systematic identification of mirna targets and the …
Post on 09-Jan-2022
3 Views
Preview:
TRANSCRIPT
SYSTEMATIC IDENTIFICATION
OF MIRNA TARGETS
AND
THE STEPS IN GENE EXPRESSION
REGULATED BY MIRNAS
A DISSERTATION
SUBMITTED TO THE DEPARTMENT OF CHEMICAL AND
SYSTEMS BIOLOGY
AND THE COMMITTEE ON GRADUATE STUDIES OF
STANFORD UNIVERSITY
IN PARTIAL FULFILLMENT OF THE REQUIREMENTS
FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
David Gillis Hendrickson
December 2009
http://creativecommons.org/licenses/by-nc/3.0/us/
This dissertation is online at: http://purl.stanford.edu/hh427ys1294
© 2010 by David Gillis Hendrickson. All Rights Reserved.
Re-distributed by Stanford University under license with the author.
This work is licensed under a Creative Commons Attribution-Noncommercial 3.0 United States License.
ii
I certify that I have read this dissertation and that, in my opinion, it is fully adequatein scope and quality as a dissertation for the degree of Doctor of Philosophy.
James Ferrell, Jr, Primary Adviser
I certify that I have read this dissertation and that, in my opinion, it is fully adequatein scope and quality as a dissertation for the degree of Doctor of Philosophy.
James Chen
I certify that I have read this dissertation and that, in my opinion, it is fully adequatein scope and quality as a dissertation for the degree of Doctor of Philosophy.
Andrew Fire
I certify that I have read this dissertation and that, in my opinion, it is fully adequatein scope and quality as a dissertation for the degree of Doctor of Philosophy.
Tobias Meyer
Approved for the Stanford University Committee on Graduate Studies.
Patricia J. Gumport, Vice Provost Graduate Education
This signature page was generated electronically upon submission of this dissertation in electronic format. An original signed hard copy of the signature page is on file inUniversity Archives.
iii
iv
Abstract
In the last decade, RNA interference (RNAi), the process by which small RNAs direct
the post-transcriptional silencing of cognate mRNA transcripts has revolutionized
longstanding paradigms about RNA function. In addition, researchers have harnessed
this pathway for experimentally induced gene silencing in what is arguably one of the
most important technological advances in modern biology. Disruption of the RNAi
pathway results in aberrant development, cancer, and embryonic death suggesting that
RNAi is an integral component of eukaryotic gene expression programming. Although
RNAi is a vast and diverse pathway with marked distinctions between species, the
basic organization has been established largely from work carried out in worms, flies,
humans, and mice. Double stranded RNA (dsRNA) inputs are “diced” by the class III
ribonuclease Dicer into small dsRNA intermediates of ~21-22 nucleotides (nt) in
length which are transferred to the RNA induced silencing complex (RISC) wherein
the guide strand is selected and bound to an Argonaute (Ago) family protein. Target
mRNAs are then recruited to RISC through Watson-Crick base pairing to the guide
strand. Silencing of target transcripts can be directed by Ago mediated cleavage, or
through Ago mediated recruitment of factors that induce translational inhibition and
mRNA degradation. MicroRNAs (miRNAs) are the most common class of
endogenous small silencing RNAs. Many of the molecular details of RISC mediated
gene silencing are poorly understood as current models are based on only a few
miRNA:mRNA target pairs. Here, we present a method for systematic identification of
specific miRNA targets. We demonstrate that immuno-affinity purification (IP) of
Argonaute proteins is a viable method for isolating RISC associated miRNAs and
mRNAs for identification using DNA microarrays. The strong enrichment of mRNAs
with binding sites to the experimentally introduced miR-1 and miR-124 in Ago IPs
from human embryonic kidney 293T cells (HEK293T) validates the utility of this
method. Furthermore, mRNAs classified as targets of miR-1 and miR-124 using this
approach behave like bona fide targets in that they exhibit significant down-regulation
at the mRNA level. To learn about the steps in gene expression regulated by miRNAs,
v
we simultaneously measured miR-124 mediated changes in Ago enrichment, mRNA
abundance, and ribosome occupancy and ribosome density for ~8,000 genes. The
translational parameters were used to estimate apparent changes in translational rate
and were collected using standard polysome profiling in tandem with DNA
microarrays and a novel gradient encoding scheme. We found that for the majority of
the miR-124 targets, changes in mRNA concentration and apparent translation rate are
concordant and that ~75% of the estimated change in protein levels could be
accounted for by changes in mRNA abundance. Our data is most consistent with
models of miRNA inhibition of translation initiation. To rule out miRNA mediated
repressive mechanisms that would not be visible to our translational profiling
(concordant reductions in translational initiation and elongation, co-translational
proteolysis) we tested the protein levels for 13 targets by Western blot and found that
our estimated changes in protein were nearly identical to the actual changes for 12/13
of the proteins measured. In addition, we observed a large dynamic range for miR-124
mediated down-regulation of mRNA abundance and apparent translation rate, and
estimated protein abundance demonstrating the versatility of miRNA mediated
regulation. The concordance between miR-124 specific changes in mRNA level and
translation supports a model wherein these two regulatory outcomes are functionally
linked in a sequential process or regulated by the same cis factors.
We have also sought to learn about the RNAi pathway from a Dicer-centric
perspective. We generated a library of Dicer truncations to test the contribution of
Dicer‟s conserved protein domains to in vitro dicing reactions to learn about
potentially interesting in vivo function as well as for increasing the efficacy of in vitro
dicing as a gene silencing tool. We found that the domain of unknown function 283
(DUF283) may be important for proper spacing in dicing reactions and is part of
Dicer‟s “molecular ruler”. In addition we found that the ATPase/Helicase domains
may inhibit Dicer activity and are dispensable for in vitro dicing, but may play a role
in non-canonical substrate recognition.
vi
Acknowledgements
I would like to thank my parents, Connie and Bill Hendrickson.
vii
Table of Contents
Abstract .......................................................................................................................... iv
Acknowledgements ....................................................................................................... vi
Table of Contents ......................................................................................................... vii
Table of Figures ............................................................................................................ xii
Table of Tables ............................................................................................................ xiv
Chapter 1: Introduction ................................................................................................... 1
Background ................................................................................................................ 1
Overview ............................................................................................................................ 1
The RNAi “Triggers” ......................................................................................................... 3
miRNA/siRNA Biogenesis................................................................................................. 7
Dicer: Structure and Function ............................................................................................ 8
Argonaute Proteins and the RISC complex ...................................................................... 13
miRNA Targeting ............................................................................................................. 15
miRNA Regulation ........................................................................................................... 17
Scope of this Work ................................................................................................... 23
Dicer Domain Function .................................................................................................... 23
Systematic Identification of miRNA Targets ................................................................... 23
Steps in Gene Expression Regulated by miRNAs ............................................................ 24
Chapter 2: Potential Roles for Conserved Dicer Domains in in vitro Dicing .............. 25
Abstract .................................................................................................................... 25
Introduction .............................................................................................................. 26
Results ...................................................................................................................... 30
Generation of a Dicer mutant library ............................................................................... 30
ATPase/Helicase domain ................................................................................................. 30
DUF283 domain ............................................................................................................... 30
viii
PAZ .................................................................................................................................. 32
RNAse Domains ............................................................................................................... 32
Domain Requirements for Efficient Dicing and Properly Sized siRNAs ........................ 34
Discussion ................................................................................................................ 38
Materials and Methods ............................................................................................. 41
Primers Dicer Domains and Point mutations ................................................................... 41
Protein Expression ............................................................................................................ 43
In vitro Dicing Assays ...................................................................................................... 43
Chapter 3: Systematic Identification of mRNAs Recruited to Argonaute 2 by Specific
microRNAs and Corresponding Changes in Transcript Abundance ............................ 44
Abstract .................................................................................................................... 45
Introduction .............................................................................................................. 46
Results ...................................................................................................................... 49
A Method for Isolating and Identifying miRNAs and mRNAs Associated With Ago2 .. 49
Effects of Ago2 Overexpression on mRNA and miRNA Profiles ................................... 51
Systematic Identification of mRNAs Regulated by miR-1 and miR-124 ........................ 54
Seed Matches in the 3‟-UTRs of Putative miR-1 and miR-124 Targets .......................... 56
Relationship Between Overrepresentation in Ago2 Immunopurifications and
Underrepresentation in the Bulk mRNA Pool .................................................................. 58
Relationship Between Size and Number of Seed Matches and Overrepresentation in
Ago2 Immunopurifications .............................................................................................. 61
Analysis of Putative Target mRNAs that Lack 3‟-UTR Seed Matches ........................... 63
Estimation of the Number of mRNAs Regulated by miR-1 and miR-124 ....................... 66
Functions of the High Confidence miR-1 and miR-124 Targets ...................................... 66
Using Ago2 Immunopurification Enrichment and mRNA Expression Changes to Assess
Computational Target Prediction Methods ...................................................................... 68
Discussion ................................................................................................................ 70
A Direct Assay to Identify Targets of Specific miRNAs ................................................. 70
ix
Functional Insights into miRNA Targeting and Regulation ............................................. 71
Insights into miRNA-based Regulation From Recent, Related Publications ................... 72
Materials and Methods ............................................................................................. 76
Plasmids and oligonucleotides ......................................................................................... 76
Cell culture and transfection ............................................................................................. 76
Imunoaffinity purification and RNA isolation ................................................................. 76
Western blots, Sypro Staining, and Nucleic Acid PAGE ................................................. 77
Microarray Production and Pre-hybridization Processing ............................................... 78
Sample Preparation, Hybridization and Washing ............................................................ 79
Scanning and Data Processing ......................................................................................... 80
Microarray Analyses ........................................................................................................ 81
Sequence Data .................................................................................................................. 81
Conservation of Seed Match Sites .................................................................................... 81
Sequence Analyses ........................................................................................................... 81
miRNA Target Predictions ............................................................................................... 82
Gene Ontology and Gene-set Analyses ............................................................................ 82
Acknowledgements .......................................................................................................... 82
Supplementary Figures ............................................................................................. 83
Chapter 4: Concordant Regulation of Translation and mRNA Abundance for
Hundreds of Targets of a Human microRNA ............................................................... 87
Abstract .................................................................................................................... 88
Introduction .............................................................................................................. 89
Results ...................................................................................................................... 92
Systematic Identification of mRNAs Recruited to Argonautes by miR-124 ................... 92
Systematic Measurement of mRNA Translation Profiles ................................................ 95
mRNA Recruitment to Argonautes by miR-124 Leads to Modest Decreases in
Abundance and Translation Rate ................................................................................... 100
x
miR-124 Affects Both the Ribosome Occupancy and Ribosome Density of Hundreds of
Targets ............................................................................................................................ 104
The Effects of miR-124 Transfection on Protein Products of miR-124 Targets ............ 108
Concordant Changes in Abundance and Translation of mRNAs Targeted by miR-124
Suggests That These Two Regulatory Outcomes Are Functionally Linked .................. 110
Changes in Abundance and Translation of miR-124 Ago IP Targets with Seed Matches in
3′-UTRs, Coding Sequences, and 5′-UTRs .................................................................... 114
Efficiency of Recruitment to Argonautes by miR-124 Seed Matches Correlates with
Effects on Both mRNA Abundance and Translation ..................................................... 115
Discussion .............................................................................................................. 116
Materials and Methods ........................................................................................... 121
Plasmids and Oligonucleotides ...................................................................................... 121
Cell Culture and Transfection ........................................................................................ 121
Preparation of Beads for Immunopurifications .............................................................. 121
Immunoaffinity Purifications ......................................................................................... 122
Western Blots ................................................................................................................. 122
Preparation of Cell Extracts for Translation Profiling ................................................... 123
Sucrose Gradient Preparation ......................................................................................... 124
Sucrose Gradient Velocity Sedimentation...................................................................... 124
Gradient Encoding .......................................................................................................... 124
DNA Microarray Production and Prehybridization Processing ..................................... 125
DNA Microarray Sample Preparation, Hybridization, and Washing ............................. 125
Scanning and Data Processing ....................................................................................... 127
Microarray Analyses ...................................................................................................... 129
Sequence Data ................................................................................................................ 130
Acknowledgments .......................................................................................................... 130
Supplementary Figures ........................................................................................... 131
Chapter 5: Concluding Remarks ................................................................................ 145
xi
Dicer Domain Function .......................................................................................... 145
Systematic Identification of miRNA Targets and Steps in Gene Expression
Regulated by miRNAs ............................................................................................ 147
Appendix .................................................................................................................... 153
Text S1. miRNA-effector Complexes Appear to Nonspecifically Bind Streptavidin
Coated Dynal Beads. .............................................................................................. 153
Text S2. Enrichment of Seed Matches to Highly-expressed miRNAs in Ago IPs
from Mock Transfected Cells. ................................................................................ 155
Text S3. Relationship Between Ribosome Occupancy in Mock-Transfected Cells
and the Change in Ribosome Occupancy Following Transfection of miR-124. .... 156
Text S4. Evaluation of the Significance of the Correlation between Changes in
mRNA Abundance and Translation of miR-124 Ago IP targets Following
Transfection with miR-124. ................................................................................... 158
References .................................................................................................................. 160
xii
Table of Figures
Figure 1. The Origins and Biogenesis of Small Guiding RNAs[139] ............................ 9
Figure 1. Generation of Dicer Mutant Library ............................................................. 31
Figure 2. Western Analysis of Insect Cells Expressing Dicer Variants ....................... 33
Figure 3. The PAZ and DUF283 Domains are Required for Efficient Dicing in vitro 35
Figure 4. Generation of Diced siRNAs by DPR and FL Dicer .................................... 37
Figure 1. Ago2 Association with Dicer and miRNAs. ................................................. 50
Figure 2. Overexpression of FLAG-Ago2 Does Not Perturb Overall mRNA
Expression or miRNA Expression. ............................................................................... 53
Figure 3. Comparison of mRNA and miRNA Specifically Associated With Ago2 in
the Absence or Presence of miR-1 or miR-124. ........................................................... 55
Figure 4. Significantly Enriched Motifs in 3′-UTRs Targeted to Ago2 by miR-1 and
miR-124. ....................................................................................................................... 59
Figure 5. Relationship Between Overrepresentation in Ago2 IP and Changes in mRNA
Levels Due to miR-1 and miR-124. ............................................................................. 62
Figure 6. Comparison of Expression Changes of mRNAs Containing Seed Matches in
3′-UTRs and Coding Sequences of miR-1 and miR-124 Ago2 IP Targets. ................. 65
Figure 7. Estimation of the Number of miR-1 and miR-124 Targets. ......................... 67
Figure S1. Disassociation of Dicer from Ago2 IPs in 300 mM KCL .......................... 83
Figure S2. The Length and Number of 3′-UTR Seed Match Sites to miR-1 and miR-
124 Correlates With Enrichment in Ago2 IPs. ............................................................. 84
Figure S3. Using Ago2 IP Enrichment and mRNA Expression Changes to Assess
Computational Target Prediction Methods. ................................................................. 85
Figure 1. miR-124 Recruits Hundreds of Specific mRNAs to Argonautes. ................ 94
Figure 2. Systematic Translation Profiling by Microarray Analysis. ........................... 96
Figure 3. Analysis of Ribosome Occupancy and Ribosome Density in HEK293T
Cells. ............................................................................................................................. 99
Figure 4. miR-124 Negatively Regulates the Abundance and Translation of mRNA
Targets. ....................................................................................................................... 102
xiii
Figure 5. miR-124 Ago IP Targets Decrease in Ribosome Occupancy and Ribosome
Density Due to the Presence of miR-124. .................................................................. 106
Figure 6. The Effect of miR-124 Transfection on Protein Production of miR-124
Targets ........................................................................................................................ 111
Figure 7. Concordant Changes in mRNA Abundance and Translation of miR-124 Ago
IP Targets. ................................................................................................................... 113
Figure S1. mRNA Enrichment Profiles in Ago IPs. ................................................... 131
Figure S2. Streptavidin-coated Dynal Beads Weakly Enrich miR-124 Targets After
miR-124 Transfection. ................................................................................................ 132
Figure S3. Polysome Profiles and Doping Control Fits. ............................................ 133
Figure S4. miR-124 Ago IP Targets Are Likely Destroyed, Rather than Deadenylated
and Stored. .................................................................................................................. 135
Figure S5. Relationship Between the Coding Sequence Length and Changes in
Ribosome Occupancy and Ribosome Density of miR-124 Ago IP Targets Following
Transfection of miR-124. ........................................................................................... 136
Figure S6. Relationship Between Ribosome Occupancy in Mock-transfected Cells and
Change in Ribosome Occupancy Following Transfection of miR-124. .................... 137
Figure S7. Significance of the Correlation Between Changes in mRNA Abundance
and Translation of miR-124 Ago IP Targets. ............................................................. 139
Figure S8. Concordant Changes in mRNA Abundance and Translation of miR-124
Ago IP Targets with 7mer 3′-UTR Seed Matches and miR-124 Ago IP Targets that
Lack a 7mer 3′-UTR Seed Match. .............................................................................. 140
Figure S9. Changes in Abundance and Translation of miR-124 Ago IP Targets With
Seed Matches in 3′-UTRs, Coding Sequences and 5′-UTRs. ..................................... 141
Figure S10. Efficiency of Recruitment to Argonautes by miR-124 Seed Matches
Correlates with Effects on Both mRNA Abundance and Translation. ....................... 143
xiv
Table of Tables
Table 1. Enrichment of seed match sites to miR-1 and miR-124 in Ago2 IP targets
(1% local FDR). ............................................................................................................ 57
Table S1. Summary of miR-124 Targets for Western Blot Analysis. ........................ 144
1
Introduction
Background
Overview
A large focus in modern biology has been the description and discernment of the
mechanisms responsible for the regulation of coherent gene expression programs
required for a cell to respond to external stimulation for the purposes of development
and adaptation. In the past, much emphasis was placed on transcription factors and the
mechanisms by which stimuli are converted into coordinated gene expression patterns.
Likewise, some work has dealt with elucidation of the specific control of mRNA
decay rate as the balance of transcription and mRNA degradation define an mRNAs
half life, and to some extent, the abundance of the cognate proteins. As the correlation
between mRNA and protein abundance is inadequate for predictive purposes for non-
structural genes, many biologists have begun to study post transcription regulatory
mechanisms that control mRNA translation rate and protein stability [1,2,3,4,5,6,7].
Indeed, all evidence is very suggestive that regulation of gene expression is a
multidimensional phenomenon wherein genes are targeted at all stages of production
from DNA to protein through a diverse array of mechanisms. However, other than a
few studies, most research on eukaryotic gene expression was conceptually bound by
the paradigm that the role of RNA was more passive than regulatory.
One such discovery ahead of its time was that of the heterochronic lin-4 gene in
Caenorhabditis elegans[8,9]. The lin-4 gene was identified as a regulatory factor
crucial in the down-regulation of the lin-14 protein; an event required for progression
of normal worm development[8,9]. Surprisingly, lin-4 did not encode a protein, but
rather two extremely short transcripts of only 61 and 21 nucleotides (nt) in length that
shared partial complementarity to sequence elements in the 3‟-untranslated region
(UTR) in the transcript of another gene, lin-14[8,9]. A multitude of similar small
RNAs were subsequently discovered justifying the creation of a new class of non-
2
coding RNAs named microRNAs (miRNAs)[10,11,12]. Mutagenesis of these
sequence elements in lin-14 that were complementary to the lin-4 miRNA resulted in
aberrant larval development suggesting that lin-4 regulates lin-14 expression through
an antisense-sense RNA interaction [8,9].
In plants, the phenomenon of co-suppression had been observed wherein the
introduction of transgenes designed to increase the expression pigmentation factors
resulted paradoxically in reduced expression of the factors[13,14]. Likewise, plants
were also found capable of silencing endogenous genes when exogenous copies of the
same genes were introduced as part the genetic payload of an RNA virus in what was
referred to as virus induced gene silencing (VIGS)[15,16,17,18,19]. Although small
RNAs were not specifically implicated in either observation, an RNA mediated
mechanism had been suggested as responsible for the unexplained silencing[17].
The commonality of homology dependent gene silencing shared between these
observations became apparent upon the seminal Fire et al. discovery that an
experimentally introduced double stranded RNA (dsRNA) trigger produces a robust
silencing of genes complementary to the double stranded trigger[20]. The key
breakthrough in explaining these phenomena came in 1998 when Fire and Mello, in
attempt to attenuate the expression of specific genes in C. elegans using antisense
technology, discovered a silencing response to dsRNA that was much larger in
magnitude when compared to introduction of the single stranded sense or antisense
molecules[20]. This observation has led to the discovery and description of a
mechanism broadly referred to as RNA interference (RNAi) that has presented both an
invaluable tool for biological study and a novel paradigm for thinking about the role of
the non-coding genome and RNA in the regulation of gene expression.
An entire field dedicated to understanding the regulatory functions of RNA has grown
in the decade following the recognition of RNAi as a potent form of post
transcriptional gene silencing. From this research, several salient features have
emerged. First, RNAi is a collective term, referring to several highly conserved small
3
RNA guided pathways capable of regulating mRNA stability, translation efficiency
(co-suppression, VIGS, miRNAs) heterochromatin structure, and
transcription[12,20,21,22,23,24,25,26,27,28,29,30,31,32,33].
In general, RNAi is a process unique to eukaryotes, although some bacterial species
express proteins found in RNAi pathways, and some eukaryotes, most notably
Saccharomyces cerevisiae, have not conserved fully functional RNAi pathways[34].
Historically, RNAi has been separated into two distinct phases, an initiation phase
defined by the biogenesis of the silencing agent, and the effector stage wherein the
silencing agent down-regulates the expression of its cognate complementary
targets[35]. In the initiation step, dsRNA triggers from both endogenous and
exogenous sources are processed into small RNAs between 18-26 nucleotides in
length (depending on the organism) by Dicer, a RNase III family ribonuclease
[36,37,38,39,40,41,42,43,44,45]. Following processing, one strand of the Dicer
product is incorporated into the RNA induced silencing complex (RISC) as a
mechanism for guiding the RISC complex to complementary target
mRNAs[46,47,48,49,50,51]. Argonaute (Ago) proteins are present in all forms of
RISC complexes and physically interact with guiding RNAs and are considered
central to the effector phase[48,49,51,52,53]. Upon association with the RISC
complex, mRNAs can be cleaved directly by RISC, translationally stalled, and/or
indirectly degraded through recruitment of common cellular deadenylases, nucleases,
and decapping enzymes[26,29,30,54,55,56,57,58,59,60,61]. For the purposes of
digesting the wealth of research currently describing all the aspects of RNAi, it is
helpful to review the primary focal points of study on the classification of small
triggers of the RNAi pathway and their biogenesis, the proteins involved in RNAi,
small RNA targeting, and the mechanism of their regulation to highlight unanswered
questions and promising avenues.
