tapi-1 · 2020. 6. 23. · tapi-1 inhibits ectodomain shedding of tnf-ɑ, l-selectin, and p55...
Post on 26-Jan-2021
6 Views
Preview:
TRANSCRIPT
-
1 | www.apexbt.com
TAPI-1Cat. No.: B4686
CAS No.: 171235-71-5
Formula: C26H37N5O5
M.Wt: 499.6
Synonyms:
Target: Proteases
Pathway: MMP
Storage: Store at -20°C
In Vitro
24.98mg/mL in DMSO
Preparing
Stock Solutions
Mass
1mg 5mg 10mgSolvent
Concentration
1 mM 2.0016 mL 10.0080 mL 20.0160 mL
5 mM 0.4003 mL 2.0016 mL 4.0032 mL
10 mM 0.2002 mL 1.0008 mL 2.0016 mL
Please refer to the solubility information to select the appropriate solvent.
Shortsummary TACE/ADAM17 inhibitor
IC₅₀ & Target
In Vitro
Cell Viability Assay
Cell Line: human pulmonary mucoepidermoid carcinoma cell line, NCI-H292 cells
Preparation method The solubility of this compound in DMSO is > 10 mM. General tips for obtaining
a higher concentration: Please warm the tube at 37 °C for 10 minutes and/or
shake it in the ultrasonic bath for a while. Stock solution can be stored below
-20°C for several months.
Reacting conditions: 30 min, 30 μM [1]
Applications: TAPI-1, tumor necrosis factor ɑ protease inhibitor-1, is an inhibitor of TACE
Product Name: TAPI-1Revision Date: 01/10/2020
Product Data Sheet
Solvent & Solubility
Biological Activity
1 | www.apexbt.com
TAPI-1Cat. No.: B46888888888866666666666
CAS No.: 1717771777717171717117177171712121212121212121223535353533535353535355355------7177777777777 -5
Formula: C2CC2C2C2C2CCC2C2C2C2C2CC26H37N5O5
M.Wt: 499.6
Synonyms:
Target: Proteases
Pathway: MMP
Storage: Store at -20°C
In Vitro
24.98mg/mL in DMSO
Preparing
Stock Solutions
Mass
1mg 5mg 10mgSolvent
Concentration
1 mM 2.0016 mL 10.0080 mL 20.0160 mL
5 mM 0.4003 mL 2.0016 mL 4.0032 mL
10 mM 0.2002 mL 1.00000000000080808080808088080808080 mmmmmmmmmmmLLLLLLLLLL 2.0016 mL
Pleaaaaaaaaasesesseseseseseseeeseeeeese rrrrrrrrrrefefefefefefefeffeeeeefeefe erererererererererer ttttttttttto oooooooooo ttthttt e solubility information to select the appropriate solventntnttnttttntt.
Shortsummary TACE/ADAM17 inhibitor
IC₅₀ & Target
In Vitro
Cell Viability Assay
Cell Line:e:e:e:e:e:e:eee human pulmonary mucoepidermoid carcinononononoonononon mamamamamamamamamamammm ccccccccccceeleleeleleleleleeleleleleeleeele lllllllllllllll lilililililililililililinnennnnnnn , NCI-H292 cells
PrPrPrPrrPrPrPrPrPrPP epepepepepepeepepepepepararaarararararara atataatattttatattttataatttatatiiiiiioioioiiioioioioioioioooooionnn n nnn nnnnnn method The solubility of this compound in DDDDDDDMSMSMSMSMSMSSMSMSMSMSMSMSMMSM OOOOOOOOOOOOOOOOOOOO isisisisisisisisisiii >>>>>>>>>>>> 111111111111100000 mM. General tips for obtaining
a higher concentration: Please wararararrararrrarrmmmmmmmmmmmmmmm ththththththththththththhhe tube at 37 °C for 10 minutes and/or
shake it in the ultrasonic bath for a while. Stock solution can be stored below
-20°C for several months.
Reacting conditions: 30 min, 30 μM [1]
Applications: TAPI-1, tumor necrosis factor ɑ protease inhibitor-1, is an inhibitor of TACE
Product Name: TAPI-1Revision Date: 01/10/ 02020
etProduct Data Shee
Solvent & Soluuuuuubbbbbbiiiiiillllllllliiiittttttttyyyyyyyyyy
Biologicaaaallllll AAAAAAActivity
-
2 | www.apexbt.com
(TNF-α converting enzyme). TAPI-1 inhibits ectodomain shedding of TNF-ɑ,
L-selectin, and p55 TNF-ɑ receptor. Pretreating cells with TAPI-1 inhibits
PMA-induced EGFR phosphorylation. Besides, TAPI-1 could block TGF-ɑ
release and block the production of mucin induced by PMA, PA sup, and LPS
[1]. TAPI-1 is also a general matrix metalloproteinase (MMP) and ADAM
inhibitor [2].
In VivoAnimal experiment
Applications:
1. Zhou J, Sun J, et al. "MicroRNA-145 overexpression attenuates apoptosis and increases matrixsynthesis in nucleus pulposus
cells." Life Sci. 2019 Mar 15;221:274-283.PMID:30797016
2. Ellis-Connell AL, Balgeman AJ, et al. "ALT-803 transiently reduces SIV replication in the absence of antiretroviraltreatment." J Virol.
