the first benchtop next-generation sequencer - ion proton™ sequencer

Post on 04-Aug-2015

1.028 Views

Category:

Technology

0 Downloads

Preview:

Click to see full reader

TRANSCRIPT

Ion Proton™ SystemIon Proton™ SystemyyJanuary 2012

The content provided herein may relate to products that have notbeen officially released and is subject to change without notice.

Highly Disruptive Technologies E EEmpower Everyone

Main Frame  Mini Computer  Personal Computer

Technology generations are defined by who can use themSanger Sequencing Next‐Gen Sequencing Ion Semiconductor Sequencing

2

Technology generations are defined by who can use them

Semiconductors Disrupt Industries

3

Ion’s Semiconductor Chip Sees Chemistry

Leverages $1 Trillion investment and $50 Billion annual spend

Ion Semiconductor Chip Digital InformationBiological Information

Leverages $1 Trillion investment and $50 Billion annual spend

4

Ion PGM™ Sequencer: The Fastest Selling Sequencer in the WorldThe Fastest Selling Sequencer in the World

• Speed:1 5 hour runsSpeed:1.5 hour runs

• Scalability:10 Mb to 1 Gb

• Simplicity: AutomatedSimplicity: Automated workflows, benchtop convenience

Aff d bl• Affordable

5

The Promise of Semiconductor Sequencing First 100 Fold Scaling Delivered and More

A hi d i 2011

First 100-Fold Scaling Delivered and More

Achieved in 2011• 100-fold scaling and 200 bp kits,

525 base perfect reads achievedIon 318™ Chip*

• Breakthrough Ion AmpliSeq™ app, microbial and RNA-seq apps

• 5,000 member Ion CommunityIon 316™

Chip

2012 Roadmap• 2 x 200 paired end kit, 400 bp kits

Ion 314™ Chip

• Custom and fixed AmpliSeq™ panels

• FDA submission and CE-IVD certificationcertification

6 The content provided herein may relate to products that have notbeen officially released and is subject to change without notice.

Introducing Ion Proton™ ChipsThe Next 100 Fold ScalingThe Next 100-Fold Scaling

7 The content provided herein may relate to products that have notbeen officially released and is subject to change without notice.

$500 Exome and $1,000 Genome Sequencing in a Few Hours on the BenchtopSequencing in a Few Hours on the Benchtop

Ion Proton™ I Chip Ion Proton™ II Chip

2 human exomes165 million wells

1 human genome660 million wells

$1,000 per run $1,000 per run

Highest ThroughputHighest Throughput8 The content provided herein may relate to products that have not

been officially released and is subject to change without notice.

Introducing the Ion Proton™ SequencerThe Benchtop Genome CenterThe Benchtop Genome Center

9 The content provided herein may relate to products that have notbeen officially released and is subject to change without notice.

Introducing the Ion Proton™ SequencerThe Benchtop Genome CenterThe Benchtop Genome Center

10 The content provided herein may relate to products that have notbeen officially released and is subject to change without notice.

Introducing the Ion Proton™ SequencerThe Benchtop Genome CenterThe Benchtop Genome Center

11 The content provided herein may relate to products that have notbeen officially released and is subject to change without notice.

Introducing the Ion Proton™ Sequencer The Benchtop Genome CenterThe Benchtop Genome Center

• Supports Ion Proton™ I and Proton™ II chipsProton II chips

• $149K List Price (USD)– $99K for Ion PGM™ owners

• State-of-the-art electronics to support highest throughput

12 The content provided herein may relate to products that have notbeen officially released and is subject to change without notice.

…and Rack-Mountable!

Broad Baylor and Yale have already

13

Broad, Baylor, and Yale have alreadysigned up for this configuration

The content provided herein may relate to products that have notbeen officially released and is subject to change without notice.

Harnessing a Decade of Moore’s Law in O LOne Leap…

Nature 475 348–352 (21 July 2011)

Ion Proton™ I Chip: 165 million wells (>100-fold more wells than Ion 314™ Chip)

Nature 475, 348 352 (21 July 2011)

( 100 fold more wells than Ion 314 Chip)

14 The content provided herein may relate to products that have notbeen officially released and is subject to change without notice.

…While Seamlessly Scaling Ion’s PostLight™ S i Ch i tSequencing Chemistry

Ion 314™ Chip Signal Ion Proton™ I Chip SignalIon 314™ Chip Signal Ion Proton™ I Chip SignalNucleotide Incorporation Signal

Same Signal Same Speed

15

Same Signal, Same SpeedInternally generated R&D data shown

The content provided herein may relate to products that have notbeen officially released and is subject to change without notice.