The RNAi “Triggers”
An important distinction concerning dsRNA triggers and the mechanism of the
silencing induced by the RISC complex lies with the triggering RNA. The manner in
4
which RNAi regulates gene expression is dependent not only on the sequence of the
input RNA, but rather on the complementarity between the small RNA its target that
determines the functional output i.e. direct cleavage versus translational
inhibition/indirect degradation[58,62,63]. Despite this ambiguity, the origin of small
RNA, along with certain structural characteristics and distinct pathways of biogenesis
are important for classifying the general function and biological roles of the three most
prevalent types of small guiding RNAs known to associate with Ago proteins, and
thus are implicated in RNAi: Small interfering RNAs (siRNAs), miRNAs, and piwi-
interacting RNAs (pi-RNAs)[64].
Small interfering RNAs (siRNAs) are ~21-22nt in length and are defined as
originating from the processive cleaving of long bimolecular dsRNA or long RNA
hairpins with significant dsRNA character[43,44,45]. The large size of siRNA
precursors allows for the generation of a diverse library of siRNAs perfectly
complementary, and thus directed, to the same targets. The Fire et al. observation of
RNAi was in fact triggered by siRNAs from exogenous added dsRNA[20]. RNAi
initiated from siRNAs results in the catalytic cleavage of target mRNAs fomenting a
precipitous drop in target mRNA/protein abundance[43,44,45]. Evidence also suggests
that siRNAs are also capable of generating and maintaining heterochromatin domains
and transcriptional silencing by guiding the RISC complexes to nascent
complementary transcripts to which RISC subsequently recruits histone/DNA methyl
transferases to drive heterochromatin formation in fission yeast[23,65,66,67]. The
mysterious gene silencing observed in co-suppression and in VIGS is mediated by
siRNAs generated from dsRNA arising from the added transgenes and RNA viruses
respectively[68]. Originally, all siRNAs were thought to arise primarily from
exogenous sources to combat intrusion from foreign genetic material belonging to
RNA viruses and any would be invaders that made use of dsRNA[68]. However,
endogenous siRNAs (endo-siRNAs) generated from transposons, centrosomes, and
mobile genetic loci, have been found in both plants in animals and are hypothesized to
protect genomic integrity by initiating destruction of the transcripts responsible for
their generation[69,70,71,72,73,74].
5
Due to the remarkable strength of the response to exogenous dsRNA in worms, RNAi
in the form of experimentally induced gene silencing is a powerful genetic tool[35].
The potency of RNAi in worms also highlights a significant divergence from the
mammalian and insect RNAi pathways. The activity of RNA dependant RNA
polymerases (RdRPs) in worms amplifies the silencing through the generation of
secondary siRNAs created from dsRNA made from the target transcript and using the
original siRNAs as primers[35,75,76,77]. Very recently, flies were found to possess an
RdRP involved in transposon silencing and are generally very amenable to the
addition and uptake of long dsRNA that can be processed by Dicer into a pool of
siRNAs[78]. However, long dsRNA over 29nt in length activates the interferon
response and cannot be used to initiate the RNAi pathway in mammalian systems[79].
RNAi has still served as an experimental boon as techniques utilizing RNAi mediated
gene silencing in mammalian systems have been developed for interrogating complex
biological systems through the addition of DNA constructs encoding short hairpin
RNAs (sh-RNAs) that act as Dicer substrates and give rise to siRNAs aimed at
specific genes of interest. Chemically synthesized siRNAs and in vitro generated diced
pools (discussed below) are also used for the induction of experimental gene silencing
in mammals[80,81,82].
Another type of triggering RNA belongs to the miRNA family first described in
worms[12]. miRNAs are small noncoding RNAs similar in length to siRNAs, but
derived from short hairpin precursor transcripts of endogenous origin whose partial
complementary pairing to target mRNAs potentially regulates expression of more than
60% of genes in many and perhaps all metazoans [9,27,59,83,84,85,86] . The 22nt and
61nt transcripts encoded by the lin-4 loci are the first observed examples of a miRNA
and its precursor[9]. The ubiquity of miRNAs and the widespread effect of their
presence can be seen in the evolutionary conservation of their binding sites in target
mRNAs as well as in the number of highly conserved distinct miRNAs; humans have
at least 400 miRNA genes and there are 140 and 110 well annotated miRNAs in flies
and worms respectively[84,86,87]. Thus, in comparison to canonical protein coding
genes, miRNAs account for ~1-2% of the coding transcriptome[87]. miRNA
6
conservation is quite variable[88]. Examples of ancestral miRNA families stretching
as far back as the emergence of the first RNAi pathways are common as are a
multitude of species specific miRNAs[59,83,88,89]. In terms of the magnitude of the
miRNA mediated gene silencing, recent work directly measuring the effect of miRNA
repression on protein abundance found that miRNAs modestly down-regulate the
expression for hundreds of proteins [90,91]. The range of miRNA repression on total
protein output on average was relatively weak, although a few targets did exhibit >4-
fold changes. Despite these reports of weak changes on protein output, disruption of
miRNA expression and/or the RNAi pathway can result in embryonic lethality, cancer,
and various other disease states suggesting that targets that are highly repressed tend to
be very important, or that the aggregate effect of numerous moderate to weak changes
on hundreds of proteins greatly impacts cellular function. [30,92,93,94,95,96,97,98].
However, these studies concentrated on the removal or addition of single miRNAs.
Most likely, cellular miRNAs target overlapping sets of genes and thus work together
to effect larger total changes than those reported for single miRNA:mRNA
interactions.
miRNAs generally share a much smaller degree of base paring with their targets and
can direct translation silencing, direct target cleavage (if there is enough
miRNA:target base pairing), and indirect degradation of target mRNAs. miRNAs are
distinct from siRNAs in that they inhibit expression of genes unrelated to the loci that
encode them, whereas siRNAs generally target the transcripts from which they arose
[9,26,29,31,33,55,87,96,99,100,101,102,103,104,105,106,107,108,109]. In spite of
extensive study, it is unclear what factors contribute to the regulatory outcomes of
miRNA:mRNA interactions or what steps in gene expression miRNAs
control[27,32,99,110,111,112].
The pi-RNAs are most recently discovered and least understood subset of small RNAs
that associate with the RNAi pathway proteins. piRNAs are distinct from both siRNAs
and miRNAs in their protein binding partners, size (24-30nt), biogenesis, and germ
cell specific expression[113].
7
miRNA/siRNA Biogenesis
Although both miRNAs and siRNAs can feed into similar effector machinery, their
biogenesis is distinct. As mentioned, the initiation phase for siRNAs is succinct. They
are generated from long dsRNA from RNA viruses, active transposons, or
experimentally added transgenes that serve as Dicer substrates[69,70,71,72]. Dicer
processes the RNA from these sources into the canonical siRNAs characterized not
only by their short length of ~21nt, but by a 3‟ 2nt overhang and hydroxyl group in
addition to a 5‟ phosphorylation[43,44,45]. The 3‟-2nt overhang signature is especially
crucial for siRNA/miRNA identification and entry into the RNAi pathway. Together,
these modifications earmark Dicer products for the RNAi effector step as these
structural constraints are required for tight binding to proteins in the RISC complex as
revealed by recent crystallographic studies[51,114,115,116,117,118,119]. miRNA
precursors, however, require two cleavages by separate ribonuclease III enzymes prior
to maturation and RISC incorporation[59]. miRNAs begin life as either intergenic or
intronic sequences transcribed by RNA polymerase II into primary microRNAs (pri-
miRNAs). Still in the nucleus, pri-miRNAs associate with the microprocessor
complex made up by the ribonuclease III Drosha and the RNA binding protein
DGCR8. Here, pri-miRNAs are converted into small hairpins between 60-100nt in
length known as precursor microRNAs (pre-miRNAs) also characterized by a 3‟-2nt
overhang recognized by Dicer[12,37,120,121,122,123,124,125,126,127]. Interestingly,
some miRNAs encoded in intronic regions bypass the Drosha step and are spliced out
of young transcripts in a structural format recognizable by Dicer[128,129,130,131].
Following Drosha cleavage, pre-miRNAs are exported from the nucleus into the
cytoplasm by way of the karyopherin Export-5 when in the presence of a RAN-GTP
cofactor. In the cytoplasm, pre-miRNAs encounter Dicer and are cleaved yet again
into the ~21nt miRNAs[120,121,123,132]. miRNAs are processed by Dicer through
the same catalytic mechanism as siRNAs and have similar properties and chemical
modifications[58]. The Dicer protein associates with RISC complex members for
expeditious handoff of newly converted Dicer products into the heart of the effector
8
complex[49,52,133,134,135,136,137,138]. The origins and biogenesis of small
guiding RNAs are outlined in figure 1[139].
Dicer: Structure and Function
Dicer proteins, like Argonautes, are central to RNAi pathways. Dicer belongs to a
class of RNases specifically evolved to recognize dsRNA. The founding member of
this family is the E. coli RNase III enzyme responsible for processing ribosomal RNA.
Current classification systems categorize RNase III enzymes based on the number
RNase III domains: class one proteins have one domain and class II proteins have
two[27]. Both Dicer and Drosha fall into the second class as both contain two separate
RNase III domains. The standard layout for most Dicer enzymes starts with an N-
terminal ATPase/helicase domain, a domain of unknown function 283 (DUF283), a
PAZ domain, two RNase III domains, and a dsRNA binding domain (dsRBD) domain
(Figure 1)[36,37,39,41,126,140,141].
The exact role of the ATPase/Helicase domain is unknown. A comparison of class II
RNase III enzymes in reveals that the Dicer helicase domain is not conserved in all
Dicers and thus might have a dispensable role in standard dicing, yet may confer
regulatory control over activity and specificity. This region is known to be important
for interactions of Dicer with binding partners which may influence Dicers activity
(below)[142]. Also, the addition of ATP to dicing reactions with drosophila Dicer2
stimulates activity whereas no such ATP preference has been observed in experiments
with human dicer[36,38,135,143]. Likewise, a recent study found that upon mutation
of key residues in the ATPase/helicase domain in human dicer, the enzymatic activity
was greatly reduced for short hairpin miRNA precursors with thermodynamically
unstable stems[144]. Interestingly, the activity of the modified dicer protein was
greater for substrates with highly stable hairpin stems[144]. Thus, the ATPase
domains may vary slightly in Dicers evolved to perform different jobs. DCR-1 and
9
Figure 1. The Origins and Biogenesis of Small Guiding RNAs[139]
10
DCR-2 in drosophila possess slightly different ATPase/helicase domain structure, and
carry out processing of miRNAs and siRNAs respectively[133].
The PAZ domain is an important feature of Dicer proteins allowing for specific
recognition of Dicer substrates and products. The primary function of the PAZ domain
is to help proteins in the RNAi pathway recognize and bind to RNAi specific dsRNA
inputs and can be found in both Dicer and Argonaute proteins. Basically, the PAZ
domain folds to form a hydrophobic pocket to accommodate the 3‟2-nt overhang
common to miRNA precursors, miRNAs, and siRNAs by promoting stacking
interactions between the hydrophobic residues of the PAZ side chains and the nucleic
acid sugar rings[115,117,118,119]. Engineered substrates with longer or shorter 3‟
overhangs bind Dicer with much lower affinity[117]. Crystal structure analysis of the
PAZ domain from Giardia intestinalis revealed that 65 angstroms separate the PAZ
domain from the Dicer catalytic. Satisfyingly, 65 angstroms is also the length of a
stretch of dsRNA ~25-27nt long, the exact size of G. intestinalis Dicer products.
These data support a model in which the PAZ domain recognizes the 3‟ 2nt overhang
common to Dicer substrates and anchors there such that the positioning and length of
space between a PAZ domain and the sites of RNA catalysis serve as the “molecular
ruler” of Dicer proteins[118,119]. This model was found to be correct upon further
study that also found that Dicer proteins can even be “reprogrammed” with different
RNA recognition structures that confer altered specificity to the modified
Dicers[118,119]. Thus, Dicers that do not contain any discernable PAZ domains may
have evolved different methods and structures for recognizing and binding their
cognate substrates[118,119].
The domain of unknown function 283 continues to earn its name. The role of this
elusive domain was nearly exposed by the crystallized G. intestinalis Dicer whose
structure implicated the DUF domain as important for supporting the alpha-helix
connecting the PAZ and RNase III domains based on its similarity to the G.
intestinalis N-terminal platform domain (NTPD)[118,119]. A bioinformatic foray into
11
protein sequence conservation found no significant sequence conservation between the
G. intestinalis NTPD domain and the human DUF283 domain[145]. The authors of
the computational analysis argue that although the two domains have similar folding
topologies βββα and αβββα, the predicted secondary structures are not closely related.
Instead, it is hypothesized that the DUF αβββα fold and the predicted structure are
strikingly similar to topologies and secondary structures indicative of dsRNA binding
domains[145]. The authors postulate that perhaps the DUF domain in conjunction with
the canonical dsRNA binding domain helps to sense the guide strand of Dicer dsRNA
substrates either through direct strand selection, or recruitment of as of yet
unidentified auxiliary RNA binding protein[145]. For the meantime, the DUF domain
remains shrouded in mystery.
Thorough research into the molecular details of the RNase III domains and the dicing
mechanism has yielded a relatively complete description of the dicer mediated RNA
catalysis. As per the function of the PAZ domain, Dicer preferentially cuts dsRNA in
an end specific manner, although RNA catalysis, albeit much slower, is possible when
dsRNA ends are modified to prevent dicing[42,146]. Upon binding a dsRNA target,
Dicer orients its two RNase III domains into a intramolecular psuedodimer such that
Asp1320 and Glu1652 from RNase IIIa, and Asp1709 and Glu1813 from RNase IIIb
form a single catalytic site wherein each domain cuts a single strand of the RNA
substrate 2nt apart so as to generate the 3‟ 2nt overhang required for downstream
binding to the Ago proteins[42,118,146]. Studies analyzing the Dicer cleavage
products of mutated Dicers have revealed that the orientation of the PAZ domain and
the 3‟2nt overhang of the substrate ensure that the RNase IIIa domain cuts the strand
terminating with 3‟-hydroxyl group and that the RNase IIIb domain cuts the strand
bearing the 5‟ monophosphorylation[42,146].
Dicer proteins are increasingly becoming recognized as important regulatory nodes for
cell signaling. As the gate keepers of mature miRNA and siRNA concentration, Dicer
proteins are well poised to regulate the overall input/output of RNA mediated gene
silencing. Extensive binding partners of Dicer have been identified and catalogued in
12
C. elegans and humans, many of which have developmental
roles[147,148,149,150,151]. In humans, Dicer interacts with both the transactivating
response binding protein (TRBP) and protein kinase R activator
(PACT)[138,152,153,154,155,156,157]. These proteins are very similar and may both
be homologues of LOQ, a binding partner of the miRNA specific DICER-1 in flies.
Both TRBP and PACT are RNA binding proteins, and despite their sequence
similarity, have opposing effects on the activity of protein kinase R (PKR) strongly
suggesting significant cross talk between the RNAi and PKR pathways[153,154,156].
A simple pubmed search of the terms “Dicer” and “Cancer” underscore the connection
between Dicer, RNAi pathways, and regulated cell growth.
Dicer is also intimately involved in the effector phase of RNAi and associates with
Argonaute and other annotated RISC binding partners. Effector phase roles of Dicer
are described in further detail below.
Beyond its roles in vivo, Dicer has proven an effective tool in vitro. Myers and
colleagues expressed and purified a recombinant version of human Dicer to generate
“diced pools” of siRNAs targeted at genes of interest[81,139]. Excitingly, recombinant
Dicer was functional and found capable of dicing in vitro transcribed dsRNA into
siRNAs on an experimentally useful scale[81,139]. The use of in vitro dicing has since
become an important tool for experimental gene silencing as Diced pools have several
advantages over chemically synthesized siRNAs. First, diced pools are quite diverse
with one 500bp dsRNA trigger generating ~350 individual siRNAs[158]. This
diversity renders siRNA validation of multiple single siRNAs unnecessary with the
much increased likelihood of successful knockdown on the first try[81,139].
Importantly, diced pools have been shown to reduce interfering off target effects from
the silencing of mRNAs with seed matches to the experimentally introduced siRNA.
The use of diced pools reduces this types of noise by virtue of dilution effects. It is
likely that any given siRNA in the pool also has its own list of off target seed effects;
however the relative concentration of any siRNA from the pool is nominally
13
insignificant. Side by side comparisons of the off target effects of single chemically
synthesized siRNAs and diced pools support these advantages[158].
Beyond the utility of directed gene silencing, in vitro dicing provides a method for
dissecting Dicer structure, function, and mechanism. The ease of doping in labeled
substrates or modified Dicer in in vitro dicing reactions makes this an attractive
method of studying Dicer. Indeed, many of the conclusions supporting the currently
accepted model for the dicing mechanism are built from in vitro dicing assays.
Although a significant body of knowledge exists concerning the mechanism by which
Dicer generates siRNAs and miRNAs, unanswered questions about specific domain
function persist.
Argonaute Proteins and the RISC complex
Central to the effector phase of RNAi are the Argonaute proteins which are
evolutionarily conserved in all interference pathways. RISC has many other
components that can differ between species that are hypothesized to modulate the
magnitude and type of gene silencing activity, RISC localization, and mRNA
targeting, but none are as integral to RNAi function as the Argonaute proteins. As
mentioned, Argonaute proteins belong to two distinct groups: the pi-RNA associated
Piwi proteins and the siRNA/miRNA binding Ago proteins[64,87]. The Ago proteins
have four distinct domains: the N-terminal domain, the PAZ domain, the Mid domain
and the Piwi domain in a N-C primary sequence order[49,51,52,116]. Extensive
structural work has defined the PAZ domain as the primary contributor of binding
specificity to Ago affinity to small RNAs cleaved by Dicer as described
above[51,115,116,117]. A bounty of various solved structures and mutational analysis
provide detailed structural insight in Argonaute function
[51,117,159,160,161,162,163]. Bound RNA spans the rest of the Ago domains
through electrostatic interactions between positively charged Ago side chains and the
negatively charged RNA phosphate backbone. The Mid domain also confers
siRNA/miRNA binding specificity with a small dock for the 5‟ monophosphate[163].
Small RNAs bound to Ago are situated to expose the face of the most 5‟ nucleotides
for engagement in Watson-Crick base pairing with target
14
mRNAs[51,117,159,160,161,162,163]. The PIWI domain has been characterized as a
cryptic RNase H domain and is responsible for cleavage of the target mRNA between
nucleotides 10-11 of the guide strand in interactions with near perfect base
pairing[51,163]. The catalytic residues necessary for this “slicing” activity are
conserved only in Ago family members capable of direct target cleavage (Ago 2 in
humans). In addition, a motif called the PIWI-box in the PIWI domain recruits the
Dicer via an interaction with Dicer‟s RNase III domains[151].
The sequence of RISC assembly differs between worms, flies, and vertebrates. The
majority of research into the RISC formation and loading has been carried out in flies
and humans. The following model is based on work from both flies and human with
an emphasis on the mammalian system. Although the primary role of Dicer is in
generating small RNAs earmarked for entry into the RISC complex, Dicer proteins
serve as a bridge between the initiation and effector phases of RNAi[137]. In humans,
RISC is defined by an Argonaute protein (Ago 1, 2, 3 or 4), associated with Dicer and
the HIV transactivating response binding protein
(TRBP)[49,63,134,138,164,165,166,167,168]. These proteins can associate
independently of a dsRNA trigger, allowing for quick handoff from Dicer to Ago upon
successful Dicer processing[136]. Post Dicer cleavage, dsRNA triggers are passed on
to the Ago protein for guide strand selection. The selection of guide strand is based on
the thermodynamic properties of the small RNA duplex[50,136,169,170,171]. Strands
with 5‟ends at the less stable terminus of the duplex are preferred as guide
strands[169,172]. The passenger strand with the stable 5‟ end is cleaved by slicer
competent Agos and jettisoned from the complex[137,173,174,175,176]. Numerous
examples exist of RISC loaded with both the sense and antisense strands of a small
guiding RNA suggesting that duplexes with ends of comparable stability are able to
contribute either strand to mature RISC. It is unclear how passenger strands are
removed from RISC complexes formed with slicer incompetent Argonaute proteins.
Potentially, the characteristic bulges and gaps present in immature miRNA duplexes
contribute enough instability to the complex as a whole to remove the need for
passenger strand cleavage prior to ejection. Although Dicer is found with Ago in
15
mammalian systems, it is dispensable for correct loading whereas in flies,
DCR2/R2D2 and DCR1/Loquacious are required for RISC maturation from a dsRNA
RNA trigger[136,143,155,169,177,178,179,180,181]. Also in flies, a more complex
system exists for sorting siRNAs and miRNAs into the proper RISC complexes as the
two are processed by two different Dicers and feed into slightly different RISCs
complexes. No evidence so far suggests a similar sorting mechanism in vertebrate
RNAi [182]. In vertebrates, most RISC:mRNA interactions are guided primarily by
miRNAs that share imperfect base pairing with their targets bypassing the need for a
sorting mechanism.
An important RISC cofactor in miRNA repression of both translation and mRNA
stability is the protein GW182. A binding partner of Ago proteins, GW182 associates
with loaded RISC and is sufficient to induce translational inhibition and decay when
tethered to mRNAs sans RISC. It is thought that n-terminal domain of GW182 binds
Ago, and that the c-terminal domain promotes inhibition of translation initiation,
deadenylation, and decay through mechanisms that are not fully understood
[55,56,101,183,184,185,186,187,188,189,190,191,192,193,194,195].
miRNA Targeting
An impressive joint effort combining experimental data with bioinformatics has
successfully outlined the basic features miRNAs recognize in targeting mRNAs. First,
a large portion of miRNA target sites are located in 3‟-UTRs of mRNAs, although
sites in coding sequences and the 5‟-UTRs can also reduce target protein levels of
mRNAs[9,60,83,88,89,196,197,198,199]. Sites in the coding region and 5‟-UTR
however are generally less effective than 3‟-UTR miRNA binding sites, most likely as
a result of translating ribosomes blocking RISC association with target mRNAs
[29,83,88,200,201,202,203]. The most important predictive feature in a candidate
miRNA target is a stretch of six to eight nucleotides complementary to the the 5‟-end
of the miRNA “seed region”. These complementary regions in target mRNAs are the
“seed matches”. To a large extent, it is the interaction between the miRNA seed region
and the mRNA seed match that confer the bulk of affinity and specificity to
miRNA:mRNA target pairs [29,60,89,196]. The importance of the seed match is
16
underscored by their conservation as well as the fact in many instances the seed match
alone is sufficient for repression by the cognate miRNA [60,83,89,199,204].