2017 Nov 8. pii: JVI.01748-17.PMID:29118125
See more customer validations on www.apexbt.com.
[1]. Shao MX, Ueki IF, Nadel JA. Tumor necrosis factor alpha-converting enzyme mediates MUC5AC mucin expression in cultured
human airway epithelial cells. Proc Natl Acad Sci U S A. 2003 Sep 30;100(20):11618-23.
[2]. Chen CD, Podvin S, Gillespie E, Leeman SE, Abraham CR. Insulin stimulates the cleavage and release of the extracellular
domain of Klotho by ADAM10 and ADAM17. Proc Natl Acad Sci U S A. 2007 Dec 11;104(50):19796-801.
FOR RESEARCH PURPOSES ONLY.NOT FOR HUMAN, VETERINARY DIAGNOSTIC OR THERAPEUTIC USE.Specific storage and handling information for each product is indicated on the product datasheet. Most APExBIO products are stable
under the recommended conditions. Products are sometimes shipped at a temperature that differs from the recommended storage
temperature. Shortterm storage of many products are stable in the short-term at temperatures that differ from that required for
long-term storage. We ensure that the product is shipped under conditions that will maintain the quality of the reagents. Upon receipt
of the product, follow the storage recommendations on the product data sheet.
APExBIO Technologywww.apexbt.com
7505 Fannin street, Suite 410, Houston, TX 77054.
Product Citations
References
Caution
2 | www.apexbt.com
(TNF-α converting enzyme). TAPI-1 inhibits ectodomain shedding of TNF-ɑ,
L-selectin, and p55 TNF-ɑ receptor. Pretreating cells with TAPI-1 inhibits
PMA-induced EGFR phosphorylation. Besides, TAPI-1 could block TGF-ɑ
release and block the production of mucin induced by PMA, PA sup, and LPS
[1]. TAPI-1 is also a general matrix metalloproteinase (MMP) and ADAM
inhibitor [2].
In VivoAnimimmimmmmmmmalalalalalalalaalaa exexexexexxxxexexexexxxxxxexppppepepppepepepepppepepepeeppepepeep riririririririririririment
ApApApApApApApApApAAAAAAAAAAA plplplplplpplplplplicicicicicicicicciciccataatatatatatatatatataa iiioii ns:
1. Zhou J, Sun J, et al. "MicroRNA-145 overexpression attenuates apoptosis and increases matrixsynthesis in nucleus pulposus
cells." Life Sci. 2019 Mar 15;221:274-283.PMID:30797016
2. Ellis-Connell AL, Balgeman AJ, et al. "ALT-803 transiently reduces SIV replication in the absence of antiretroviraltreatment." J Virol.
2017 Nov 8. pii: JVI.01748-17.PMID:::::::292929292929929292929118125
See more customer validaaaaaaaaaaaatititittittitititit ononononononononononononssssssssssss oooooonoooooooo www.apexbt.com.
[1]. Shao MX, Ueki IF, Nadel JA. Tumor necrosis factor alpha-converting enzyme mediates MUC5AC mucin expression in cultured
human airway epithelial cells. Proc Natl Acad Sci U S A. 2003 Sep 30;100(20):11618-23.
[2]. Chen CD, Podvin S, Gillespie E, Leeman SE, Abraham CR. Insulin stimulates the cleavage and release of the extracellular
domain of Klotho by ADAM10 and ADAM17. Proc Natl Acad Sci U S A. 2007 Dec 11;104(50):19796-801.
FOR RESEARCH PURPOPOPOPOPOPOPOPOPOPOPOSESESESESESEESESESESESSSS S SSSSSS SSSSSS OOOOONONONONONOONONOONONONONNONLYLLL .NOT FOR HUMAAN,N,N,N,N,N,N,,, VVVVVVVVVVVVVETETETETETETETTETETETETERERERERERERERERERERRERRININININININININININININARAAA Y DIAGNOSTIC OR THERAPEUTTIC USE.Specific storage aaaaaaaaaaaaaandndndndndndndnddndnddndndnnd hhhhhhhhhhhhhhhhhhhaananananananananaananaanaaanaa dld ing information for each product is indicatted on the product datasasasasasaasshhehhhhhhh et. Most APExBEE IO ble products are stab
under the recommended conditions. Products are sometimes shipped at a temperature that differs from the recommended storageed at a temperature that differs from the recommended storag
temperature. Shortterm storage of many products are stable in the sshort-term at temperatures that differ from that required for
long-term storage. We ensure that the product is shipped under conditions that will maintain the quality of the reagents. Upon receipt e
of the product, follow the storage recommendations on the product ddata sheet.
APExBIO Teechnologywww.apexbt.comxbt com
7505 Fannin street, Suite 410, Houston, TX 77054.
Product Citations
Referrrrreeeeeeennnnnncccccccccccceeeees
Caution
-
3 | www.apexbt.com
Tel: +1-832-696-8203 | Fax: +1-832-641-3177 | Email: info@apexbt.com
3 | www.apexbt.com
Tel: +1-832-696-8203 | Fax: +1-832-641-3177 | Email: info@apexbt.com
top related