Maintaining 200 Base Read Lengths

200 Base Q20 Reads on Ion Proton™ I Chip

TCTTCTTCTGGCTGCCAGCACGCCGGTTGTAGTGGGATCTCTTCGCGATC||||||||||||||||||||||||||||||||||||||||||||||||||TCTTCTTCTGGCTGCCAGCACGCCGGTTGTAGTGGGATCTCTTCGCGATC1 10 20 30 40 50

AAACGCCAGATCACCCCCGTTAACCACTTCAGAACCGTGGGTGATGACCT||||||||||||||||||||||||||||||||||||||||||||||+|||AAACGCCAGATCACCCCCGTTAACCACTTCAGAACCGTGGGTGATG-CCT51 60 70 80 90 100

TTGAAATCGAATCAGGTTGGTATCGCACAGATGCGACGGCACCACATTCT|||||||||||+||||||||||||||||||||||||||||||||||||||TTGAAATCGAA-CAGGTTGGTATCGCACAGATGCGACGGCACCACATTCTTTGAAATCGAA CAGGTTGGTATCGCACAGATGCGACGGCACCACATTCT101 110 120 130 140 150

GCATCGCGCTGAACATCGTCTCGATACGCCCTGGATAACGTTTATCCCAG||||||||||||||||||||||||||||||||||||||||||||||||||GCATCGCGCTGAACATCGTCTCGATACGCCCTGGATAACGTTTATCCCAG151 160 170 180 190 200

TCA|||TCA201

16Internally generated R&D data shown

The content provided herein may relate to products that have notbeen officially released and is subject to change without notice.

Single Day Workflow with Highest Throughput

Ion Proton™O T h S t

Ion Proton™ Sequencer Proton™ Torrent ServerIon Kits

17

OneTouch System

The content provided herein may relate to products that have notbeen officially released and is subject to change without notice.

Streamlined Bioinformatics InfrastructureServer Room & Informaticists in a Box and in the CloudServer Room & Informaticists in a Box and in the Cloud

Ion Reporter™Solution

Proton™ Torrent ServerProton Torrent Server and Torrent Suite Software

18 The content provided herein may relate to products that have notbeen officially released and is subject to change without notice.

Overcoming Data Bottlenecks

Full Genomes in Ion Reporter™ High DataHours vs. Weeks

Single genome sequencing in hours

pSolution

Flexible cloud-based solution to manage

gQuality

More uniform coverage enables higher quality sequencing in hours

greatly eases analysis bottleneck (vs. batch-processing)

solution to manage, annotate, and archive variants of interest for future interpretation

variant calls with less raw data. Longer reads enable better mappability with less raw data

19 The content provided herein may relate to products that have notbeen officially released and is subject to change without notice.

Ion Proton™ System Availability

January 2012 Ion Proton™ System available for quotesJanuary 2012 Ion Proton System available for quotes

Ion Proton™ I Chip to commence shipment (Ion Proton™ II Chip to be available 6 months later)Early Access for 4-unit rack-mounted configuration

Mid-2012Early Access for 4 unit rack mounted configuration

Unrestricted launch of Ion Proton™ Sequencer and standalone Proton Torrent™ Server to commenceEnd of Q3:2012

20 The content provided herein may relate to products that have notbeen officially released and is subject to change without notice.

Ion Semiconductor SequencingRapid Benchtop Sequencing for AllRapid, Benchtop Sequencing for All

Genes GenomesIon 3 Series Chips Ion Proton™ Chips

1”1.25”

Ion 3-Series Chips Ion Proton™ Chips

Ion PGM™ Sequencer21

Ion Proton™ SequencerThe content provided herein may relate to products that have notbeen officially released and is subject to change without notice.

Unprecedented Scaling Every 6 Months

22 The content provided herein may relate to products that have notbeen officially released and is subject to change without notice.

Enabling All Applications

23 The content provided herein may relate to products that have notbeen officially released and is subject to change without notice.

5500 Wildfire

24 The content provided herein may relate to products that have notbeen officially released and is subject to change without notice.

Wildfire Offered to Existing 5500 Customers Mid-2012 DeliveryMid-2012 Delivery

Wildfire simplifies workflow and improves economics while retaining ultra high accuracy and pay-per-lane sequencingg g y p y p q g1.Simpler Workflow: 2 hour on flowchip template preparation2.Lower Price / Gb: $25 / Gb guaranteed3.Higher Throughput: > 20 Gb / day throughputg g p y g p

25 The content provided herein may relate to products that have notbeen officially released and is subject to change without notice.

Purchasing Options for 5500 and SOLiD C tSOLiD Customers

• Ion Proton™ Sequencer + Wildfire upgrade q pg(discounted package for 5500 customers)

• Ion Proton™ Sequencer + 5500 Wildfire(discounted package for SOLiD customers)

• Ion Proton™ Sequencer(discounted, standalone for 5500/SOLiD)

• Wildfire upgrade(list price, standalone for 5500/SOLiD)

26 The content provided herein may relate to products that have notbeen officially released and is subject to change without notice.

All products mentioned in this presentation are for Research Use Only, t i t d d f i l h th ti di ti

Confidential and Proprietary—DO NOT DUPLICATE27

not intended for any animal or human therapeutic or diagnostic use.

top related