Beyond the seed region, binding between the 3‟ end of miRNAs and target mRNAs
can, in a small minority of cases, contribute to miRNA targeting and can be
compensatory for seed region mismatches or supplementary to normal seed
interactions [83,84,88,196]. Likewise, a very small degree of conservation can be
found in target mRNAs upstream of the canonical seed match[83,84,88,196]. 3‟
compensatory binding can confer more specificity between miRNAs and their targets
in scenarios in which miRNAs with the same or similar seed are expressed
sequentially. Indeed, in C. elegans, the lin-41 transcript is a target of the miRNA let-7.
However, several miRNAs with the same seed as let-7 are expressed earlier in
development. Thus, the let-7 seed matches in lin-41 are slightly mismatched to the
shared let-7 seed, yet have 3‟ compensatory matches to 3‟ sequence unique to let-7 to
ensure proper timing for down-regulation of lin-41[10,92,98,205,206].
To explain the dual capability of Ago proteins to allow both miRNA mediated seed
interactions and siRNA directed Ago2 cleavage, Bartel in 2009 suggests an attractive
seed nucleation model[87]. First, small guide RNAs bind to the Ago null conformation
in a manner that exposes the seed for the purpose of mRNA targeting while recruiting
the rest of the miRNA inward so as to protect the guide strand from scavenging
cellular RNases. Upon finding a target with a seed match, the mRNA and the guide
strand adopt a half turn helix conformation that does not extend past the seed. When
there is sufficiently strong binding between target and guide in the case of perfect base
pairing, the Ago protein is induced to reorganize and free the 3‟ end of the miRNA to
engage in a helix interaction for the length of the miRNA. However, the extended
helix Ago2 conformation promotes cleavage of the target strand breaking the helix and
turning the guide strand back inward as the broken mRNA is released. The
thermodynamic cost of maintaining the Ago protein in a strained conformation to
accommodate more than half a helix and less than a full 2 turn helix with the target
would also explain the gap in conservation of miRNA binding sites in target mRNAs
17
between the seed match and the less conserved 3‟ binding regions. Extremely recent
crystallographic analysis of Thermus thermophilus Ago with DNA strands of varying
length provide strong biophysical evidence for just such a nucleation model[207].
A seminal study showing that miRNAs induce measurable decreases in the abundance
of some of their cognate mRNA targets provided a powerful experimental handhold
for determining what features in mRNA sequences contribute to miRNA targeting[29].
Basically, Lim et al. found that introduction of either the heart-specific miR-1 or the
brain-specific miR-124 into HeLa cells resulted in significant decreases in the
abundance 96 and 174 mRNAs highly enriched for seed matches to the respective
miRNA. The success of this approach led the authors to expanded the study to
incorporate data from 11 distinct miRNAs[29,88]. This data set was then used to
bioinformatically identify additional features beyond the conservation of canonical
seed matching in the primary sequence of mRNAs that increase the chance that a
mRNA will act as a functional target [88]. These data provided the basis for a model
for the effectiveness of each seed match site in 3‟-UTRs of mRNAs for ~450 miRNAs
that can incorporate conservation, but does not require it, so as to identify potential
specie specific miRNA targets (TargetScan 4.0). It has been argued however that
TargetScan is insufficient for predicting targets that are regulated primarily through
translational inhibition as the data set used to generate the predictions was based
reductions in mRNA abundance. Other prediction algorithms have been formulated
that rely upon both similar and distinct theoretical considerations (e.g. mRNA
secondary structure). However, the accuracy, and thus utility of many of the target
prediction algorithms is limited by a paucity of functional data to test their
performance[89,198,199,208,209,210].
miRNA Regulation
A decade of research has firmly established that miRNAs mediate pos-transcriptional
silencing of their cognate targets. In the mRNA:miRNA interactions driven by
extensive base pairing it is clear that miRNAs, like siRNAs induce direct cleavage by
Argonautes competent for nuclease activity[40,63,109,168,211,212,213]. In the more
18
common scenario (for animals), wherein mRNAs are recruited to RISC through
interactions with miRNA seed regions, the combined knowledge of many avenues of
research has yet to accrete into an accurate description of the mechanisms by which
miRNAs inhibit translation and/or promote target mRNA degradation. Much
conflicting evidence exists arguing that miRNAs either reduce translation, target
instability, or both [9,25,26,27,28,29,30,31,33,86,106]. Often, the discussion
surrounding the gene repressive mechanisms of miRNAs is framed as a debate of
translation versus decay. Actually, a large part of the confusion arises from a lack of
an agreed upon mechanism for either miRNA induced fate. No less than six competing
theories have been put forth as to how miRNAs might reduce translational
efficiency[64]. Likewise, miRNA induced changes in mRNA abundance have been
deemed a result of primary directed degradation as well as attributed to indirect effects
of decreased translation and deadenylation[64]. From this mixed bag of evidence three
explanations can account for reported inconsistencies. One model is that miRNAs act
through a myriad of dissimilar mechanisms that are directed by the recruitment of
different RISC cofactors depending on the miRNA:target pair. This model is
consistent with the idea that there is not a consensus mechanism that could easily
accommodate the varied details of miRNA function. Another explanation is that
miRNAs act through a common initial step after which the proteins associated with
RISC can dictate alternate fates for targeted mRNAs in a sequence and/or cellular
context dependant manner. Lastly, the current confusion surrounding miRNA
regulation could be attributed to experimental artifact.
The sheer number of distinct theories based on solid evidence alone argues that
miRNAs regulate gene expression through numerous different, and sometimes
exclusive, mechanisms. The idea the miRNAs reduce target protein abundance
without altering the half life of an mRNA surfaced early in miRNA research with the
observation that the C. elegans miRNA lin-4 lowers the protein concentration of its
target lin-14 without any effect on the lin-14 transcript abundance[8,9,30]. Similar
work in vertebrate systems bolstered this original finding along with additional
research revealing that targeted mRNAs, miRNAs and RISC components localize to
19
P-bodies suggesting that miRNA targets are actively separated from translating
mRNA pools [56,58,60,108,194,195,214,215,216,217,218].
Another theory of miRNA function is rooted in the well documented deadenylation of
miRNA repressed mRNAs[33,55,57,61,102]. Deadenylation shortens polyA tail
length resulting in decreased initiation[219,220]. However, mRNAS that are removed
or blocked from entering the translational machinery are more likely to become
deadenylated[219,220]. To test whether miRNA mediated deadenylation is a miRNA-
specific effect rather than an indirect result of miRNA induced translation inhibition,
the polyA tail length of mRNAs with internal ribosome entry sites (IRES) that are
immune to miRNA translational repression were measured[61]. Even in these
unrepressed target mRNAs, a marked reduction in polyA tail length was noted[61].
Thus, miRNA mediated deadenylation is a potentially a primary mechanism by which
miRNAs inhibit translational initiation. However, mRNAs lacking an mRNA tail are
also susceptible to miRNA mediated repression[33,108,193].
Other studies have argued for an early cap-dependant inhibition of translation
initiation[99,221]. The first line of evidence implicating miRNAs in cap-dependant
blocked initiation arises from the observation that the Argonatue MID domain binds
the EIF4E complex[221]. Sequestration of EIF4E blocks binding to the 5‟ cap of the
targeted mRNA and prevents subsequent mRNA circularization and recruitment of the
40s ribosomal subunit necessary for translation initiation. Indeed, the addition of
excess EIF4E rescues efficient translation. In Drosophila, 40s recruitment is blocked
by active RISC [222,223]. However, evidence from Drosophila suggests that the
region of Argonaute implicated in EIF4E binding was found to actually bind the RISC
cofactor GW182[193].
The last initiation theory suggests later phases in initiation at the stage of 40s-60s
joining are inhibited by miRNAs[224,225]. It was discovered that Argonaute proteins
associate with both EIF6 and the 60s ribosomal subunit[224,225]. The annotated role
of EIF6 is prevention of premature 40s-60s joining[226,227]. Thus the theory was put
20
forth that initiation is halted by a sequestration of 60s available for 40s joining by Ago
proteins. Furthermore, any available 60s associated with Ago is is blocked from 40s
joining by the presence of the Ago bound EIF6. Two additional lines of evidence
support this model: depletion of EIF6 rescues mRNAs from translational torpor in
worms, and ribosomal toeprinting reveals that translation is stalled just prior to 40-60s
joining as evidenced by the presence of the 40s subunits accumulation at the start
codon of miRNA targeted mRNAs in human cell lysate[224,225].
Outside of initiation, it has also been suggested that post-initiation steps of translation
are targeted by miRNAs [30,201,228,229,230]. In one study, translation driven from
IRES transcripts was reported as repressible by a small guide RNA arguing that
initiation is not a requirement for miRNA translational inhibition. The authors also
observed decreased read through at the stop codon on miRNA repressed mRNAs
indicating that miRNAs slow elongation rate. In addition, miRNA induced ribosome
drop off was implicated when it was noted that ribosomes disassociate from repressed
mRNAs at a faster rate than non-targeted mRNAs post treatment with an initiation
blocking agent[229]. Nascent polypeptide degradation was put forth after the
demonstration that miRNAs and repressed mRNAs associate with actively translating
polysomes[228,230].
A contributing factor to the absence of a consensus model (in addition to the myriad of
potential mechanisms for miRNA induced translational repression) is the reported
phenomenon of miRNA mediated mRNA degradation [26,29,33,61,105,106,188].
That miRNAs reduce the stability of their targets really became established after
publication of the first systematic evidence for widespread miRNA mediated
degradation by exogenous miRNAs in human tissue culture[29]. The intrinsic link
between translation and mRNA stability dictates that some portion of the changes in
mRNA abundance measured in response to the introduction of miRNAs are
necessarily an indirect effect of translational inhibition[219,231,232,233,234].
However, degradation of miRNA targets has been observed in vitro in the absence of
active translation[33,61].
21
Despite the extensive body of work describing multiple diverse mechanisms for
miRNA activity, several lines of evidence based on concordant reductions in inferred
translation and mRNA abundance are consistent with at least a common initial
mechanism. Recent work from Baek et al. and Selbach et al found that changes in
mRNA levels correlate with and account for a majority of the lowered protein
expression observed for miRNA targets after the introduction of a miRNA into human
tissue culture[90,91]. However, concordant regulation of mRNA stability and
translational efficiency may also arise from separate mechanisms regulated by the
same cis factors. The theory that miRNA independent features encoded in targeted
mRNAs dictate the outcome of miRNA:mRNA pairing arises from observations of
both concordant and exclusive reductions in translation efficiency and mRNA
abundance [61,99,101,107,235,236,237].
The use of cell free translation assays, reporter constructs, and/or error introduced by
variations in experimental procedures might also explain some degree of the
divergence in the data used to formulate the disparate theories attempting to describe
the process by which miRNAs inhibit gene expression [99,111]. The majority of work
regarding the translational aspect of miRNA function has relied on reporter assays.
The impetus for the use of such constructs is made clear in consideration of the utility
and power provided by transcripts designed to possess a certain number or type of
miRNA binding sites. However, the uses of this technology can subtlety alter the cell‟s
ability to regulate reporter transcripts in the same manner as endogenous mRNAs.
Artificial mRNAs usually have very short 3‟-UTR sequences and thus may lack
important regulatory information that feeds into normal miRNA function. miRNA
regulation may depend on a delicate balance between targets, miRNAs, the RISC
complex and other cofactors. Weak miRNA mediated repression might be
overshadowed reporter construct mRNAs inundating the cell and disrupting the
regulatory stoicheometry. Not surprisingly, it was reported that experimental
procedure significantly alters the degree and type of miRNA regulation. Factors
influencing mRNA fate determination include but are not limited to, method of
22
transfection, type of 5‟cap attached to an mRNA, and even the promoter sequence
driving reporter expression miRNAs [201,238].
Clearly, research employing systematic methodologies for quantifying miRNA
mediated changes in mRNA abundance, translational efficiency and protein
abundance coupled with careful biochemical analysis will be necessary for resolving
some of these seemingly irreconcilable models. As with many scientific debates
characterized by multiple opposing viewpoints, the truth is most likely somewhere in
between.
23
Scope of this Work
Dicer Domain Function
The method of using recombinant human Dicer for the purposes of experimentally
induced gene silencing was developed in the Ferrell lab. Thus, research into the
structure and function of Dicer and its domains is a logical pursuit based on the
expertise and reagents available. Here we measured the contribution of several of
Dicers various domains to dicing activity through the generation of a library of Dicer
point mutations (key residues identified by previous work) and truncations. This
library was used to express and purify mutant versions of Dicer for in vitro assays
designed to quantify relative efficiencies of activity. In addition, the library can be
used to generate stable human cell lines expressing the Dicer variants to explore the
function of the domains in vivo dicing of biological targets, protein-protein
interactions, and effector stage gene silencing.
Systematic Identification of miRNA Targets
As discussed, algorithms designed to predict miRNA targets are commonly based on
features important for miRNA mediated changes in mRNA abundance, seed match
conservation and predicted secondary structure. However, miRNA mediated
reductions in target transcript concentrations do not fully account for changes in
protein abundance introducing the risk of biasing algorithms based on mRNA changes
towards the prediction of targets most susceptible to this specific regulatory fate and
potentially missing targets with sequence features that primarily limit miRNA
regulation to translational inhibition. Conservation based approaches are limited in the
observation that many conserved sites are not functional and many functional sites are
not conserved. Strategies based on the predicted mRNA secondary structure
surrounding seed matches are predicated on the idea that less structure results in
greater site accessibility for RISC, and thus more miRNA mediated down-regulation.
Predictions based on other predictions with no solid grounding in empirical data are
fraught with error and have not proven especially useful[90,239].
24
To rigorously explore the landscape of miRNA targeting without recourse to
conservation and unbiased with respect to regulatory fate of miRNA targets, we
developed a direct biochemical assay to identify miRNA targets. Using over-expressed
affinity tagged human Argounaute 2 as a handle, we immunopurified the RISC
complex, miRNAs, and their target mRNAs from Human Embryonic Kidney (HEK)
293T cells. The immunopurified (IP) RNA was identified using microarray
technology. This tandem IP/microarray provides a comprehensive method for the
unbiased identification of miRNA targets. To test the method, we transfected both
miR-1 and miR-124 to identify mRNAs specifically recruited to RISC in the presence
of either target. In addition we measured the miR-1 and miR-124 changes in mRNA
abundance to correlate Ago2 enrichment with a functional outcome to validate the
approach.
Steps in Gene Expression Regulated by miRNAs
Efforts to make sense of the various mechanisms by which miRNAs are thought to
mediate gene silencing have, in part, been hampered by our technological inability to
measure multiple parameters that influence actual gene expression simultaneously for
all the potentially hundreds of genes a miRNA may target. Simply knowing to what
extent miRNA targets behave similarly with respect to mRNA abundance,
translational efficiency, and protein abundance would help to determine if there is an
underlying mechanistic commonality between targets of the same miRNA.
Here, we employ our immunoaffinity Ago pull down methodology for systematically
identifying the targets of miR-124 and measuring in parallel, mRNA abundance and
two translational parameters, ribosome occupancy and ribosome density for 8,000
genes and ~650 miR-124 targets. The translational measurements were taken using
polysome profiles, DNA microarrays, and a novel gradient encoding scheme. This
strategy allowed us to directly investigate the behavior of miRNA–mRNA target pairs
with respect to both mRNA fate and translation, on a genomic scale.
25
Potential Roles for Conserved Dicer Domains in in vitro
Dicing
Abstract
RNA interference (RNAi) pathways are cellular mechanisms responsible for
recognizing and responding to various short double stranded RNA inputs. Techniques
utilizing the RNAi pathway have moved to the forefront of reverse genetics, allowing
biologists to effectively silence or inhibit gene translation despite an incomplete
mechanistic understanding. Bridging the gap between RNAi initiation and execution,
the type III ribonuclease Dicer represents an interface between RNAi as an
endogenous mechanism regulating gene expression programs, and RNAi as a
powerful, emergent tool. A two-pronged approach that will conjoin mechanistic data
in vitro with functional data in vivo will at once provide a more complete description
of Dicer‟s roles in the mammalian RNAi pathway, while simultaneously maximizing
the efficacy of Dicer based RNAi techniques.
26
Introduction
Comprehensively, the term RNAi refers to a collection of conserved pathways that
utilize small guiding RNAs to induce gene silencing by down-regulating transcription,
mRNA stability, translation, and transposable element activity in most
eukaryotes[9,12,20,21,22,23,24,25,26,27,28,29,30,31,33,65,66,67,86,106]. RNAi is
commonly subdivided into an initiation step and an effector step[35]. For small
interfering RNA (siRNA) mediated interference, initiation begins with the
introduction and transformation of long double stranded RNA (dsRNA) into 21-25nt
siRNAs with 5‟ phosphates and 3‟ 2nt overhangs[43,44,45]. Micro RNA (miRNA)
driven RNAi starts with the expression of primary miRNA (pri-miRNA) transcripts
bound for conversion via the type III ribonuclease Drosha into ~60-100 nucleotide
miRNA hairpin precursors (pre-miRNA) destined for maturation into 19-25nt
miRNAs, characterized by their 5‟ phosphorylation state, 3‟nt overhangs, and
propensity for bulges, and mismatch base
pairing[12,37,120,121,122,123,124,125,126]. Trigger modifications hinge on the
activity of the type III ribonuclease Dicer that “dices” its substrates into RISC ready
products with the correct 5‟ and 3‟ profiles[43,44,45].
Post Dicer processing, both classes of RNA incorporate into the effector RNA induced
silencing complex (RISC) composed of Argonaute and PIWI family (PPD) proteins
and Dicer[49,52,133,134,135,136,137,138]. In mammals, fully active RISC requires a
single stranded trigger bound to an Argonaute protein[46,48,135]. Mature RISC then
engages in target finding, and subsequent binding to cognate mRNA targets. The
outcome of an mRNA interaction with a complementary RISC bound siRNA/miRNA
depends largely on base pairing[58,62,240,241]. Perfect homology results in
Argonaute mediated target mRNA cleavage whereas mismatch base pairing prevents
translation and and/or an indirect reduction in target mRNA
stability[12,25,26,28,29,30,58,62,240,241]. miRNAs bind imperfectly to regulatory
3‟UTRs from one to a multitude of mRNA targets inhibiting translation and promoting
27
degradation via an unknown RISC
mechanism[9,12,25,26,28,29,30,60,83,89,196,197,198,242]. siRNAs primarily target
the transcripts that gave rise to them with a high degree of complementarity inducing
RISC mediated cleavage. It is unclear if RISC composition is influenced by RNA
cargo[40,46,50,242].
Dicer family proteins are characterized by several common conserved domains. The
most common domains are: a dsRBD, two Rnase domains bearing resemblance to
bacterial Rnase III, a PAZ domain, a domain of unknown function (DUF283) and a
DExH helicase ATPase domain[36,37,39,41,126,140,141]. Fortuitously, some
organisms have split Dicer‟s workload, evolving multiple Dicers with differing
combinations of domains having similar though not completely redundant tasks. This
dissemination of function coupled with recent structural studies suggests very
plausible functions for several Dicer domains[133]. Functional comparison of the two
D. melongaster Dicers, DCR-1 and DCR-2 provides clues into the roles of several
Dicer domains. The helicase containing DCR-2 is required for efficient processing of
long dsRNA into siRNAs, whereas the helicase deficient DCR-1 is not, strongly
suggesting a role for the helicase domain in dicing[133]. Later work revealed that
DCR-1 and DCR-2 process different dsRNA triggers into miRNAs and siRNAs
respectively and are involved in a sorting process responsible for delivering each class
of small RNA into RISC complexes formed around Argonaute 2 for siRNAs and
Argonaute 1 for miRNAs[177,182]. Similarly, structural and mutational analysis of
the Argonaute 2 and Dicer PAZ domain have been adduced to hypothesize that the
PAZ domain is an RNA binding domain responsible for PAZ protein specificity for
RNA earmarked for RNAi[51,117,118,160,161,162,207,212,243,244].
At the outset of this study, the mechanism by which the two human Dicer RNase
domains catalyzed the dicing of Dicer substrates was not fully understood. The solved
crystal structure for Aquifex aeolicus bacterial Rnase III, highly similar to both Dicer
RNase domains, prompted the postulation that Bacterial Rnase III functions as an
28
obligate anti-parallel homo-dimer with two separate cut sites responsible for cleavage
of dsRNA into ~9-11nt products[146,245]. From this model it was extrapolated that
Dicer behaves similarly. Little was known about how spacing for the characteristic
22mer is achieved and was mistakenly believed that the PAZ domain was not required
for this phenomenon[146,245].
Once dsRNA triggers have been correctly processed, the effector stage of RNAi is
initiated through a transfer of small RNA from Dicer to the RISC
complex[134,136,137,138,169,246,247,248]. Experiments carried out on both
drosophila egg and embryo extracts agree that DCR-2 and DCR-1 with their
respective binding partners R2D2 and Loquacious are important for pre-miRNA
maturation and efficient RISC maturation, a process defined by guide strand selection
and passenger strand ejection[143,176,178,179,180,249]. That RNAi silencing
mediated by experimentally introduced processed siRNAs with no need of Dicer
processing is much less efficient in lysates generated from DCR-1 or DCR-2 null
mutants suggests that both drosophila dicers play some redundant role in RISC
maturation downstream of dsRNA dicing or miRNA excising[143,178,179,180,249].
In mammals, the lone Dicer protein serves a purpose more than that of initiation as
well. There is evidence that silencing of exogenous reporters in tissue culture cells
lacking Dicer is severely impaired, even when a chemically synthesized siRNA
capable of feeding directly into the effector step is used[250]. In addition, mammalian
Dicer interacts directly with known PPD proteins[134,137,138,151]. In particular,
Argonaute 2 is known to function as the endonuclease in the RISC complex
responsible for siRNA mediated message cleavage. AGO1, in drosophila, promotes
the stability of mature miRNAs and interacts with DCR-1 during or around the
initiation phase of RNAi [52,54,63,114,151]. Other known RISC factors include VIG
and fragile X, in mammals, and Armitage in Drosophila[251].
Dicer plays a role in exogenous RNAi initiated gene silencing as well. Often
chemically synthesized siRNAs, or constructs encoding Dicer substrates are used to
29
avoid activation of the mammalian interferon response, which is sensitive to dsRNA
over 29nt in length[79]. Myers et al in 2003 discovered that recombinant human Dicer
is useful for dicing dsRNA templates in vitro to create pools of siRNAs directed at one
target[81]. In vitro dicing is particularly attractive, requiring no systematic testing and
validation of multiple siRNA sequences. Furthermore, diced pools are effective at
lower concentrations then the synthetic siRNA, preventing adverse cellular responses
from toxicity and siRNA inundation[81,158]. Interestingly, treatment with proteolysis
appears to increase the efficacy of Dicer suggesting the possibility that one or more of
Dicer‟s domains have an inhibitory role in catalytic activity[42].
Indeed, evidence from multiple organisms has accreted into a framework delineating
the basic tenets and tendencies of RNAi. However, much is unclear and there are
inconsistencies. For instance, a very recent study of in vitro Dicer activity used
mutation of putative catalytic residues, sedimentation data, and Dicer‟s penchant for
dsRNA ends, to put forth a dicer pseudo-dimer monomer model[42,146].
As the primary active initiator of RNAi, as well as a key constituent of the effector
complex, Dicer stands uniquely placed to illuminate many aspects of both the
initiation and effector phases of RNAi. Here we have generated a FLAG tagged
library of Dicer point mutations and truncations that will be employed to shed light on
the molecular details of dicing mechanism in addition to the biological roles of human
Dicer. The library will be used to generate the mutated and truncated Dicers using a
Baculovirus expression system. Dicer activity can then be assayed for using in vitro
dicing reactions. The product and yield, size, and sequence can then be used to gain
insight into the functional requirements of efficient and correctly spaced dicing. In
addition, stable Hela cells expressing members of this library will be used to identify
the structural requirements Dicers interactions with both known and novel binding
partners. Luciferase assays to designed to measure the efficiency of RNAi mediated
gene silencing will be employed in these cell lines in order to determine how and if
Dicer is involved in the effector stage of RNAi based on the requirements of specific
Dicer domains and residues.
30
Results
Generation of a Dicer mutant library
The first step in probing Dicer‟s structure and functions was to generate a library of
point mutation and truncations of interesting Dicer domains based on previous work as
well as conservation implicating several regions as previously unrecognized functional
extensions of the annotated domains (Figure 1).
ATPase/Helicase domain
Prior work on the Arabadopsis thalinia DCL-1 and the D. melongaster DCR-1
implicated the ATPAse/Helicase domains of Dicer. Mutations in several key residues
resulted in aberrant development in and attenuated RNA respectively[39,133].
Multiple sequence alignments with Dicer proteins from different organisms revealed
that several of the mutated residues were conserved, or replaced with similar amino
acids in human Dicer. Overall, two changes were designed to mimic the previously
reported mutations with interesting phenotypes: G31R and C473Y were subcloned
into mammalian/and baculovirus expression vectors. In addition, the helicase domain
was sub-cloned into both vectors by itself to test for potential inhibitory/activation
effects on in vitro dicing and as a well to find potential Dicer binding partners
recruited specifically by the ATPase/Helicase domains in vivo. A Dicer truncation
lacking the ATPase/Helicase domain was generated as well.
DUF283 domain
To test for DUF functionality and binding partners, the DUF domain was cloned alone
into mammalian and baculovirus expression vectors in addition to the creation of a
Dicer truncation lacking both the ATPase/Helicase and DUF283 domains.
31
Figure 1. Generation of Dicer Mutant Library
Left: Illustrations of the Dicer truncations subcloned into expression vectors. All were made except for
the three on the bottom. Right:List of the Dicer point mutation generated and the studies that implicated
the residues as important for function.
32
PAZ
Crystallographic analysis of the PAZ domain implicates this domain as important for
Dicer recognition of its substrates and for conferring the correct spacing of the RNase
domains for effective production of products 21-22 nt in length[51,117,118,119].
Accordingly, Dicer mutants based on the key residues required for proper PAZ
function revealed by crystal structure of the Argonaute PAZ domain crystallized with
a short RNA were generated: F292A, Y309A, L337A and C342A[117]. Likewise, the
PAZ domain was sub-cloned in isolation and in addition to a truncated Dicer lacking
the ATPase/HElicase domain, the DUF domain, and the PAZ domain for the same
purposes as described above.
RNAse Domains
Extensive mutational analysis has determined that there are 4 primary residues
necessary for proper dicing: Asp1320 and Glu1652 from RNase IIIa, and Asp1709 and
Glu1813 from RNaseIIIb[146]. The 24 permutations of single, double, triple and
quadruple mutants were generated to probe the mechanism by which Dicer cleaves
dsRNA. At the outset of this study, it was unclear whether or not Dicer functioned as
pseudo-monomer or as an obligate homodimer[42,146,245]. Studies on bacterial
RNase III suggested that one of the Dicer RNase domains might not be functional.
Additionally, gel filtration analysis has shown that Dicer activity tracks with fractions
of proteins ~twice the size of Dicer. Both pieces of evidence suggested that a single
Dicer molecule may not be sufficient for dicing. The RNase domains also have
important roles in protein-protein interactions as evidenced by the Argonaute PIWI
box and Dicer RNase IIIb interaction[151]. The RNase region of Dicer contains two
well defined RNase domains in addition to a strectch of highly conserved sequence
between them. Each RNase domain was sub-clone in isolation as well as in tandem
with this conserved region of unknown function. These clones will be used to identify
additional Dicer binding partners and the in vivo roles of Dicer in RNAi execution.
Unfortunately, the Dicer truncations lacking one or more of the internal domains, yet
with an intact Helicase domain were never generated. Although baculovirus was
33
Figure 2. Western Analysis of Insect Cells Expressing Dicer Variants
FLAG antibody was used to check for expression of Dicer variants in SF9 cells at increasing
multiplicity of infections (MOI) with recombinant baculovius
34
generated to express all of the aforementioned truncations and domains, not all of the
viruses successfully induced soluble expression of the intended domain. Figure 2
outlines the domains that were successfully expressed and subsequently purified. The
library of point mutation, although created was never used to express and purify
protein, nor were stable cell lines ever created.
Domain Requirements for Efficient Dicing and Properly Sized siRNAs
To identify the minimal domain requirements for efficient Dicing, several truncated
versions of Dicer were expressed in and purified from SF9 insect cells using a
baculovirus expression system: full length Dicer (FL), the DUF, PAZ and Rnase
domains of Dicer (DPR), the PAZ and RNase domains (RP) and the Dicer Rnase
domains with the dsRBD (RNab). Although it is known that the RNase domains are
required, it is unclear what role these other domains play in dicing. To this end,
expressed proteins were purified using a FLAG antibody conjugated to an agarose
resin. Purified proteins were quantified and added at equi-molar concentrations to
dicing reactions containing 500bp of dsRNA (GL3) generated from a fragment of a
firefly luciferase with T7 transcription sites at both ends.
After overnight incubation at 37 degrees Celcius, the reactions were separated by
PAGE on 15% native gels to preserve the double stranded character to distinguish
actual products from single stranded RNA. Interestingly, we observed that the RNab
domains alone were not competent for efficient dicing of dsRNA into 21-22 nt long
siRNAs. A smeared pattern of RNA migration larger than 21-22 was noted indicating
incomplete catalysis of the longer 500bp dsRNA substrate. The RP domains appeared
to process dsRNA, however, the average size of ~15nt is significantly smaller than the
typical Dicer products generated by FL Dicer and the DPR domains (Figure 3A&B).
These data suggest that both the DUF283 and PAZ domains are required for Dicer to
efficiently catalyze the generation of siRNAs of the correct size in vitro. Likewise, the
Helicase domain is dispensable for siRNA production.
35
Figure 3. The PAZ and DUF283 Domains are Required for Efficient Dicing in
vitro
(A) Diced RNA products generated from with Dicer truncations in 16 hour overnight in vitro dicing
reactions with a 500bp dsRNA substrate. Reactions were run out on 4% agarose gels and stained with
ethidium bromide. From left to right: siRNA ~21-22nt, input, DPR Dicer, RNab domains.
(B) Diced RNA products generated from with Dicer truncations in 16 hour overnight in vitro dicing
reactions with a radiolabeled 500bp dsRNA substrate. Reactions were run out on 15% PAGE-TBE gels.
From left to right: RP domains (products <21-22nt), full length Dicer (products ~21-22nt).
36
Reports that Proteinase K increases purified Dicer activity, in tandem with
observations that heterogeneous Dicer purifications are more efficient , compel the
notion that dicing (as defined by the production of ~22nt RNA molecules having 5‟
phosphorylations and 3‟ 2nt overhangs), can be carried out, more efficiently by a
truncated version of Dicer. These observations suggest that perhaps some section or
domain of Dicer is inhibitory to dicing.
To test the hypothesis that FL Dicer may be less active than a truncated version
lacking an inhibitory region, we tested its activity in comparison to the DPR domains,
the one truncation we tested competent for dicing. Equi-molar concentrations of FL
and DPR Dicer were incubated with the GL3 dsRNA over a timecourse from 30
minutes to 24 hours. PAGE analysis revealed that although both proteins were capable
of processing the GL3 dsRNA, the DPR unit produced significantly more siRNA than
the FL Dicer at both 12 and 24hours (Figure 4). At the early time points, FL Dicer
appeared to dice more efficiently, although this observation is potentially an artifact
from the low signal to noise ratio for low intensity bands. Interestingly, plotting the
amount of product generated as a function of time for both the DPR and FL Dicer
reveals that although the DPR reaction is fit well with a simple linear relationship, the
best fit line does not intersect the origin, suggesting potentially that the DPR dicing
has an initial rate that is slower than it rate at later time points (Figure 4). These data
support a model in wherein the ATPase/Helicase domains potentially bind to the
RNase domains and inhibit Dicer activity. It is also possible that the DPR cannot
cleave dsRNA substrates lacking 3‟2nt overhangs as efficiently as full length Dicer.
The potential increase in rate might be indicative of DPR acquiring more substrate
after initial inefficient cleavages.
37
Figure 4. Generation of Diced siRNAs by DPR and FL Dicer
Top: Linear fit of diced products generated in nanograms versus time in hours. The blue line and
equation correspond with the activity of DPR Dicer and the red corresponds with FL Dicer.
(A) Time course of in vitro dicing reaction with FL Dicer. The primary band corresponds with 21-22nt
siRNAs used as loading controls for sizing and quantification of band intensity (not shown).
(B) Time course of in vitro dicing reaction with DPR Dicer. The primary band corresponds with 21-
22nt siRNAs used as loading controls for sizing and quantification of band intensity (not shown).
38
Discussion
Unfortunately, after creating the library of Dicer point mutations and domains, several
studies were published that decreased the urgency of performing many of the planned
experiments including but not limited to, a published analysis of Giardia Dicer, two
independent studies overturning the conjecture that Dicer was required for the RNAi
effector stage from Doi et al, and several works delineating a more complete role
Dicer in human RISC assembly as well identification of novel binding partners and
putative homologs of the DCR1 and DCR2 binding partners R2D2 and
Loquacious[48,136,137,138,181]. In addition the Giardia structure work verified that
Dicer in fact does function as a pseudo-dimer capable of two separate cuts on opposite
RNA strands 2nt apart giving rise to the canonical Dicer 3‟-2nt overhang common to
all Dicer products[118,146].
However, using a small panel of Dicer protein truncations, we found potential roles for
the ATPase/Helicase, DUF283, and PAZ domains in in vitro dicing that goes beyond
published work. The observation that the RNase domains in isolation are unable to
effectively cleave dsRNA is in accord with conclusions made from labs carrying out
similar analysis as well as the crystallographic analysis. The novel observation that the
DUF domain may have a significant role in proper dicing is in agreement with the
hypothesis that the DUF domain may serve as a support platform for the “connector
helix” linking the PAZ and RNase domains[118]. Perhaps in the absence of DUF283,
the PAZ domain correctly recognizes and binds to the ends of substrates but the
RNase domains are unable to orient ~22nt away. That the RP domains generate a
moderately uniform product that is too small suggests that the connector loop in the
absence of the supporting DUF283 is slightly compacted resulting in closer spacing
between the PAZ and RNase domains. Further experiments to test this model should
focus on determining if the addition of separately expressed and purified DUF283
introduced into dicing reactions with the RP domains could restore proper dicing.
Rescue of normal Dicer activity would suggest a crucial for DUF283 as part of human
Dicer‟s molecular ruler. Additionally it might be interesting to test if the effect was not
39
a specific structural interaction between the DUF283 and connecter helix, and rather a
steric affect of DUF283 by assaying the size of Dicer products generated by Dicers
with repeated DUF283 inserted into the primary sequence adjacent to the original
DUF283.
However, as asserted by Dlakic, the DUF283 domain might not share significant
conservation with the Giardia connecter helix and is actually a cryptic dsRNA binding
domain involved potentially in post dicing orientation of Dicer products en route to the
RISC complex or with Dicer recognition of its substrates[145]. To test these theories,
it would be interesting to measure the basic affinity for different combinations of
Dicer‟s domains for dsRNAs with different thermodynamic and structural properties
to determine in what interactions certain domains confer additional affinity or
specificity. If DUF283 in isolation has a measurable affinity for dsRNA and a stable
secondary conformation, NMR experiments designed to determine the structure given
its small size of ~300 amino acids might elucidate both the structure and structural
response to bound dsRNA of DUF283.
The observation that the DPR domains are more efficient at producing siRNAs only
after 12 hours potentially suggests a dual role for the ATPase/Helicase domains as
both an inhibitor of dicing as well as a cofactor for the dicing of non-canonical
substrates. It is easy to postulate an inhibitory role for the ATPase/HElicase domain as
the FL simply generates less siRNAs over time compared to the DPR unit which lacks
the ATPAse/HElicase domain. The proposed role as an initiator for the dicing of non-
standard substrates is rooted in the observation of a higher initial activity for FL Dicer
compared to the DPR, similar in concept to the initial lag seen in Dicer processing of
dsRNA substrates with inaccessible ends[42]. Although, the initial relative burst of
activity we measured for the FL Dicer may be artifactual, it is possible that the effect
is real suggesting that the ATPase/Helicase domain might be important for the
recognition and processing of the initial dsRNA substrate we added which lacks a 3‟-
2nt overhangs common to most human Dicer substrates. One explanation is that the
ATPase/Helicase domain expedites the initial binding or unwinding of substrates
40
lacking recognizable 3‟ overhangs and thus is faster at cleavage than the DPR at the
early time points. The DPR unit however does cleave these long dsRNA, but at a
slower rate. The DPR has an ace in the hole so to speak in the fact that diced products
have the same character as optimal Dicer substrates. This would allow the DPR to
build up a higher concentration of substrates it can readily process at a faster rate over
time, if the ATPase/Helicase domain is a bona fide inhibitor of dicing activity. For this
model to work, it is necessary that the increased proclivity for substrates lacking
overhangs conferred by the ATPase/Helicase domain is greater than the intrinsic
inhibitory effect of this domain on dicing general. Testing this model would require
side-by-side comparisons of FL and DPR Dicer fed a panel of standard and non-
standard potential Dicer substrates to ferret out any subtle benefit the ATPase/Helicase
domain provides for the dicing of non-standard substrates. Importantly, it would be
interesting to test a substrate large enough to discern product from substrate, but not so
large as to produce more substrate after cleavage. A ds RNA ~30nt in length with and
without 3‟2nt overhangs would suffice as the 8-9nt and 21-22nt products cannot be
processed by Dicer. If DPR is less efficient at processing substrates without overhangs
we would expect that FL Dicer would generate much more product than DPR when in
the absence of overhangs and and vice versa in their presence. Additionally, purified
ATPase/Helicase, if folded correctly, would dampen the DPR efficiency if both were
incubated with canonical substrates together.
Fortuitously, it was found that the DPR unit expressed much more efficiently in insect
cells than FL Dicer in addition to enjoying similar if not greater functionality (data not
shown). The DPR unit provides an attractive alternative to FL Dicer for the purposes
of in vitro dicing as an experimental tool for directed gene silencing.
41
Materials and Methods
Primers Dicer Domains and Point mutations
PAZ ATAAGA TAGC GGCCGC ATT GAC TTT AAA TTC
GCATATTACCGTTACTAGACTTAGTACACAC
RNase ATAAGA TAGC GGCCGC AGT CCT GTG ATG GCC
GCTTTAGGCTTATAGACGTACGATGCTAGATCCATT
Helicase ATAAGA TAGC GGCCGC ATG AAA AGC CCT GCT
CATTAGCAGCTGACTGATGCTAGGCTAGTGAT
RNase+PAZ ATAAGA TAGC GGCCGC CAG AGC CCT TCT ATT GGG
GCTTTAGGCTTATAGACGTACGATGCTAGATCCATT
Helicase+PAZ ATAAGA TAGC GGCCGC ATG AAA AGC CCT GCT
GCTTTAGGCTTATAGACGTACGATGCTAGATCCATT
DPR ATAAGA TAGC GGCCGC GGT CCA CGA GTC ACA ATC
GCTTTAGGCTTATAGACGTACGATGCTAGATCCATT
DUF ATAAGA TAGC GGCCGC GGT CCA CGA GTC ACA ATC
CCG CCG CTC GAGA CTC TTC TTC ATC ATG
R1 ATAAGA TAGC GGCCGC CAG AGC CCT TCT ATT GGG
CCG CCG CTC GAGA GTC TTG ATT TAC TAC
R1+ ATAAGA TAGC GGCCGC CAG AGC CCT TCT ATT GGG
CCG CCG CTC GAGA CCT TTT AAT TAC CGG
R2 ATAAGA TAGC GGCCGC TTT GAA AAG AAA ATC
GCTTTAGGCTTATAGACGTACGATGCTAGATCCATT
R2+ ATAAGA TAGC GGCCGC TCT TAC GAC TTG CAC
GCTTTAGGCTTATAGACGTACGATGCTAGATCCATT
H1 CATTTTGGGACTAACTGCTTCC TCT TTA AAT GGG AAA TGT GAT
CCA G
GT`AAAACCCTGATTGACGAAGG AGA AAT TTA CCC TTT ACA
CTAGGT C
42
H2 CAAGGAATTGGAAGAAAAGAAACAGAAA CTAGAGAAAATTC
GTTCCTTAACCT TCTTTTCTTTGTCTTTGATCTCTTTTAAG
R137e1 GCTAGTGATGGA TTT AAC CTG GTG CGG CTT GAA ATG CTT
GGC GAC
CGATCACTACCT AAA TTG GAC CAC GCC GAA CTT TAC
GAA CCG CTG
R244d1 GCG GCT TGA AAT GCT TGG CGC CTC CTT TTT AAA GCA
TGC CAT CAC
CGCCGAACTTTAC GAACCG CGG AGG AAAAATTTC GTA
CGG TAG TG
R364e1 GCACTTACCCT GAT GCG CAT GCG GGC CGC CTT TCA TAT
ATG AGA AG
TGTGAATGGGA CTA CGC GTA CGC CCG GCG GAA
AGTATATACTCT TC
R4110e1 CAAAAGCAACACA GAT AAA TGG AAA AAA GAT GAA ATG
ACA AAA GAC
GTTTTCGTTGTGTCTATTTACCTTTTTTCTACTTTACTGTTTT
CTG
R537q2 CAATACTATCACT GATTGTTACGTGCGCTTAGAATTCCTG
GGAGATG
GTTATGATAGTGA CTA ACAATG CAC GCG AAT CTT
AAGGAC CCT CTAC
R644d2 CGCTTAGAATTCCTG GGA GCT GCG ATT TTG GAC TAC CTC
ACA ACC
CGAATCTTAAGGACCCT CGACGC TAAAAC CTG ATG
GAGTGTTGG
R7110e2 CAAAGGCCATGGGGGAT ATT TTT AAG TCG CTT GCT GGT
GCC ATT TAC
GTTTCCGGTTACCCCCTA TAAAAATTCAGC GAA CGA
CCACGGTAA ATG
43
Protein Expression
Protein expression of Dicer Domains was carried out using BAC-to-BAC expression
system as per the manufacturer‟s directions (Invitrogen CAT# A11100)
In vitro Dicing Assays
Dicer purification was performed as previously described [81]. Dicing reactions were
set up and carried out as previously describes [81].
44
Systematic Identification of mRNAs Recruited to Argonaute
2 by Specific microRNAs and Corresponding Changes in
Transcript Abundance
David G. Hendrickson1,$
, Daniel J. Hogan2,3,$
, Daniel Herschlag2,*
, James E. Ferrell1,2
and Patrick O. Brown
2,3,*
1Department of Chemical and Systems Biology, Stanford University School of
Medicine, Stanford, California, 2Department of Biochemistry, Stanford University
School of Medicine, Palo Alto, California, United States of America, 3Howard Hughes
Medical Institute, Stanford University School of Medicine, Palo Alto, California,
United States of America
*To whom correspondence should be addressed. E-mail:
pbrown@pmgm2.stanford.edu or herschla@stanford.edu.
$These authors contributed equally to this work.
This chapter was reprinted from:
PLoS One 2008 May 7;3(5):e2126
PLoS journals publish under the Creative Commons Attribution License (CCAL).
No permission is required from the authors or the publishers.
DGH, DJH and POB conceived and designed experiments. DGH and DJH performed
the experiments, analyzed the data, and helped write the manuscript. POB, JEF, and
DH provided general direction, helped with the data analysis and figure reparation,
and helped write the manuscript.
45
Abstract
microRNAs (miRNAs) are small non-coding RNAs that regulate mRNA stability and
translation through the action of the RNAi-induced silencing complex (RISC). Our
current understanding of miRNA function is inferred largely from studies of the
effects of miRNAs on steady-state mRNA levels and from seed match conservation
and context in putative targets. Here we have taken a more direct approach to these
issues by comprehensively assessing the miRNAs and mRNAs that are physically
associated with Argonaute 2 (Ago2), which is a core RISC component. We transfected
HEK293T cells with epitope-tagged Ago2, immunopurified Ago2 together with any
associated miRNAs and mRNAs, and quantitatively determined the levels of these
RNAs by microarray analyses. We found that Ago2 immunopurified samples
contained a representative repertoire of the cell‟s miRNAs and a select subset of the
cell‟s total mRNAs. Transfection of the miRNAs miR-1 and miR-124 caused
significant changes in the association of scores of mRNAs with Ago2. The mRNAs
whose association with Ago2 increased upon miRNA expression were much more
likely to contain specific miRNA seed matches and to have their overall mRNA levels
decrease in response to the miRNA transfection than expected by chance. Hundreds of
mRNAs were recruited to Ago2 by each miRNA via seed sequences in 3‟-untranslated
regions and coding sequences and a few mRNAs appear to be targeted via seed
sequences in 5‟-untranslated regions. Microarray analysis of Ago2 immunopurified
samples provides a simple, direct method for experimentally identifying the targets of
miRNAs and for elucidating roles of miRNAs in cellular regulation.
46
Introduction
MicroRNAs (miRNAs) are ~22 nucleotide non-coding RNAs that regulate protein
production by pairing to appropriate complementary stretches in
mRNAs[25,59,252,253]. Hundreds of miRNAs are encoded in the human genome,
with an estimated 30% of mRNAs possessing conserved miRNA binding sites,
suggesting that miRNA-based regulation is an integral component of the global gene
expression program[83,86]. The importance and functional range of miRNAs is
evident from their widespread occurrence and the diverse and often strong phenotypes
and disease states associated with mutation or altered expression of
miRNAs[30,92,93,94,95,96,97,98]. miRNAs function through formation of a
ribonucleoprotein complex termed the RNA-induced silencing complex
(RISC)[49,59,137,167]. In humans, RISC is minimally composed of a guide miRNA
bound to an Argonaute protein (Ago 1, 2, 3 or 4), along with Dicer and the HIV
transactivating response binding protein
(TRBP)[49,63,134,138,164,165,166,167,168]. Experiments in mice and human cell
lines show that Ago2 is the central RISC component, capable of cleaving target
mRNA when there is perfect miRNA:mRNA
complementarity[40,63,109,168,211,212,213]. However, most miRNA:mRNA
interactions in metazoans have imperfect complementarity[60,89], and it is likely that
an overwhelming majority of miRNA targets are not cleaved by Ago2. In many cases
it is likely that miRNAs repress translation and/or promote decay of their mRNA
targets[9,26,29,31,33,55,96,99,100,101,102,103,104,105,106,107,108].
A combination of experimental and computational approaches has begun to elucidate
how mRNA targets are specifically recognized by miRNAs. From this large body of
work, several salient features of target recognition have emerged. First, it is likely that
most miRNA target sites are located in 3‟-untranslated regions (UTRs) of
mRNAs[9,60,83,88,89,196,197,198,199]. Sites in coding sequences and, in at least
one instance, 5‟-UTR can also lead to decreased protein levels, although they do so
47
less efficiently than sites in 3‟-UTRs[29,83,88,200,201,202]. Second, a stretch of six
to eight nucleotides near the 5‟-end of the miRNA, the “seed region”, are particularly
important for miRNA function[29,60,89,196]. Their importance is underscored by the
fact that the complementary regions are among the most evolutionarily conserved
regions in mRNA targets and in some instances the seed match alone appears
sufficient to confer recognition[60,83,89,199,204].
The observation that miRNAs cause decreases in the abundance of at least some
mRNA targets provides a powerful strategy for determining what features in mRNA
and miRNA sequences contribute to specificity[26,29,31,33,55,96,101,102,104,105].
Recently, Lim et al. found that transfection of each of two miRNAs, heart-specific
miR-1 and brain/kidney-specific miR-124, into HeLa cells led to decreases in
abundance of at least 96 and 174 mRNAs respectively, many of which were likely to
be direct targets as inferred from the enrichment of seed matches in their 3‟-UTRs
(~90% had 6mer seed matches)[29]. The observation that many of these targets had
conserved seed matches in their 3‟-UTRs and that overexpression of the miRNA
induced a muscle-like or brain-like gene expression program, respectively, suggested
many of the apparent targets were physiological, even though miR-1 and miR-124 are
not normally present in HeLa cells. In addition to the 3‟-UTR sites, the authors found
evidence for some targeting to sites in coding sequences. This miRNA
overexpression/microarray approach was subsequently expanded to 11 miRNAs and
used to identify additional features in mRNAs that contribute to changes in target
mRNA levels[88]. These data provided the basis for a model for the effectiveness of
each seed match site in 3‟-UTRs of mRNAs for ~450 miRNAs (TargetScan 4.0).
Other miRNA target prediction methods are based on limited experimental data and
theoretical considerations (e.g. mRNA secondary structure surrounding predicted
sites), but only limited functional data are available to test their
performance[89,198,199,208,209,210].
One limitation of current approaches is that targets are often inferred from changes in
mRNA abundance; however, miRNA-induced decreases in protein levels can only
48
partially be accounted for by changes in mRNA levels, consistent with the view that
miRNAs affect both translation and mRNA decay
[9,26,29,31,33,55,96,99,100,101,102,103,104,105,106,107,108]. In addition,
identifying targets by altering miRNA expression and measuring changes in mRNA
levels returns no information on which targets might be the most important in carrying
out the actual biological processes (e.g. cellular differentiation) and is limited to the
study of the altered miRNA. Conservation is commonly used as a filter to identify
likely targets, but many functional sites are not conserved and many conserved sites
do not seem to be functional[88,254]. Although useful, the existing methods may be
capturing an incomplete and possibly biased subset of miRNA targets.
A direct experimental method to identify miRNA targets that does not rely on any
specific mechanism of regulation, conservation, or the altered expression of specific
miRNAs is required to fully explore the suite of miRNA targets. Here we describe a
simple method that provides quantitative information about which mRNAs are being
regulated by miRNAs in a cell population. We express affinity-tagged Ago2 in Human
Embryonic Kidney (HEK) 293T cells, immunopurify the resulting tagged Ago2
complexes, and identify the associated mRNAs and miRNAs using DNA microarrays.
This Ago2 immunopurification (IP)/microarray approach allows miRNA targets to be
comprehensively identified in an unbiased fashion, and provides a method for
comprehensively assessing the regulation of mRNAs by RISC. In addition, mRNA
targets of particular miRNAs can be identified by comparing the Ago2 IP/microarray
profiles of cells expressing a particular miRNA to the Ago2 IP/microarray profiles of
untreated cells.
49
Results
A Method for Isolating and Identifying miRNAs and mRNAs Associated With
Ago2
Ago2 is a core component of the RISC complex, associating both with miRNAs and
their mRNA targets[63,168]. Thus, immunopurifying Ago2 under the appropriate
conditions might retain associated miRNAs and mRNAs, allowing miRNA targets to
be identified. At the outset of the project no effective antibodies were available for
immunopurifying Ago2 from mammalian cells. We therefore chose to express a
FLAG-tagged Ago2 protein and identify mRNAs and miRNAs that were associated
with it.
HEK293T cells were transfected with an N-terminal FLAG-tagged Ago2 construct,
allowed to express FLAG-Ago2 for 48 h, and lysed (Figure 1A). Whole cell lysates
from transfected cells were mixed with a FLAG antibody resin, resin was then
washed, and RNA bound to the resin was recovered by phenol-chloroform extraction.
To control for nonspecific association of RNAs with the resin, lysates of mock-
transfected cells were subjected to the same affinity purification.
FLAG IPs of FLAG-Ago2 transfected cells were enriched, relative to mock IPs, in the
RISC components Ago2 and Dicer (Figure 1B and 1C), in small RNAs (Figure 1D),
and in total RNA (5-10 fold; data not shown), consistent with successful purification
of the RISC complex and associated RNAs. This enrichment of RNA and Dicer was
lost when IPs were performed with a two-fold higher KCl concentration, whereas
Ago2 enrichment was not affected (Figure S1).
For microarray analysis, total RNA was isolated from crude lysates, amplified, and
labeled with Cy3, and Ago2-associated RNA was obtained from FLAG IPs, amplified,
and labeled with Cy5. The labeled RNAs were profiled by comparative hybridization
to DNA microarrays printed with the Human Exonic Evidence Based Oligonucleotide
50
Figure 1. Ago2 Association with Dicer and miRNAs.
A) Strategy for the systematic isolation and identification of RNA associated with Ago2. (B)
Immunopurification of FLAG protein purified from mock transfected cells (left) and FLAG-Ago2
transfected cells (right). A Dicer antibody (top) and FLAG antibody (bottom) were immuno-reactive
with bands corresponding to the predicted molecular weight of Dicer (~250 kD) and Ago2 (~90 kD).
(C) SYRO ruby protein stain of FLAG immunopurifications from mock transfected cells (left) and
FLAG-Ago2 transfected cells (right). (D) SYBR gold nucleic acid stain of small RNAs (20–40 bp)
isolated from whole cell lysate (left), FLAG immunopurification from FLAG-Ago2 transfected cells
51
(middle) and FLAG purification from mock transfected cells (right). Brackets outline expected
migration of nucleic acids ~21 base pairs in length.
(HEEBO) probe set containing ~45,000 70mer oligonucleotide probes designed to
detect transcripts for almost all known protein-encoding genes, alternatively spliced
transcripts for hundreds of genes, as well as many annotated non-coding RNAs,
mitochondrial-encoded mRNAs, and viral RNAs[255]. Small RNAs enriched by size
fractionation were labeled with Cy dyes and hybridized to microarrays containing
21mer probes designed to detect ~300 known human miRNAs[256].
Effects of Ago2 Overexpression on mRNA and miRNA Profiles
A major concern was that the miRNAs and mRNAs associated with overexpressed
Ago2 might not be completely representative of those normally associated with
endogenous Ago2. Indeed, although cells transfected with the FLAG-Ago2 construct
were normal in appearance and size, they grew at only ~75% the rate of mock-
transfected cells, indicating some perturbation induced by the overexpression of
FLAG-Ago2.
One method for gauging changes in cell physiology is global gene expression
profiling, which is a sensitive way of assessing changes in cell state since most
physiological responses are associated with changes in mRNA expression[257]. As
shown in Figure 2, the mRNA profiles from the Ago2-transfected and mock-
transfected samples were very similar. Hierarchical clustering showed that the Ago2-
transfected samples did not segregate away from the mock-transfected samples
(Figure 2A), consistent with the hypothesis that Ago2-transfection had little effect on
mRNA levels. Using the significance analysis of microarrays (SAM) algorithm[258],
we found only one transcript with significant differential expression between Ago2-
and mock-transfected samples: a ~25 fold enrichment of a CMV IRES sequence
present in the exogenous FLAG-Ago2 expression transcript. Endogenous Ago2
mRNA levels did not change, as measured by a probe designed to detect the 3‟-UTR
52
of endogenous Ago2. Thus, FLAG-Ago2 overexpression had little detectable effect on
mRNA profiles.
We also assessed whether FLAG-Ago2 overexpression altered the cells‟ miRNA
profile. For the 90 miRNAs deemed to be expressed in HEK293T cells, the levels of
expression in the presence and absence of FLAG-Ago2 transfection were very similar,
with only a few miRNAs registering changes of around two-fold between the two
conditions (Figure 2B). Thus FLAG-Ago2 overexpression had little effect on the
miRNAs present.
The striking similarity in the mRNA and miRNA profiles for the Ago2 and mock
transfected cells suggests that Ago2 overexpression does not substantially alter the
global gene expression program at the mRNA level. These results give us confidence
that conclusions drawn from our IPs are also applicable to unperturbed HEK293T
cells.
Ago2 Immunopurifications Contain a Representative Profile of the Cells’
miRNAs and a Specific Subset of Their Total mRNAs
HEK293T cells were transfected with FLAG-Ago2, and the FLAG-Ago2 associated
miRNAs and mRNAs were isolated, amplified, labeled with Cy dyes, and analyzed by
hybridization to HEEBO and miRNA arrays. The microarray data were then analyzed
by SAM. As shown in Figure 3A, 1215 mRNAs were overrepresented in the FLAG
IPs from FLAG-Ago2-transfected cells relative to mock-transfected cells at a local
false discovery rate (FDR)[259] of 1%. Supervised hierarchical clustering showed that
the profiles of mRNAs significantly enriched in 8 FLAG-Ago2-transfections were
clearly similar to each other and distinct from 14 mock transfection profiles (Figure
3A), demonstrating the reproducibility of the association of this subset of mRNAs
with Ago2. The conservatively-estimated ~1200 overrepresented mRNAs presumably
represent messages being actively regulated by miRNAs under basal conditions. Based
upon gene ontology (GO) terms, the Ago2-associated mRNAs were
53
Figure 2. Overexpression of FLAG-Ago2 Does Not Perturb Overall mRNA
Expression or miRNA Expression.
(A) Unsupervised hierarchical cluster of mRNA levels in HEK293T cells determined relative to a
universal reference for RNA from FLAG-Ago2 transfected cells (red) and mock transfected cells (blue).
Rows correspond to 12,931 gene elements (representing ~9,059 genes) and columns represent
individual experimental samples (rave = 0.92, Pearson correlation between averaged values from each
side of the highest node in the dendrogram). (B) Scatter plot of the normalized log2 microarray signal
intensity of 90 expressed miRNAs from whole cell lysates of mock transfected cells (x-axis) versus the
normalized log2 microarray signal intensity from Ago2 transfected cells (y-axis, r = 0.98). Values are
the averages of 3 experiments. The grey lines delineate the boundary for a two-fold change.
54
diverse in their functional themes, highlighting the likely importance of RISC and
miRNA-mediated regulation in diverse cellular processes.
We also compared the FLAG-Ago2-associated miRNAs to the overall pool of
miRNAs obtained from FLAG-Ago2-transfected HEK293T cells. For the 90 miRNAs
judged as being detectably expressed, their representation in the FLAG-Ago2 IPs
(Figure 3B, y-axis) was proportional to their overall abundance (Figure 3B, x-axis),
with the exception of one miRNA (miR-485-5P) that was about 4-fold down in the
FLAG IP. Thus, FLAG-Ago2 IPs contained a fairly representative array of the cells‟
miRNAs and a select subset of the total mRNAs
Systematic Identification of mRNAs Regulated by miR-1 and miR-124
To identify mRNAs that were recruited to RISC in response to particular miRNAs, we
transfected HEK293T cells with FLAG-Ago2 with or without one of two miRNAs not
normally expressed in HEK293T cells (miR-1 or miR-124), and assessed how the
Ago2-associated mRNA profile was affected . We then used SAM to test for mRNAs
whose association with Ago2 was significantly higher in the Ago2-plus-miR-
transfected cells relative to the Ago2-transfected cells.
The transfection of miR-1 and miR-124 promoted the association of distinct sets of
mRNAs with FLAG-Ago2 and presumably RISC. At a stringent 1% local FDR, SAM
identified 68 mRNAs specifically recruited by miR-1 and 419 mRNAs specifically
recruited by miR-124. Fifty-nine and 388 of these mRNAs, respectively, had RefSeq
IDs with 3‟-UTR sequences available. Hierarchical clustering of mRNAs based on
their association with Ago2 in response to each miRNA revealed a distinct,
reproducible target signature for each miRNA (Figure 3C). There was little overlap
between the sets of mRNAs; only three mRNAs were targeted to Ago2 by both miR-1
and miR-124. These data provide strong evidence that each of these miRNAs recruits
a distinct, reproducible set of mRNAs to FLAG-Ago2-containing RISC complexes.
55
Figure 3. Comparison of mRNA and miRNA Specifically Associated With Ago2
in the Absence or Presence of miR-1 or miR-124.
(A) Supervised hierarchical cluster of putative Ago2 targets that are enriched over mock (local FDR
1%) from FLAG purifications of FLAG-Ago2 transfected cells (red) and mock transfected cells (blue).
Rows correspond to 1,215 gene elements (representing ~1,083 genes) and columns represent individual
experimental samples. There is a high correlation between replicate experiments: rave = 0.80 for Ago2
replicates, 0.73 for mock replicates, and −0.070 for all experiments. (B) Scatter plot of the normalized
log2 microarray signal intensities of 90 miRNAs from whole cell lysate (x-axis) graphed against the
normalized log2 microarray signal intensities of miRNAs associated with Ago2 (y-axis, r = 0.92). Four
replicates were performed for each experiment. The grey lines delineate the boundary for a two-fold
change. (C) Supervised hierarchical clustering of putative miR-1 and miR-124 targets enriched over
Ago2 alone (1% local FDR) from FLAG purifications of FLAG-Ago2 transfected cells alone (red) and
FLAG-Ago2 transfected cells with miR-1 (green) or miR-124 (purple). Rows correspond to 667 gene
features (representing ~544 genes) and columns represent individual experimental samples. rave = 0.80
for Ago2 replicates, 0.77 for Ago2+miR-1 replicates, 0.90 for Ago2+miR-124 replicates, and 0.43 for
all experiments.
56
Seed Matches in the 3’-UTRs of Putative miR-1 and miR-124 Targets
In principle, the mRNAs specifically associated with Ago2 in cells transfected with
miR-1 or miR-124 could have been targeted to Ago2 either directly by the transfected
miRNA or by an indirect mechanism; for example, by other miRNAs whose
abundance or activity is enhanced indirectly by miR-1 or miR-124. If the miRNA
specific Ago2 associated mRNAs consisted predominantly of direct targets, we would
expect that many would contain seed matches to the 5‟ ends of the respective
miRNAs. As an initial approach to this question, we examined what fraction of the
high confidence miR-1 and miR-124 targets possessed seed sequences. By the least
stringent definition of a seed match – a six-nucleotide match complementary to
nucleotides (nt) 2-7 or nt 3-8 in the miRNA – 70% of the miR-1 targets and 75% of
the miR-124 targets possessed seed matches, a highly significant (P < 10-6
and < 10-25
,
hypergeometric density distribution) enrichment over would be expected by chance
(Table 1, designated „6mer‟ seed match). For other more stringent definitions of seed
matches (7mer: complementarity at nt 2-8 or complementarity at nt 2-7 plus an A at
target position 1; 8mer: complementarity at nt 2-8 and an A at target position 1) the
percentage of the miR-1 and miR-124 targets with seed matches was lower but still
highly significant (Table 1). This indicates that the majority of miR-1 and miR-124
targets are likely to be direct targets of the miRNAs.
A second approach to the same question was to ask which 6mers were most highly
overrepresented in the 3‟-UTRs of the high confidence miR-1 and miR-124 targets.
For miR-1, the most highly overrepresented 6mer was UUUUUU. This low
complexity sequence is often speciously enriched in small sample sizes because of its
frequent occurrence in 3‟-UTRs. Thus it is likely not specifically associated with miR-
1. The next three most highly overrepresented 6mers were overlapping sequences with
perfect complementarity to positions 1-8 in miR-1 (Figure 4Ai). We also calculated
the frequency with which a perfect match to each of the 16 6mers in miR-1 was found
in the high confidence miR-1 targets. As shown in Figure 4Aii, the three most 5‟
6mers were highly overrepresented. Similarly, the multiple expectation maximization
57
Table 1. Enrichment of seed match sites to miR-1 and miR-124 in Ago2 IP targets
(1% local FDR).
58
for motif elicitation (MEME) motif discovery algorithm identified a 10 nt motif
sequence from the high confidence miR-1 targets with perfect complementarity to
positions 1-8 in miR-1 (Figure 4Aiii)[260].
Analogous results were found for miR-124, although in this case there was some
enrichment for base pairing near the 3‟ end of the miRNA as well as base pairing near
the 5‟ end (Figure 4Bi and Bii). These results are consistent with previous reports
demonstrating no preference for base-pairing immediately adjacent to the seed match,
but some base-pairing with miRNA positions 13-18[88,198]. The 10 nt motif returned
by MEME included a 7 nt stretch with perfect complementarity to positions 2-8 in
miR-124.
We also looked for overrepresentation of the nt 2-7 seed matches for all 90 of the
miRNAs we deemed as being expressed in HEK293T cells in the putative miR-1 and
miR-124 targets. None were found to significantly overrepresented; the response
appeared to be specific.
Taken together, these data indicate that most of the high confidence targets of miR-1
and miR-124 are likely to be direct targets. In addition, the same sequence criteria
inferred from previous studies for the recognition of mRNA targets by miRNAs
[60,88,89,196,197], especially the importance of sequences complementary to
positions 1-8 in the miRNA, emerged independently from analysis of the mRNAs
overrepresented in FLAG-Ago2 IPs. These results provide an important validation of
the IP method.
Relationship Between Overrepresentation in Ago2 Immunopurifications and
Underrepresentation in the Bulk mRNA Pool
miRNAs appear to regulate gene expression by effects on mRNA abundance or
translation or both. Therefore, previous studies focusing on changes in mRNA levels
59
Figure 4. Significantly Enriched Motifs in 3′-UTRs Targeted to Ago2 by miR-1
and miR-124.
(A) Analysis of mRNAs associated with Ago2 from cells transfected with FLAG-Ago2 and miR-1
relative to cells transfected with Ago2 alone (1% local FDR). (i) Enrichment of hexamers in 3′-UTRs of
miR-1 IP targets compared to 3′-UTRs of all mRNAs passing array filters. Shown are hexamers with at
least four contiguous Watson-Crick base pairs to miRNA with a p-value cut-off of 0.001 (binomial test
with bonferroni correction). Rank by p-value relative to all 4096 hexamers. Bases in red can form
60
Watson-Crick base pairs with miR-1. (ii) Moving plot of observed/expected ratios of hexamers
complementary to miR-1. Frequencies calculated as in (i). (iii) 10mer motif returned by MEME motif
finder using 3′-UTR sequences from the miR-1 high confidence target set. For each position in the
motif, the combined height of the bases represents the information content at that position, whereas the
relative heights of the individual bases represent the frequency of that base at that position. Bases in red
can form Watson-Crick base pairs with miR-1. Numbers underneath the logo correspond with miRNA
5′-position, with 1 being the 5′-most miRNA nucleotide. (B) Same as in (A), except for mRNAs
associated with Ago2 from cells transfected with FLAG-Ago2 and miR-124 relative to cells transfected
with Ago2 alone.
alone potentially miss many targets. We hypothesized that the IP method could
capture all direct mRNA targets regardless of functional outcome. To test this, we
measured mRNA levels from cells transfected with the respective miRNAs in parallel
to the IP experiments. We found 0 and 145 mRNAs significantly decreased in
presence of miR-1 and miR-124, respectively, at a 1% local FDR threshold. Thus
significantly more putative miRNA targets, 56 and 388 respectively, were identified
by miRNA-specific enrichment Ago2 IPs than from the miRNA-specific changes in
mRNA levels.
To further explore the relationship between Ago2 IP enrichment and mRNA
expression change, we relaxed the stringency for the SAM analysis of miRNA-
induced decreases in mRNA abundance to a 10% local FDR threshold (16 for miR-1
and 255 for miR-124), and mapped the values from each assay onto two axes (Figure
5). We broke the data into three color coded classes: mRNAs that are overrepresented
in Ago2 IPs and decrease in mRNA level (Figure 5, black lines); mRNAs that are
overrepresented in Ago2 IPs but do not significantly decrease in mRNA level (Figure
5, red lines); and mRNAs that are not overrepresented in Ago2 IPs, but decrease
significantly at the mRNA level (Figure 5, blue lines). To enrich for the highest
confidence targets, we focused on mRNAs with a 7mer seed match in their 3‟-UTRs.
Only a minority of the targets that were significantly overrepresented in the Ago2 IPs
were also significantly decreased in their mRNA levels: 24% of the miR-1 IP targets
and 40% of miR-124 IP targets (Figure 5, black lines). These targets are represented
61
by lines that run from the positive side of the Ago2 IP axis to the negative side of the
expression axis (Figure 5, black lines). On average the mRNA levels of these miR-1
and miR-124 targets decreased 58% and 61%, respectively. The majority of the targets
overrepresented in Ago2 IPs did not show significant decreases (10% local FDR) in
their overall mRNA levels (Figure 5, red lines). Nevertheless, approximately 90% of
these IP targets did show some decrease in their expression levels (Figure 5, red lines),
with average decreases of 24% and 25%, respectively. Thus, most of the mRNAs
overrepresented in Ago2 IPs did exhibit a modest decrease in their mRNA levels. The
mRNA targets whose levels decreased only modestly may be regulated primarily at
the translation level or miRNAs may play only small modulatory roles in the
expression of the proteins these mRNAs encode.
Conversely, 44% and 56% of mRNAs that decreased significantly in response to miR-
1 and miR-124 transfection, respectively, were not significantly overrepresented (1%
local FDR) in the Ago2 IPs (Figure 5, blue lines). However, almost all of these (9/9
miR-1 targets and 63/65 miR-124 targets) were enriched to some extent in the Ago2
IPs to some extent (Figure 5, blue lines). This trend argues that most of these mRNAs
are actually miR-1 and miR-124 targets.
Relationship Between Size and Number of Seed Matches and Overrepresentation
in Ago2 Immunopurifications
Bartel and co-workers[88] previously reported that mRNAs with long seed match sites
(e.g. 8mer matches) were more likely to change in abundance in response miRNA
transfection than those with shorter seed match sites, and that mRNAs with two 7mer
seed match sites were more likely to show changes than those with one. We therefore
asked whether the same relationships would hold based on overrepresentation of
mRNAs in Ago2 IPs. As shown in Figure S2, this was indeed the case. For both miR-
1 and miR-124, mRNAs with a single 8mer seed match site were overrepresented in
the Ago2 IPs relative to those with single 7mer seed match sites, and those with single
7mer seed match sites were overrepresented relative those with single 6mer seed
62
match sites (Figure S2A and B). Likewise, mRNAs with two or more 7mer seed match
sites were overrepresented in the Ago2 IPs relative to those with one (Figure S2C and
Figure 5. Relationship Between Overrepresentation in Ago2 IP and Changes in
mRNA Levels Due to miR-1 and miR-124.
(A) Lines connect the log2 of the average Ago2 IP value (bottom axis) to the log2 of the average mRNA
expression change (top axis) for three groups of mRNAs from miR-1 experiments. This analysis has
only mRNAs with 7mer seed matches in their 3′-UTRs. Black lines correspond to mRNAs that were
Ago2 IP targets and decreased at the mRNA level (10% local FDR); seven mRNAs are in this group.
Red lines correspond to IP targets but did not decrease significantly at the mRNA level; 20 of 22
mRNAs in this group decrease (log2 change<0) at the mRNA level (P<10−5
, one-way binomial test).
Blue lines correspond to mRNAs that decreased at the mRNA level, but were not Ago2 IP targets; all 9
mRNAs in this group are overrepresented (log2 enrichment>0) in Ago2 IPs (P = 0.0006). (B) as in (A)
63
except for mRNAs from miR-124 experiments. 82 mRNAs are in black. 109/121 mRNAs in red
decrease at the mRNA level (P<10−15
); and 63/65 mRNAs in blue are up in Ago2 IPs (P<10−15
).
D). The same relationships were found in the changes of mRNA levels in response to
miR-1 and miR-124 (data not shown). These findings corroborate and extend those of
Grimson et al.[88] and further validate the Ago2 IP method.
Analysis of Putative Target mRNAs that Lack 3’-UTR Seed Matches
Interestingly, a large minority, 30% and 25%, of high confidence miR-1 and miR-124
targets identified by Ago2 IP do not contain a 6mer seed match in their 3‟-UTRs.
Several studies have provided evidence that seed matches in the coding sequence and
5‟-UTR can also confer regulation by a miRNA, as judged by mRNA expression data,
Ago2 IPs in Drosophila, phylogenetic conservation analyses and reporter
studies[29,83,88,200,201,202]. We therefore checked for enrichment of 7mer seed
matches in the coding sequences of miR-1 and miR-124 Ago2 IP targets. As reported
in Table 1, 29% and 33% of Ago2 IP targets contained coding sequence 7mer seed
match sites for miR-1 and miR-124 respectively (P = 0.007 and 10-20
, hypergeometric
distribution). Further, 59% and 47% of miR-1 and miR-124 targets that lacked any 3‟-
UTR seed matches contained 7mer seed matches in their coding sequences (P < 10-5
and 10-15
; Table 1). 5‟-UTR 7mer seed matches were also significantly
overrepresented (P = 0.001 and 0.0005 for miR-1 and miR-124, respectively; Table 1).
We next set out to assess the effectiveness of 3‟-UTR seed matches versus coding
sequence seed matches in the Ago2 IP targets, as assessed by effects on mRNA
expression (Figure 6A and B). Seed matches in the 5‟-UTR were not included in this
analysis because of their small numbers. We considered two subsets the miR-1 and
miR-124 targets: those mRNAs that possessed a 7mer seed match in the 3‟-UTR but
no 6mer seed match in their coding sequence (Figure 6, red curves) and those that
possessed a 7mer seed match in their coding sequence but no 6mer seed match in their
3‟-UTR (Figure 6, green curves). As a comparison group we examined all mRNAs
(not just those whose levels in the Ago2 IPs changed after miRNA transfection) that
64
contained no 6mer seed match (Figure 6, black curves). We then plotted the
cumulative distributions for each subset as a function of the miRNA-induced change
in expression level (Figure 6). If one type of seed match was highly effective at
causing mRNA expression decreases, we would expect the cumulative distribution of
that subset to be shifted to the left with respect to the black curve. That was the case
for the coding sequence seed matches, although the shift was modest (Figure 6A and
B, green) (P < 0.006 and 10-8
for miR-1 and miR-124, respectively). The 3‟-UTR seed
matches shifted further to the left (Figure 6A and B, red) (P = 0.0004 and 0.00005 for
miR-1 and miR-124 respectively). Thus, coding sequence seed matches appeared to be
effective in decreasing mRNA levels, but 3‟-UTR seed matches were more effective.
These conclusions agree well with previous studies based on other assays and
approaches.
As a further test of the significance of coding sequence seed matches, we compared
how well conserved they were compared to 3‟-UTR seed matches. Of the high
confidence miR-1 and miR-124 targets with 7mer 3‟-UTR seed matches, 41% and
47% of the mRNAs contained seed matches that were perfectly conserved across
mouse, rat and dog. Of the high confidence targets with 7mer coding sequence seed
matches, 25% and 35% of the mRNAs contained conserved seed matches across the
same species. We also compared whether high confidence targets were more likely to
contain conserved seed matches than were non-targets for both coding sequence and
3‟-UTR seed matches. For 7mer 3‟-UTR seed matches, the conservation rate was
higher in Ago2 IP targets than in non-targets (41% vs. 22% for miR-1 and 47% vs.
45% for miR-124; P = 0.005 and 0.3). For 7mer coding sequence seed matches, the
conservation rates were very similar for targets versus non-targets (25% for targets vs.
29% for non-targets for miR-1; 35% for targets vs. 36% for non-targets for miR-124;
P = 0.4 and 0.6). These comparisons strongly suggest that 3‟-UTR seed matches are
more important than coding sequence seed matches for the regulation of mRNA
levels[29,83,88,200,201,202].
65
Figure 6. Comparison of Expression Changes of mRNAs Containing Seed
Matches in 3′-UTRs and Coding Sequences of miR-1 and miR-124 Ago2 IP
Targets.
(A) Cumulative distribution of the change in mRNA levels following transfection with FLAG-Ago2
and miR-1 compared to FLAG-Ago2 alone. This analysis included Ago2 IP targets with 3′-UTR 7mer
seed matches, but no coding sequence 6mer seed matches (21, red), Ago2 IP targets with coding
sequence 7mer seed matches, but no 3′-UTR 6mer seed matches (10, green), and mRNAs that did not
contain 3′-UTR or coding sequence 6mer seed matches (2893, black). Changes in mRNA levels of
Ago2 IP targets with 3′-UTR 7mer seed matches were greater than those for Ago2 IP targets with
coding sequence 7mer seed matches (P = 0.0004), which were in turn greater than those for mRNAs
without any 6mer seed matches in the 3′-UTR or coding sequence (P = 0.006). (B) Same as in (A)
except for mRNAs associated with FLAG-Ago2 upon transfection with miR-124. There were 81 Ago2
IP targets with 3′-UTR 7mer seed matches but no 6mer coding sequence seed matches (red), 43 Ago2
IP targets with coding sequence 7mer seed matches but no 6mer 3′-UTR seed matches (green), and
1877 mRNAs with no 6mer seed matches in their 3′-UTR or coding sequence. Changes in mRNA levels
of Ago2 IP targets with 3′-UTR 7mer seed matches were greater than the changes for Ago2 IP targets
with coding sequence 7mer seed matches (P = 0.0005), which in turn were greater than the changes for
mRNAs without any 6mer seed matches in the 3′-UTR or coding sequence (P<10−8
).
66
Estimation of the Number of mRNAs Regulated by miR-1 and miR-124
Several thousand human mRNAs have seed match sites to either miR-1 or miR-124,
but only a small fraction of these were identified with high confidence as actual
regulatory targets by our gene expression profiling and IP experiments. We estimated
a lower bound of 68 targets for miR-1 and 419 for miR-124, based on the stringent 1%
local FDR criterion. Several prediction algorithms and reporter assays along with our
analysis in Figure 5 suggest that the total number of targets is significantly
higher[83,88,89,197,198,199,209,210]. We therefore took an alternative statistical
approach to this question. We ranked the 7805 (for miR-1-transfected cells) and 7817
(for miR-124-transfected cells) well-measured mRNAs with RefSeq IDs from most
enriched to least enriched in Ago2 IPs (Figure 7A and B, x-axes). Then for groups of
200 sequences, we calculated running averages of the fraction of mRNAs with 7mer
seed matches in their 3‟-UTRs. As expected, the fraction was high for the most
enriched mRNAs and low for the least (Figure 7A and B). We then estimated where
the curve first significantly rose above the background frequency of 7mer seed
matches. To accomplish this we calculated the slope between the right-hand end of the
distribution and every point to the left of it. We took the cutoff to be where the slope
of this line first became negative (Figure 7A and B, vertical gray line). We then
calculated the estimated number of targets as:
number M fM fB
Functions of the High Confidence miR-1 and miR-124 Targets
To determine if miR-1 and miR-124 selectively bind mRNAs that share common
biological functions we searched for enrichment of GO terms in the miRNAs target
sets identified through Ago2 immunopurification. There is modest enrichment of
several GO categories for each miRNA target set: for example, the miR-124 set is
enriched for mRNAs encoding proteins localized to the membrane (P = 0.002) or that
bind GTP (P = 0.009), and the miR-1 set is
67
Figure 7. Estimation of the Number of miR-1 and miR-124 Targets.
(A) Moving average plot (window size of 200) of the fraction of mRNAs with 7mer 3′-UTR seed
matches to miR-1. mRNAs were ranked by their SAM enrichment in Ago2 IPs in the presence of miR-1
compared to Ago2 alone, with 1 corresponding to the most enriched mRNA. To determine the point at
which the curve first rose above the background level of 7mer seed matches, we first calculated the
slope of each least-squares-fit regression line between the right-hand end of the distribution and every
point to left of it. The point at which the curve first rose above the background level of 7mer seed
matches was determined as the point at which the slope was first negative (vertical grey line). The
fraction of mRNAs containing 7mer seed matches to the right of the vertical grey line was considered to
be the background level of 7mer seed matches (horizontal grey line). To estimate the total number of
targets (pink shaded region), the number of mRNAs to the left of the vertical grey line (3071 of 7805)
was multiplied by the fraction of mRNAs to the left of the vertical line containing 7mer 3′-UTR seed
matches (0.23) minus the fraction of mRNAs to the right of the vertical line containing 7mer seed
matches (0.12). This results in an estimate of 325 targets. (B) Same as in (A), but for miR-124. 6393 of
7817 mRNAs were to the left of the vertical grey line. The fraction of mRNAs with 7mer 3′-UTR seed
matches to the left of the grey vertical line was 0.21, while the fraction of mRNAs with 7mer seed
68
matches to the right of the grey vertical lines was 0.07. This results in an estimate of 1000 targets. (C)
Same as in (A), except moving average plots of the fraction of mRNAs with 7mer coding sequence seed
matches to miR-1. mRNAs with 6mer 3′-UTR seed matches were removed, leaving 4855 mRNAs. 820
mRNAs were to the left of the vertical grey line. The fraction of mRNAs with 7mer seed matches to the
left and right of the grey vertical line was 0.24 and 0.14 respectively. This results in an estimate of 83
targets. (D) Same as in (C), but for miR-124. 3312 of 3916 mRNAs were to the left of the vertical grey
line. The fraction of mRNAs with 7mer seed matches to the left and right of the grey vertical line was
0.15 and 0.08 respectively. This results in an estimate of 236 targets.
where M is the number of mRNAs to the left of the cutoff, fM is the fraction of those mRNAs with 7mer
seed matches, and fB is the fraction of the mRNAs to the right of the cutoff with 7mer seed matches.
This method gives estimates of 325 and 1000 mRNAs recruited to Ago2 by 3‟-UTR seed matches to
miR-1 and miR-124, respectively (Figure 7A,B). Using 6mer seed matches rather than 7mers yielded
similar estimates, 293 and 1232 respectively (data not shown). Applying the same logic to mRNAs with
7mer seed matches in their coding sequences but no 6mer 3‟-UTR seed matches gives estimates of 83
miR-1 and 236 miR-124 targets recruited to Ago2 exclusively through miRNA targeting of the coding
sequence (Figure 7C and D). Using 6mer seed matches again yielded similar estimates (50 and 253;
data not shown). These data provide direct empirical evidence that miR-1 and miR-124 have hundreds
of direct mRNA targets. These miRNAs are highly connected hubs in the network of RNA regulation.
enriched for mRNAs involved mRNA metabolism (P = 0.006) and cell motility (P =
0.015). We also tested the distribution of ~430 curated gene sets in the IP enrichments
as a whole. Using curated gene sets from gene set enrichment analysis[261] rather
than GO terms, we found that no gene sets were significantly enriched at a corrected
P-value threshold of 0.05.
Using Ago2 Immunopurification Enrichment and mRNA Expression Changes to
Assess Computational Target Prediction Methods
Our empirical data on miR-1 and miR-124 targets allow us to assess computational
methods for the prediction of miRNA targets. We examined five methods: TargetScan
4.0, which looks for seed matches in appropriate sequence contexts[88]; TargetScan
3.0 and PicTar, which look for seed matches conserved among human, dog, mouse,
rat, and chicken mRNAs[89,199]; PITA, which makes use of seed matches and
predicted target accessibility[209]; and MiRanda, which looks at sequence
complementarity and conservation among human, mouse and rat mRNAs[197,198].
69
The performance of these methods was assessed by cumulative distribution plots, with
either microarray expression data or Ago2 IP enrichment data on the x-axis (Figure
S3). The more successful the method, the further its cumulative distribution curve
should shift to the left (for expression data) or the right (for Ago2 IP enrichment). As
shown in Figure S3, TargetScan 4.0 performed best for predicting both miR-1 targets
and miR-124 targets (blue curves). TargetScan 3.0 and PicTar were next best
(magenta and orange curves), followed by PITA and Miranda (green and gray curves).
None of the computational methods performed as well as an expression data-plus-seed
match criterion for predicting Ago2 IP-enriched targets (Figure S3A and B, red
curves). Likewise, none of the computational methods performed as well as an Ago2
IP-enrichment-plus-seed match criterion for predicting targets identified by the
expression data (Figure S3C and D, red curves). Thus, while TargetScan 4.0
performed particularly well, the two empirical methods (expression data and Ago2 IP
enrichment) were superior. This indicates that some information important for miRNA
target recognition is still missing from the prediction algorithms.
70
Discussion
A Direct Assay to Identify Targets of Specific miRNAs
Much of what we know about miRNA targeting has been inferred indirectly from
effects on mRNA levels, from phylogenetic conservation of recognition sites, and, on
a smaller scale, from effects on levels of the encoded proteins. Such studies have
provided a foundation for our understanding of miRNA regulation of gene expression,
yet crucial information directly linking these effects to miRNA pathways has been
missing. We would like to know what mRNAs are recruited to RISC by each miRNA
and are thus acted upon by miRNA-mediated regulation.
A simple method employing immunoaffinity isolation of Ago2, a core component of
RISC, identifies mRNAs recruited to RISC by specific miRNAs. Knowledge of these
mRNAs provides a direct and critical point of reference for understanding the
molecular mechanism and logic of mRNA target specificity and for comprehensive
investigation of the functional consequences of miRNA-induced interactions.
The selective association of specific mRNAs with Ago2 in response to specific
miRNAs is prima facie evidence for their miRNA-mediated recruitment to
Ago2/RISC. The enrichment of cognate seed matches in computationally predicted
favorable contexts and the correlation between specific miRNA-dependent Ago2-IP
enrichment and changes in mRNA levels are strong evidence that the assay reflects a
direct and functional interaction between the transfected miRNA and the Ago2 IP-
enriched mRNAs. Although the introduction of exogenous FLAG-Ago2 could have
altered the normal specificity of these interactions, the negligible effect of exogenous
FLAG-Ago2 on global patterns of expression of either mRNAs or miRNAs argue
against a major distortion of normal regulation and suggest that the interactions we
observed are generally faithful representations of native interactions.
71
The evolutionary conservation of many of the seed matches to miR-1 and miR-124 in
the 3‟-UTRs of the mRNAs identified as specific targets in our assay lends further
credence to the biological relevance of the interactions. Transfection of miR-1 or miR-
124 into these cells greatly increased the cellular levels of these miRNAs (which are
undetectable in untransfected cells), but the resulting concentrations appeared to be
well below those of the most highly expressed endogenous miRNAs, based on qRT-
PCR experiments (data not shown). The lack of enrichment (or underenrichment) of
seed matches to other miRNAs in the mRNAs recruited to Ago2-RISC after
transfection of miR-1 or miR-124 further implies that perturbation of endogenous
miRNAs and miRNA targets was not a significant factor in the Ago2-enriched
mRNAs.
The cells we used in this study were chosen for their experimental tractability; they
were not an optimal model for studies of the regulatory roles of miR-1 or miR-124.
The Ago2 IP procedure used herein should, however, be widely applicable to other
cells or even whole organisms, in which mRNAs identified as targets, by either
overexpressing or blocking a specific miRNA, can be related to specific biological
consequences.
Although there were significant changes in the levels of many of the mRNAs recruited
to Ago2/RISC in the presence of specific miRNAs, there were also many associated
mRNAs that were only slightly altered in expression level. The ability to identify
mRNA targets directly, without relying on a change in their levels in response to
perturbation of a specific miRNA, makes it possible to systematically investigate other
possible miRNA-directed effects on their expression, including, for example, effects
on subcellular localization or translation.
Functional Insights into miRNA Targeting and Regulation
The strong correlation between miRNA-specific association with Ago2 and decreases
in mRNA levels for mRNA targets with 3‟-UTR seed matches suggests that the
strength or properties of a miRNA‟s association with a potential target mRNA has an
72
important role in regulating their degradation. Most high confidence mRNA targets
with 3‟-UTR seed matches were regulated to some degree at the level of mRNA
abundance, albeit weakly in most cases.
Comparing the magnitude of the changes in mRNA abundance to direct measurements
of the efficiency with which each mRNA is recruited to RISC revealed a quantitative
relationship between the recruitment efficiency and consequences for expression.
Moreover, the link between size, number of seed matches and recruitment efficiency
suggests an evolutionary mechanism for quantitative tuning of the regulatory response
of each mRNA to a miRNA. A continuous scale of regulation, tuning affinity, or
context of a site that allows an increase in existing regulation is easier than evolving a
functional site de novo.
Insights into miRNA-based Regulation From Recent, Related Publications
While this paper was in preparation, four papers describing similar strategies to
identify mRNAs associated with RISC and specific miRNAs were
published[200,262,263,264]. We briefly review these results, highlighting the
similarities that strengthen common conclusions and differences that may be
instructive with respect to methodologies and biological mechanisms.
Easow et al. [200] immunopurified affinity-tagged Ago1 from Drosophila
melanogaster S2 cells and identified associated mRNAs via microarray hybridization.
The authors found 89 mRNAs specifically associated with Ago1. 3‟-UTR seed
matches to some highly expressed miRNAs were overrepresented in the target set.
The authors also found some enrichment of coding sequence seed matches to highly
expressed miRNAs in the Ago1 targets. The efficacy of coding seed match sites was
tested for two mRNAs lacking seed matches in their 3‟-UTR by cloning the coding
sequences in-frame with a luciferase reporter; mutation of these seed match sites led to
a ~25% increase in the expression of luciferase. The authors also created two
exogenous seed matches to a highly expressed miRNA in the coding sequence of
luciferase by mutating silent codon positions. Sequences with these seed matches
73
were also introduced into the SV40 3‟-UTR downstream of a luciferase reporter.
Addition of the seed match sites to both regions led to decreased luciferase levels, but
the repression was more pronounced when the sites were in the 3‟-UTR. 108 mRNAs
were differentially underenriched in Ago1 IPs of embryos with a mutation in miR-1
compared to Ago1 IPs from lysates of embryos with the wild-type miR-1 gene. The
regulatory effect of miR-1 on potential targets was gauged by comparing the luciferase
levels of reporter genes containing 3‟-UTRs of 11 of the 32 potential miR-1 targets in
the presence or absence of miR-1. Luciferase activity was reduced in the presence of
miR-1 for all 11 constructs, but to different extents, varying from ~5-60%. In all
cases, the decreases in luciferase activity were greater than the decreases in mRNA
levels, consistent with substantial translational regulation, as suggested by numerous
studies.
Zhang et al. [264] immunopurified GFP-tagged AIN-1 and AIN-2, which they found
to be Ago-associated proteins, from Caenorhabditis elegans whole animals and
identified associated miRNAs by sequencing and associated mRNAs by DNA
microarray hybridization. The authors found approximately 3000 (15% of all known
C. elegans genes) mRNAs associated with either AIN-1 or AIN-2, including many
known and predicted miRNA targets.
Beitzinger et al. [262] immunopurified Ago1 and Ago2 from HEK293T cells and
identified some associated mRNAs by sequencing. About 600 clones derived from
RNAs associated with Ago1 or Ago2 were sequenced. Nonspecific interactions with
the resin or antibody were not controlled for by comparison to “mock”
immunopurification. Instead, clones recovered once were classified as nonspecific and
clones recovered multiple times were counted as direct targets. Using this criterion,
only 82 unique Ago1 and 28 unique Ago2 targets were found, with 15 targets in
common. The large number of single hit clones indicates that the results represent a
non-exhaustive list of Ago2 targets. Thus, it is not surprising that the Ago2-associated
mRNAs identified in this study do not significantly overlap with our findings.
74
Karginov et al. [263] applied an Ago2 immunopurification strategy similar to ours to
identify Aog2-associated mRNAs and miRNAs in HEK293T cells. The authors found
over one thousand mRNAs specifically associated with Ago2. Ago2 IP enrichment
was positively correlated with the presence of 3‟-UTR seed match sites to highly
expressed miRNAs. Following transfection of miR-124, 370 mRNAs were specifically
recruited to Ago2. About half of the putative targets contained 7merm-8 seed matches
to miR-124 in their 3‟-UTRs. The mRNA levels of many of the putative miR-124
targets were significantly decreased in response to the presence of miR-124. The 3‟-
UTRs from 21 of 30 mRNAs that were miR-124 IP targets but did not change
significantly at the mRNA level that were incorporated into luciferase probes lead to
significant miR-124 dependent decreases in protein expression. Of the 370 mRNAs
for which Karginov et al. reported a miR-124 dependent association with Ago2, 238
had unique RefSeq IDs and were detected on our arrays. Forty-nine percent of these
mRNAs were also classified as miR-124 targets in our experiments at a 1% local FDR
threshold, 59% were enriched at a less stringent 10% local FDR cut-off, and 95% were
more enriched than the median IP enrichment of all mRNAs. Our findings are thus in
broad general agreement, and provide further validation of the approach and
individual insights into miRNA-based regulation.
There were also findings that were unique to our study. Enrichment of mRNAs
containing coding sequence and 5‟-UTR seed match sites was not observed in the
Karginov et al. study. The discrepancies may be related to differences in the IP
procedures. Karginov et al. washed immunopurified beads with 650 mM NaCl,
whereas our immunopurifications and washes were performed with 150 mM KCl. In
our hands, washing the Ago2 immunopurified beads with 300 mM KCl resulted in
loss of enrichment of total RNA and Dicer, whereas Ago2 enrichment was not
affected (SFigure 1). We did not analyze the pool of mRNA that remained bound to
Ago2 following this more stringent wash. It is possible that the stringent wash
employed in Karginov et al. disrupted relatively labile mRNA:RISC interactions,
including those in coding sequences and 5‟-UTRs. On the other hand, it is possible
that coding sequence and 5‟-UTR interactions identified in our assay were “created”
75
by association with Ago2 post-lysis. Another reason for the discrepancy could be
differences in the growth rate of the cells at the time of lysis. The global ribosome
occupancy at the time of lysis in the cells used in our experiments was quite low
because the cells reached high confluency during the 48 hours between transfection
and cell-lysis. It is possible that under conditions in which there is more translation,
coding sequence and 5‟-UTR sites are relatively less occupied compared to 3‟-UTR
sites, because these miRNA-mRNA interactions are disrupted by ribosomes. The
Karginov et al. study employed similar growth conditions, and also prepared extracts
48 hours after transfections. Regardless of the causes for the discrepancies, the
significant decrease in abundance of mRNAs containing coding sequence sites
suggests that these are biologically relevant miRNA targets.
76
Materials and Methods
Plasmids and oligonucleotides
CMV-FLAG-Ago2 plasmid was provided by G. Meister and T. Tuschl[63].
miR-1 siRNA:
sense: 5‟UGGAAUGUAAAGAAGUAUGUA3‟
antisense: 5‟CAUACUUCUUUACAUUCAAUA3‟
miR-124 siRNA:
sense: 5‟UAAGGCACGCGGUGAAUGCCA3‟
antisense: 5‟GCAUUCACCGCGUGCCUUAAU3‟
Cell culture and transfection
HEK293T cells were obtained from ATCC (Cat #CRL-11268) and grown in
Dulbecco‟s modified Eagle‟s medium (Invitrogen) with 10% fetal bovine serum
(Invitrogen) and supplemented with 100U/ml penicillin, 100mg/ml streptomycin, and
additional 4mM glutamine (Invitrogen) at 37°C and 5% CO2. Transfections of
HEK293T cells were carried out with calcium phosphate. Cells were plated in 10cm
dishes 12-16hrs prior to transfection at 30% confluency. For 1mL transfection
mixtures (1/10 volume of growth media) 61µl of 2M CaCl2 and 10µg of Ago2 plasmid
DNA were diluted into 500 µl of nuclease free H2O (Invitrogen) and added slowly to
500 µl of 2X HBS (50mM Hepes, 280mM NaCl, 1.5mM Na2HPO4) pH 7.1. After ~1
minute, the mixture was added to a 10cm plate at a medium pace. Transfections with
the miR-1 and miR-124 oligonucleotides were performed analogously by diluting a
40µM stock to 5nM in the 500µl nucleic acid mixture along with the plasmid DNA.
Imunoaffinity purification and RNA isolation
For each purification, 400µl of 4°C lysis buffer (150mM KCl, 25mM Tris-HCl pH
7.4, 5mM EDTA, 0.5% Nonidet P-
SUPERase•In
77
(Ambion Cat #AM2694) was added to ten 10cm plates after washing 1X in PBS 48
hrs post-transfection. After 30min at 4°C, the plates were scraped and the lysates
combined and spun at 4°C for 30 minutes at 14,000 RPM in a microcentrifuge. The
supernatant was then collected and filtered through a 0.45µm syringe filter. The lysate
was then mixed with 300µl of FLAG resin (Sigma Cat #A2220), which was
equilibrated by washing 2X with lysis buffer with 10X volume. The beads were
incubated with the lysate for 4hrs at 4°C and washed 2X with 10X volume of lysis
buffer for 5 minutes. Five percent of the beads were frozen for SDS PAGE analysis
after the second wash. RNA was extracted directly from the remaining beads with
25:24:1 phenol:chloroform:isoamyl alcohol (Invitrogen Cat#15593-031). Trace
amounts of phenol were removed by chloroform extraction and RNA was precipitated
using sodium acetate with Glyco-Blue (Ambion Cat# AM9516) as a carrier. RNA
pellets were resuspended in 25µl of RNase free water and stored at -80 °C. Small
RNA samples for PAGE detection were isolated using a modified protocol for RNA
isolation using Invitrogen‟s Micro-to-Midi kit (Invitrogen Cat#12183-18)[139]. Small
RNA for microarray analysis was fractionated using the FLASH-PAGE system
(Ambion Cat#AM13100) as per vendors‟ instructions.
Western blots, Sypro Staining, and Nucleic Acid PAGE
Resin saved from each immunoaffinity purification were resuspended in water and
diluted to 1X sample buffer and 1X reducing buffer (Biorad Cat#161-0791, and 161-0792)
and heated at 95oC for 3 min. Each sample was then divided and one-half was loaded
onto either a 4-12% criterion XT gel (BioRad Cat# 345-126) for protein staining with
sypro ruby (Invitrogen Cat #S-12000) or onto a 3-8% criterion XT gel for western
blotting (BioRad Cat# 345-0129). For the SYPRO ruby staining, gels were treated as
per the vendor‟s instruction immediately after electrophoresis. For western analysis,
each gel was transferred onto polyvinylidene fluoride membrane (Immobilon Cat#
IPVH08100) and probed with FLAG m2 antibody (Sigma Cat# F-1804) and a
polyclonal Dicer antibody generated by rabbits inoculated with a peptide
corresponding with the N-terminus of Dicer: EILRKYKPYERQQFESVC (Quality
Controlled Biochemicals). Small RNA was detected using 15% urea TBE criterion
78
gels (Biorad Cat# 345-0055) and Syber Gold (Invitrogen Cat# S-1149) as per the
vendor‟s instructions. RNA (0.5-1 µg) was loaded in each lane.
Microarray Production and Pre-hybridization Processing
Detailed methods for microarray experiments are available at the Brown lab website
(http://cmgm.stanford.edu/pbrown/protocols/index.html). HEEBO oligonucleotide
microarrays and miRNA microarrays were produced by Stanford Functional Genomic
Facility. The HEEBO microarrays contain ~45,000 70-mer oligonucleotide probes,
representing ~30,000 unique genes. A detailed description of this probe set can be
found at (http://microarray.org/sfgf/heebo.do)[255]. The miRNA arrays (Ambion
miRNA Bioarrays version 2)[256] contained probes for 668 human, mouse and rat
miRNAs. Each probe was printed in duplicate.
RNA from immunopurification experiments was hybridized to microarrays printed on
aminosilane-coated glass (Schott Nexterion A). Prior to hybridization, the
oligonucleotides were cross-linked to the aminosilane-coated surface with 65mJ of
UV irradiation. Slides were then incubated in a 500 ml solution containing 5X SSC
(1X SSC = 150 mM NaCl, 15 mM sodium citrate, pH 7.0), 1% w/v Blocking Reagent
(Roche Cat# 1109617001), and 0.1% SDS for 35 minutes at 65oC. Slides were washed
twice for 1 min each in glass chambers containing 400 ml water, dunked in a glass jar
containing 400 ml 95% ethanol for 15 seconds, then dried by centrifugation. Slides
were used the same day.
mRNA expression experiments and miRNA experiments were performed with
microarrays printed on epoxysilane-coated glass (Schott Nexterion E). Prior to
hybridization, slides were first incubated in a humidity chamber (Sigma Cat# H6644)
containing 0.5X SSC for 30 min at room temperature. Slides were snap-dried at 70-
80oC on an inverted heat block. The free epoxysilane groups were blocked by
incubation with 1M Tris-HCl pH 9.0, 100 mM ethanolamine (Sigma Cat# E9508), and
0.1% SDS for 20 minutes at 50oC. Slides were washed twice for 1 min each with 400
ml water, and then dried by centrifugation. Slides were used the same day.
79
Sample Preparation, Hybridization and Washing
For HEEBO microarray experiments, poly-adenylated RNAs were amplified in the
presence of aminoallyl-UTP with Amino Allyl MessageAmp II aRNA kit (Ambion
Cat# 1753). For expression experiments, universal reference RNA was used as an
internal standard to enable reliable comparison of relative transcript levels in multiple
samples (Stratagene Cat# 740000). Amplified RNA (3- ntly
labeled with NHS-monoester Cy5 or Cy3 (GE HealthSciences Cat# RPN5661). Dye-
solution containing 3X SSC, 25mM Hepes- -1 DNA
(Invitrogen Cat# 152790
tRNA (Invitrogen Cat # 15401029), and 0.3% SDS. The sample was incubated at 70oC
for 5 minutes, spun at 14,000 rpm for 10 minutes in a microcentrifuge, then hybridized
at 65oC for 12-16 hours. For immunopurification experiments, microarrays were
hybridized inside sealed chambers in a water bath using the M-series lifterslip to
contain the probe on the microarray (Erie Scientific Cat # 22x60I-M-5522). For
mRNA expression experiments, microarrays were hybridized using the MAUI
hybridization system (BioMicro), which promotes active mixing during hybridization.
Following hybridization, microarrays were washed in a series of four solutions
containing 400 ml of 2X SSC with 0.05% SDS, 2X SSC, 1X SSC, and 0.2X SSC,
respectively. The first wash was performed for 5 minutes at 65oC. The subsequent
washes were performed at room temperatures for 2 minutes each. Following the last
wash the microarrays were dried by centrifugation in a low-ozone environment (<5
ppb) to prevent destruction of Cy dyes[265]. Once dry, the microarrays were kept in a
low-ozone environment during storage and scanning (see
http://cmgm.stanford.edu/pbrown/protocols/index.html).
Small RNAs for miRNA microarrays were labeled using the mirVana labeling kit
(Ambion Cat# Am1562) and samples were prepared, hybridized and washed
according to manufacturer‟s instructions.
80
Scanning and Data Processing
Microarrays were scanned using either AxonScanner 4200 or 400oB (Molecular
Devices). PMT levels were auto-adjusted to achieve 0.1-0.25% pixel saturation. Each
element was located and analyzed using GenePix Pro 5.0 (Molecular Devices). These
data were submitted to the Stanford Microarray Database for further analysis
(http://smd.stanford.edu/cgi-bin/publication/viewPublication.pl?pub_no=685)[266].
Data were filtered to exclude elements that did not have a regression correlation of
≥0.6 between Cy5 and Cy3 signal over the pixels compromising the array element of
and intensity/background ratio of ≥2.5 in at least one channel, for 60% of the arrays.
For cluster and SAM (Fig2) analysis of Ago2 +/- miR-1/124 IPs versus mock IPs,
measurements corresponding to oligonucleotides that map to the same entrezID were
treated separately and the data were globally normalized per array, such that the
median log2 ratio was 0 after normalization. For all analysis after Figure 3,
measurements corresponding to oligonucleotides that map to the same entrezID were
averaged and the data were globally normalized per array, such that the median log2
ratio was 0 after normalization. To control for variation among groups of experiments
performed at different times, each group was normalized by subtracting the median
log2 ratio for each gene across the experiments in a group from the log2 ratio of the
gene in each experiment. The groups are labeled in the supplementary information.
miRNA microarray experiments were normalized by subtracting the median value of
average Cy3 and Cy5 signal intensities of negative control spots from the average Cy3
and Cy5 signal of each experimental measurement. Normalized Cy3 and Cy5 signal
intensities from replicate experiments were normalized and log2 transformed
(measurements with negative values were changed to a value of 1). The distribution of
the log2 signal intensities was nearly bimodal; miRNAs with signal intensity greater
than the value at the trough of the distribution were considered to be expressed.
The microarray data have been submitted to Gene Expression Omnibus (GEO)
(www.ncbi.nlm.nih.gov/geo/) under the accession number GSE11082.
81
Microarray Analyses
Hierarchical clustering was performed with Cluster 3.0[267] and visualized with Java
TreeView 1.0.12[268].
For SAM, unpaired two-class t-tests were performed with default settings (R-package
samr). FDRs were generated from up to 1000 permutations of batch normalized (see
above) data.
Sequence Data
For each entrezID, the RefSeq sequence with the longest 3‟-UTR was used. In cases
where there were multiple RefSeqs with the same 3‟-UTR length, the one that was
alpha-numerically first was used. RefSeq 3‟-UTR, coding, and 5‟-UTR sequences
were retrieved from UCSC genome browser (hg18). Seed match sites in these
sequences were identified with Perl scripts. miR-1 seed matches: 6mer_n2-7
“CAUUCC”, 6mer_n3-8 “ACAUUC”, 7mer-m8 “ACAUUCC”, 7mer-A1
“CAUUCCA”, 8mer “GUGCCUUA”. miR-124 seed matches: 6mer_n2-7
“UGCCUU”, 6mer_n3-8 “GUGCCU”, 7mer-m8 “GUGCCUU”, 7mer-A1
“UGCCUUA”, 8mer “GUGCCUUA”.
Conservation of Seed Match Sites
For each RefSeq, the 28-way multiple sequence alignments files for the 3‟-UTR or
coding sequences were retrieved from UCSC genome table browser. The human, dog
(canFam2), mouse (mm8), and rat (rn4) sequences were extracted and multiple
sequence alignments files corresponding to the same RefSeq were stitched together
with Galaxy. Sites with 7mer-m8 or 7mer-A1 matches present in all three species
within 20 positions of the human seed match site were considered to be conserved.
Sequence Analyses
Enrichment of hexamers in 3‟-UTRs of miR-1 and miR-124 targets relative to
nontargets was performed on the Regulatory Sequence Analysis Tools website. P-
82
values were calculated with binomial distribution function and corrected for multiple
hypothesis testing using the bonferroni method.
To identify sequence motifs associated with enrichment in immunopurifications
subsequent to miR-1 and miR-124 transfection, the MEME method was used[260].
MEME 3.0.14 was downloaded from the MEME website and run with default settings,
except searching the forward strand only with zoops model.
miRNA Target Predictions
Predictions for Targetscan 4.0 were downloaded on June 12, 2007. Context scores for
each miRNA site in each RefSeq sequence were summed to get the cumulative context
score for that miRNA. Predictions for human PITA3/15 flank were downloaded on
November 4, 2007. For both TargetScan 4.0 and PITA, miR-506/124-2 predictions
were used for miR-124, because of changes in annotated sequences in Sanger miRNA
database. These miRNAs share the same 5‟end as the miR-124 sequence used in this
study, but have different 3‟ends. Predictions for TargetScan 3.0 were retrieved on
November 2, 2006. Predictions for Pictar 5-way and Miranda were retrieved on March
2, 2007. Miranda predictions used Ensemble IDs, which were mapped to RefSeqs
using UCSC genome table browser.
Gene Ontology and Gene-set Analyses
Enrichment of GO terms in miR-1, miR-124, and Ago2 target sets was identified with
Expression Analysis Systematic Explorer[269]. Enrichment of gene sets was
performed with Gene Set Enrichment Analysis[261].
Acknowledgements
Drs. Tom Tuschl and Günther Meister provided the FLAG-Ago2 plasmid, and we
thank Drs. Tongbin Li and Jason Myers and members of the Brown, Ferrell, and
Herschlag labs for discussions and critical reading of the manuscript.
83
Supplementary Figures
Figure S1. Disassociation of Dicer from Ago2 IPs in 300 mM KCL
Disassociation of Dicer from Ago2 IPs in 300 mM KCL. Western blot with Dicer antibody on protein
associated with an Ago2 IP from cells lysed in 150 mM KCl (left), after washing once with 300 mM
KCL (middle), and after washing a second time with a 300 mM KCl concentration (right).
84
Figure S2. The Length and Number of 3′-UTR Seed Match Sites to miR-1 and
miR-124 Correlates With Enrichment in Ago2 IPs.
(A) Cumulative distributions of Ago2 IP enrichment due to the presence of miR-1 of mRNAs
containing single 6–8mer 3′-UTR seed match sites. The IP enrichment of mRNAs containing different
6–8mer sites was as follows: 8mer (144, red)>7mer-m8 (257, green, P = 0.005, one-sided Mann–
Whitney test)>7mer-A1 (375, blue, P = 0.0005)>6mer_n-7 (magenta, 567, P = 0.005)~6mer_n3–8
(orange, 654, P = 0.3)~no seed match (black, 4855, P = 0.2). (B) Same as in (A), except for miR-124.
The IP enrichment of mRNAs containing different 6–8mer sites was as follows: 8mer (78, red)>7mer-
m8 (329, green, P<10-4)>7mer-A1 (283, blue, P<10-4)>6mer_n-7 (magenta, 845, P<10-9)~6mer_n3–8
(orange, 624, P = 0.09)>no seed match (black, 3916, P<10-4). (C) CDF of Ago2 IP enrichment due the
presence of miR-1 of mRNAs containing multiple 7mer 3′-UTR seed match sites (61, red), single 7mer
3′-UTR seed match sites (632, green), and no 3′-UTR seed match sites (black). mRNAs with multiple
miR-1 7mer 3′-UTR seed match sites were significantly more enriched than mRNAs containing single
7mer seed match sites (P = 0.03). (D) Same as in (C), except for miR-124. mRNAs containing multiple
7mer 3′-UTR sites (81) were more enriched than mRNAs with single 7mer sites (612, P = 0.01).
85
Figure S3. Using Ago2 IP Enrichment and mRNA Expression Changes to Assess
Computational Target Prediction Methods.
(A) Cumulative distributions of Ago2 IP enrichment in cells transfected with miR-1 relative to cells
transfected with FLAG-Ago2 alone of several sets of mRNAs predicted to be targeted by miR-1. The
100 mRNAs containing 7mer 3′-UTR seed matches to miR-1 whose levels were most significantly
downregulated due to the presence of miR-1 were the most enriched group (red). The 100 mRNAs
whose levels were most significantly downregulated due to the presence of miR-1 irrespective of seed
match sites were the next most enriched group in Ago2 IPs (dark green). The 100 mRNAs containing
the lowest TargetScan 4.0 “cumulative context score” were the next most enriched group (blue).
TargetScan 3.0 (274, magenta) and PicTar 5way predictions (97, orange) were the next most enriched
groups. The 100 mRNAs containing the most favorable 3′-UTRs for miR-1 binding according to PITA
3/15 flank (green), miRanda predictions (113, grey) and mRNAs containing 7mer 3′-UTR seed matches
86
were the next most enriched groups (1245, cyan). mRNAs containing no 6mer 3′-UTR seed matches
were the least enriched group (4765, black). (B) Same as in (A) except for miR-124. 573 mRNAs were
TargetScan 3.0 predictions; 128 mRNAs were PicTar 5way predictions, 202 mRNAs were miRanda
predictions, 1500 mRNAs contained 7mer 3′-UTR seed matches, and 3820 mRNAs did not contain a
6mer 3′-UTR seed match. (C) Cumulative distributions of changes in mRNA levels in cells transfected
with miR-1 relative to cells transfected with FLAG-Ago2 alone of several sets of mRNAs predicted to
be targeted by miR-1. The 100 mRNAs containing 7mer 3′-UTR seed matches to miR-1 that were most
enriched in Ago2 IPs due to the presence of miR-1 was the most underenriched group (red). The 100
mRNAs that were most enriched in Ago2 IPs due to the presence of miR-1 irrespective of seed match
sites was the next group (dark green). The 100 mRNAs containing the lowest TargetScan 4.0
“cumulative context score” was the next most underenriched group (blue). TargetScan 3.0 (magenta)
and PicTar 5way predictions (orange) were the next most underenriched groups. The 100 mRNAs
containing the most favorable 3′-UTRs for miR-1 binding according to PITA 3/15 flank (green),
miRanda predictions (grey) and mRNAs containing 7mer 3′-UTR seed matches were the next most
underenriched groups (cyan). mRNAs containing no 6mer 3′-UTR seed match was the least
underenriched group (black). (D) Same as in (C) except for miR-124.
87
Concordant Regulation of Translation and mRNA
Abundance for Hundreds of Targets of a Human microRNA
David G. Hendrickson1, Daniel J. Hogan
2,3, Heather L. McCullough2,3,4, Jason W.
Myers2,3, Daniel Herschlag
2*, James E. Ferrell
1,2*, Patrick O. Brown
2,3*
1 Department of Chemical and Systems Biology, Stanford University School of
Medicine, Stanford, California, United States of America, 2 Department of
Biochemistry, Stanford University School of Medicine, Stanford, California, United
States of America, 3 Howard Hughes Medical Institute, Stanford University School of
Medicine, Stanford, California, United States of America, 4 Department of Genetics,
Stanford University School of Medicine, Stanford, California, United States of
America
These authors contributed equally to this work.
This chapter was reprinted from:
PLoS Biology 2009 Nov;7(11):e1000238
PLoS journals publish under the Creative Commons Attribution License (CCAL).
No permission is required from the authors or the publishers.
DGH, DJH, JWM and POB conceived and designed experiments. DGH, DJH, and
JWM performed the experiments, analyzed the data, and helped write the manuscript.
POB, JEF, and DH provided general direction, helped with the data analysis and
figure reparation, and helped write the manuscript.HLM provided reagents.
88
Abstract
MicroRNAs (miRNA) regulate gene expression posttranscriptionally by interfering
with a target mRNA‟s translation, stability, or both. We sought to dissect the
respective contributions of translational inhibition and mRNA decay to microRNA
regulation. We identified direct targets of a specific miRNA, miR-124, by virtue of
their association with Argonaute proteins, core components of miRNA effector
complexes, in response to miR-124 transfection in human tissue culture cells. In
parallel, we assessed mRNA levels and obtained translation profiles using a novel
global approach to analyze polysomes separated on sucrose gradients. Analysis of
translation profiles for ~8,000 genes in these proliferative human cells revealed that
basic features of translation are similar to those previously observed in rapidly
growing Saccharomyces cerevisiae. For ~600 mRNAs specifically recruited to
Argonaute proteins by miR-124, we found reductions in both the mRNA abundance
and inferred translation rate spanning a large dynamic range. The changes in mRNA
levels of these miR-124 targets were larger than the changes in translation, with
average decreases of 35% and 12%, respectively. Further, there was no identifiable
subgroup of mRNA targets for which the translational response was dominant. Both
ribosome occupancy (the fraction of a given gene‟s transcripts associated with
ribosomes) and ribosome density (the average number of ribosomes bound per unit
length of coding sequence were selectively reduced for hundreds of miR-124 targets
by the presence of miR-124. Changes in protein abundance inferred from the observed
changes in mRNA abundance and translation profiles closely matched changes
directly determined by Western analysis for 11 of 12 proteins, suggesting that our
assays captured most of miR-124–mediated regulation. These results suggest that
miRNAs inhibit translation initiation or stimulate ribosome drop-off preferentially
near the start site and are not consistent with inhibition of polypeptide elongation, or
nascent polypeptide degradation contributing significantly to miRNA-mediated
regulation in proliferating HEK293T cells. The observation of concordant changes in
mRNA abundance and translational rate for hundreds of miR-124 targets is consistent
89
with a functional link between these two regulatory outcomes of miRNA targeting,
and the well-documented interrelationship between translation and mRNA decay.
Introduction
MicroRNAs (miRNAs) are small noncoding RNAs whose complementary pairing to
target mRNAs potentially regulates expression of more than 60% of genes in many
and perhaps all metazoans [9,27,59,83,84,85]. Destabilization of mRNA and
translational repression have been suggested as the mechanisms of action for miRNAs
[9,25,26,27,28,29,30,31,33,86,106], and recent work directly measuring endogenous
protein levels in response to altered miRNA expression levels found that specific
miRNAs modestly inhibit the production of hundreds of proteins [90,91].
The importance and functional range of miRNAs are evidenced by the diverse and
often dramatic phenotypic consequences when miRNAs are mutated or misexpressed,
leading to aberrant development or disease [30,92,93,94,95,96,97,98]. Although
regulation by miRNAs is an integral component of the global gene expression
program, there is currently no consensus on either the mechanism by which they
decrease the levels of the targeted proteins or even the steps in gene expression
regulated by miRNAs [27,32,99,110,111,112].
The proposal that miRNAs decrease protein levels without affecting mRNA stability
arose from the observation that the miRNA lin-4 down-regulates lin-14 expression in
the absence of noticeable changes in lin-14 mRNA abundance in Caenorhabditis
elegans [8,12,30,270,271]. Subsequent studies in mammalian cell culture provided
further support for this model [58,60,217,218]. Several studies have found that
repressed mRNAs as well as protein components of the miRNA regulatory system
accumulate in P-bodies, suggesting that repressed mRNAs may be sequestered away
from the translation pool [56,108,194,195,214,215,216]. Other evidence points to
deadenylation of miRNA-targeted mRNAs, an effect that can inhibit translation
[33,57,61,102,237,272,273,274,275,276]. Some studies have argued that initiation of
90
translation is blocked at either an early, cap-dependent stage or later during AUG
recognition or 60S joining [28,61,108,221,222,223,224,225,277]. Others have argued
that a postinitiation step is targeted, resulting in either slowed elongation, ribosome
drop-off, or nascent polypeptide degradation [30,201,228,229,230].
One factor contributing to the lack of a consensus model for miRNA function is the
evidence that miRNA targeting of an mRNA significantly reduces message levels
(despite previous reports to the contrary) [26,29,33,61,105,106,188]. Indeed, very
recent studies from Baek et al. and Selbach et al. found that the changes in mRNA
abundance are not only correlated with the repression of many targets, but also can
account for most of the observed reduction in protein expression [90,91]. mRNA
targets of the same miRNA can either be translationally repressed with little change in
mRNA abundance, translationally repressed and have concordant changes in mRNA
abundance, or have little translation repression with large changes in mRNA
abundance [61,101,235]. That miRNAs can affect both protein production and
abundance of their mRNA targets raises the question of to what extent these outcomes
of miRNA regulation are mediated by a common mechanism or by competing or
complementary processes. The regulatory consequence of a particular miRNA–mRNA
interaction might be influenced by miRNA-independent factors such as cellular
context or by additional information encoded by the target mRNA, e.g., presence of
binding sites for other RNA-binding proteins and miRNAs, secondary structure
around miRNA binding sites, or the intrinsic decay rate of the mRNA
[99,107,236,237].
Experiment-specific effects of in vitro translation assays, reporter constructs, or
procedural differences that alter properties of gene expression could account for some
of the wide variation in the apparent mechanisms by which miRNAs alter expression
[99,111]. To date, most studies on translational regulation by miRNAs have used
reporter assays. Although assays that rely on engineered reporter transcripts are
powerful, assay-specific anomalies are a concern; artificial mRNAs may lack key
pieces of regulatory information, overexpression of reporter mRNAs could mask
91
subtle regulatory functions, and DNA transfection can lead to indirect effects on cell
physiology [110]. Indeed, recent reports have found that differences in experimental
setup, such as the method of transfection, type of 5′-cap, or the promoter sequence of
the DNA reporter construct can drastically alter the degree or even the apparent mode
of regulation by miRNAs [201,238]. In addition, some models have been based on
studies in which only one or a few targets were studied, which introduces the
possibility of generalizing the behavior of a single miRNA–mRNA interaction that
may not represent the dominant biological mechanism.
Two recent studies avoided many of these caveats by overexpressing, inhibiting or
deleting specific miRNAs and systematically measuring changes in endogenous
mRNA and protein levels using DNA microarrays and stable isotope labeling with
amino acids in cell culture (SILAC), respectively [90,91]. Both studies found mostly
concordant changes in mRNA levels and protein levels, with changes in mRNA levels
accounting for much, but not all, of the changes in protein abundance. With data for
hundreds of endogenous targets, these studies were the first to provide genome-wide
evidence that mRNA degradation accounts for much of the reduction in protein levels.
And whereas these results suggest that translation inhibition accounts for some of the
observed changes in protein abundance of miRNA targets, they do not provide direct
evidence of this, nor do they provide insight into which steps in translation are
regulated, the extent this regulation contributes to reduced gene expression of specific
mRNAs, or its possible links to mRNA decay.
To investigate how miRNAs regulate gene expression, we systematically identified
direct targets of the miRNA miR-124 by measuring the recruitment of target mRNAs
to Argonaute (Ago) proteins, the core components of the miRNA effector complex, as
previously described [200,239,263]. We then measured, in parallel, mRNA abundance
and two indicators of translation rate, ribosome occupancy and ribosome density, for
more than 8,000 genes, using DNA microarrays and a novel polysome encoding
scheme. This strategy allowed us to directly investigate the behavior of miRNA–
mRNA pairs with respect to both mRNA fate and translation, on a genomic scale.
92
Results
Systematic Identification of mRNAs Recruited to Argonautes by miR-124
To study the effects of miR-124 on expression of mRNA targets, we first had to
identify those targets. Recruitment to Ago complexes in response to the expression of
a particular miRNA appears to be the most reliable criterion for target identification
[239]. To this end, we lysed human embryonic kidney (HEK) 293T cells transfected
with miR-124 and isolated Ago-associated RNA by immunopurification (IP) using a
monoclonal antibody that recognizes all four human Ago paralogs [278]. We
measured mRNA enrichment in Ago IPs by comparative DNA microarray
hybridization of samples prepared from immunupurified RNA and total RNA from
cell extracts. Three replicates of Ago and control IPs were performed from both miR-
124 and mock-transfected cells.
To examine the enrichment profiles of the IPs, we first clustered the microarray results
by their similarity and visualized the results as a heatmap, with the degree of
enrichment of each RNA shown on a green (least enriched) to red (most enriched)
scale (Figure S1). The Ago IP enrichment profiles were reproducible as evidenced by
an average Pearson correlation coefficient between mRNA enrichment profiles of Ago
IPs in mock-transfected cells and miR-124–transfected cells of 0.90 and 0.94,
respectively.
Thousands of mRNAs were reproducibly enriched in the Ago IPs from mock-
transfected cells (Figures S1 and S2, and Text S1). We found that the presence of
sequence matches to two highly expressed microRNA families, miR-17-
5p/20/92/106/591.d and miR-19a/b, in the 3′-untranslated regions (UTRs) of mRNAs
significantly correlated with Ago IP enrichment (Text S2), suggesting that association
with Ago is in large part a reflection of the relative occupancy of each mRNA with the
suite of miRNAs endogenously expressed in HEK293T cells. High-confidence Ago-
associated mRNAs (at least 4-fold enriched over the mean, 1,363 mRNAs)
disproportionately encode regulatory proteins (409, p = 0.001), with roles including
93
“transcription factor activity” (95, p = 0.01), “signal transduction” (230, p = 0.02) and
“gene silencing by RNA” (7, p = 0.02).
To identify RNAs specifically recruited to Agos by miR-124, we compared the mRNA
enrichment profiles of Ago IPs from miR-124–transfected cells to Ago IPs from
mock-transfected cells using the significance analysis of microarrays (SAM) modified
two-sample unpaired t-test. At a stringent 1% local false-discovery rate (FDR)
threshold, we identified 623 distinct mRNAs significantly enriched in Ago IPs from
lysates of miR-124–transfected cells compared to Ago IPs from mock-transfected cells
(Figure 1A).
Previous work established that the 5′-end of the miRNA, the “seed region,” is
particularly important for interactions with mRNA targets [29,60,83,89,196,199,204].
In most cases, there is a 6–8 bp stretch of perfect complementarity between the seed
region of the miRNA and a “seed match” sequence in the 3′-UTR of the mRNA
[29,60,83,89,196,199,204]. We reasoned that if the mRNAs specifically recruited to
Agos by miR-124 transfection were physically associated with miR-124, seed match
sequences would be significantly enriched in miR-124–specific IP targets compared to
nontargets. Indeed, we found strong enrichment of 6–8 base seed matches to miR-124
in the 3′-UTRs of miR-124 Ago IP targets (Figure 1B). We also found enrichment
within the coding sequences of miR-124 Ago IP targets, as previously reported (Figure
1B) [29,90,91,200,239,279,280]. For instance, 60% of miR-124 Ago IP targets contain
a perfect match to positions 2–8 of miR-124 (called 7mer-m8) in their 3′-UTRs,
compared to 10% of nontargets (p < 10−185
, hypergeometric distribution), and 23% of
miR-124 Ago IP targets contain a perfect match to positions 2–8 of miR-124 in their
coding sequence, compared to 10% of nontargets (p < 10−23
). After removing mRNAs
with 7mer seed matches in their 3′-UTRs, the remaining miR-124 IP targets were still
significantly, albeit weakly, enriched for 3′-UTR 6mer matches to miR-124 (6mer 2–
7, p = 0.008, 6mer 3–8, p < 10−5
). These data argue that most miR-124 Ago IP targets
were recruited to Agos by direct association with miR-124, via seed matches in their
3′-UTRs or coding sequences.
94
Figure 1. miR-124 Recruits Hundreds of Specific mRNAs to Argonautes.
(A) Supervised hierarchical clustering of the enrichment profiles of putative miR-124 Ago IP targets
(1% local FDR) in Ago IPs from miR-124–transfected cells (blue) and mock-transfected cells (black).
Rows correspond to 789 sequences (representing 623 genomic loci with a Refseq sequence), and
columns represent individual experiments.
(B) Enrichment of seed matches to miR-124 in the 3′-UTRs and coding sequences of miR-124 Ago IP
targets (1% local FDR). The significance of enrichment of seed matches in Ago IP targets was
measured using the hypergeometric distribution function.
95
Systematic Measurement of mRNA Translation Profiles
The standard approach to assess translation in vivo has been the analysis of “polysome
profiles.” After treatment with cycloheximide to trap elongating ribosomes, mRNAs
with no associated ribosomes and those with varying numbers of ribosomes bound can
be separated by velocity sedimentation through a sucrose gradient. The polysome
profile of a gene‟s mRNA provides information on two key parameters in translation:
(1) the fraction of the mRNA species bound by at least one ribosome, and presumably
undergoing translation, referred to as “ribosome occupancy,” and (2) the average
number of ribosomes bound per 100 bases of coding sequence to mRNAs that have at
least one bound ribosome, referred to as the “ribosome density.”
We previously developed a method to systematically measure ribosome occupancy
and ribosome density by measuring the relative amount of each gene‟s mRNA in each
fraction of a polysome profile using DNA microarray hybridization [281]. We have
since developed and implemented a more streamlined approach that uses one DNA
microarray hybridization to measure ribosome occupancy and only a single additional
microarray hybridization to measure ribosome density (Figure 2 and Figure S3). We
measured ribosome occupancy by first pooling ribosome bound fractions and unbound
fractions and adding exogenous doping control RNAs to each (Figure 2A). Poly(A)
RNA from bound and unbound pools was isolated, amplified, coupled to Cy5 and Cy3
dyes, respectively, and comparatively hybridized to DNA microarrays. The ribosome
occupancy for each gene‟s mRNA was obtained after scaling the microarray data
using the doping controls (see Materials and Methods for details).
We determined the ribosome density for each gene‟s mRNA by a “gradient encoding”
strategy in which a graded ratio of each fraction from the ribosome bound fractions
was split into a “heavy” and a “light” pool, respectively. For instance, 99% of the first
fraction (~one ribosome bound) was added to the light pool and 1% was added to the
heavy pool. Then, 98% of the
96
Figure 2. Systematic Translation Profiling by Microarray Analysis.
(A) Schematic of the procedure used to systematically measure each gene‟s mRNA ribosome
occupancy (see Results and Materials and Methods for details). (B) Schematic of the „„gradient
encoding‟‟ method to measure the average number of ribosomes bound to each gene‟s mRNAs (see
Results and Materials and Methods for details).
97
second fraction (1.5–2 ribosomes bound) was added to the light pool and 2% was
added to the heavy pool, and so on, such that the light pool was enriched for mRNAs
associated with fewer ribosomes, and the heavy pool was enriched for mRNAs
associated with a greater number of ribosomes (Figure 2B). The RNA in each pool
was amplified, labeled with Cy5 or Cy3, mixed, and comparatively hybridized to
DNA microarrays. Thus, the Cy5/Cy3 ratio measured at each element on the array is a
monotonic function of the mass-weighted average sedimentation coefficient of the
corresponding mRNA, which is primarily determined by the number of ribosomes
bound to it. The validity of this approach is supported by the very strong concordance
between ribosome density measurements in yeast obtained with the gradient-encoding
method and our previously published ribosome density measurements obtained using
the traditional approach of analyzing each fraction on separate DNA microarrays
(Pearson r = 0.95) (unpublished data) [281]. Further details of the methodology, as
well as control experiments and additional analyses, will be described elsewhere.
To measure the effects of miR-124 on translation, we performed translation profiling
on cell extracts generated from the same miR-124–transfected, or mock-transfected
cell cultures that were used for Ago IPs and mRNA expression profiling (see below).
We obtained high-quality ribosome occupancy and ribosome density measurements on
16,140 sequences (representing 10,455 genes) from three independent mock-
transfected cultures and two miR-124–transfected cultures. There was a strong
concordance between replicate experiments for both the ribosome occupancy and
ribosome number/density measurements, both in terms of the correlation of the gene-
specific measurements (Pearson correlation for ribosome occupancy = 0.85–0.89,
ribosome number = 0.91–0.97) and the means (mean ribosome occupancy = 0.83–
0.87, mean ribosome number = 5.6–6.1 per mRNA), which were derived
independently for each experiment based on the exogenous doping controls.
The measurements from mock-transfected cells provide some general insights into the
translation regulatory program in proliferating human cells. Here, we focus on 8,385
genes that correspond to a Refseq mRNA for which we obtained high-quality
98
measurements in both Ago IP and mRNA expression DNA microarray experiments.
The average ribosome occupancy for the mRNAs from these 8,385 genes was 85%
(25th and 75th quartiles = 0.81 and 0.94, respectively) (Figure 3A) suggesting, that for
most genes, most polyadenylated mRNAs are associated with ribosomes under these
growth conditions and that there are not abundant pools of polyadenylated mRNAs in
an untranslated “compartment.” For more than 97% of the genes analyzed, a majority
of the transcripts were associated with ribosomes; mRNA transcripts of 3% of these
genes (224) were predominantly unassociated with ribosomes (ribosome occupancy
<50%). The reason for the relative exclusion of this small set of mRNAs from the
highly translated pool remains to be determined: possibilities include sequestration
from the translation machinery or a relatively short half-life that results in these
mRNAs spending a correspondingly small fraction of their lives in the translated pool.
We searched for common biological themes among these non–ribosome-associated
mRNAs using gene ontology (GO) term analysis, and found that an unexpectedly
large fraction of these mRNAs encode proteins involved in “regulation of
transcription” (64, p < 10−7
). On the flip side, there were 342 genes whose mRNAs
were almost completely (98% or greater) associated with ribosomes. Many of these
mRNAs encoded proteins involved in metabolism and gene expression, including
“oxidative phosphorylation” (21, p < 10−10
), “nuclear mRNA splicing” (23, p < 10−5
),
“proteasome complex” (11, p = 0.0003) and “glycolysis” (10, p = 0.0002). mRNAs
with low ribosome occupancy (less than 50%) were significantly less abundant than
mRNAs with high ribosome occupancy (greater than 98%) (Kolmogorov-Smirnov
test, p < 10−15
), consistent with the hypothesis that a lower rate of decay, and hence a
greater fraction of the lifespan spent in the translated pool, contributes to ribosome
occupancy.
The average ribosome density for the 8,385 genes with technically high-quality data
across this set of experiments was 0.53 ribosomes per 100 nucleotides (nts) (25th and
75th quartiles = 0.27 and 0.67, respectively), which corresponds to one ribosome per
189 nts (Figure 3B). Given that ribosomes are believed to span ~30 nts of the mRNA,
99
Figure 3. Analysis of Ribosome Occupancy and Ribosome Density in HEK293T
Cells.
(A) The number of genes as a function of ribosome occupancy. The average ribosome occupancy is
85%.
(B) The number of genes as a function of ribosome density. On average, there is one ribosome per 189
nucleotides.
(C) Ribosome density as a function of a gene‟s coding sequence length. Each gene is indicated by a
blue circle. The red line indicates the moving average density value (window of 50). The inset shows
only genes with coding sequences that are shorter than 1,000 nucleotides.
100
the average ribosome density would be approximately one sixth of the maximal
packing density [282]. This spacing suggests that translation initiation is rate limiting
for most mRNAs.
We previously observed a strong negative correlation between an mRNA‟s ribosome
density and its coding sequence length in yeast cells rapidly growing in rich medium
[281]. Subsequent experiments suggested that this relationship is due to either a strong
inverse correlation between initiation rate and coding sequence length [283], or a
decrease in ribosome density as a function of position along the mRNA [284]. We
found the same inverse relationship between the size of a coding sequence and
ribosome density in proliferating mammalian cells (Spearman r = −0.90) (Figure 3C).
Sucrose gradient sedimentation did not clearly resolve polysomes containing more
than seven ribosomes, so it is possible that our method underestimates the number of
ribosome bound to mRNAs with long coding sequences, which could, in principle,
lead to a spurious negative correlation between coding sequence length and ribosome
density. However, the inverse relationship between coding sequence length and
ribosome density is still readily evident when only mRNAs with coding sequences less
than 1,000 nts are considered (r = −0.73), strongly supporting the validity of this
relationship.
These broad similarities between translational programs in proliferating HEK293 cells
and proliferating S. cerevisiae grown in rich medium, suggest that the overall
organization of the program, and perhaps some of the fundamental mechanisms
underlying the regulation of translation, may be similar in rapidly growing yeast and
human cells [281].
mRNA Recruitment to Argonautes by miR-124 Leads to Modest Decreases in
Abundance and Translation Rate
To measure the effects of miR-124 on mRNA expression levels, we profiled mRNA
expression in the same cell cultures that we used for the Ago IPs and translation
profiling. We obtained high-quality measurements for 15,301 genes from three
101
independent mock-transfected cultures and three independent miR-124–transfected
cultures. There was strong concordance between replicate experiments (Pearson r =
0.95–0.97).
To study the effects of miR-124 on the expression of its mRNA targets, we first
compared the changes in mRNA abundance of Ago IP targets of miR-124 (560
mRNAs; 1% local FDR) and nontargets (7,825 mRNAs) between cells transfected
with miR-124 and cells that were mock-transfected. Samples were taken 12 h after the
respective treatments. We plotted the cumulative distributions of miR-124–dependent
Ago IP targets (Figure 4A, green curve) and nontarget mRNAs (Figure 4A, black
curve) as a function of the differences in their mRNA abundance between miR-124
and mock-transfected cells. miR-124 target mRNAs were much more likely to
decrease in abundance after miR-124 transfection than nontargets (p < 10−173
, one-
sided Kolmogorov-Smirnov test). For example, 74% of miR-124 IP targets decreased
at least 15% at the mRNA level, compared to 13% of nontargets. The average
abundance of miR-124 Ago IP targets decreased by 35% compared to nontargets
(Figure 4C, green bar in left panel). The results are consistent with miRNAs having
significant, but modest effects on the mRNA levels of most of their endogenous
mRNA targets.
Previous work has established that perfect seed matches to the miRNA in 3′-UTRs are
important to elicit effects on mRNA abundance [29,60,83,89,196,199,204]. To test the
importance of 3′-UTR seed matches on the expression of miR-124 targets, we plotted
the cumulative distributions of miR-124 IP targets with at least one 7mer 3′-UTR seed
match (379, Figure 4A, red curve) and miR-124 IP targets that lacked a 7mer 3′-UTR
seed match (181, Figure 4A, blue curve). We found that mRNA targets with 7mer 3′-
UTR seed matches were more likely than targets that lacked a 7mer 3′-UTR seed
match to decrease in abundance in the presence of miR-124 (90% of miR-124 IP
targets with a 3′-UTR seed match decreased at least 15%, compared to 49% of targets
that lacked a 7mer 3′-UTR seed match). On average, IP target mRNAs with 7mer 3′-
UTR seed matches decreased 40%, whereas IP targets that did not have a 7mer seed
102
Figure 4. miR-124 Negatively Regulates the Abundance and Translation of
mRNA Targets.
(A) Cumulative distribution of the change in mRNA levels following transfection with miR-124
compared to mock. This analysis compares miR-124 Ago IP targets (1% local FDR) (560, green), IP
targets with at least one 3′-UTR7mer seed match (379, red), IP targets that lacked a 3′-UTR 7mer seed
match (181, blue), and nontargets (7,825, black). mRNA levels of miR-124 Ago IP targets were more
likely than nontargets to decrease following transfection with miR-124 (p < 10−173
).
(B) Cumulative distribution of the change in the estimated translation rate following transfection with
miR-124 compared to mock. This analysis compares miR-124 Ago IP targets (1% local FDR) (green),
IP targets with at least one 3′-UTR7mer seed match (red), IP targets that lacked a 3′-UTR 7mer seed
match (blue), and nontargets (black). Translation rates of miR-124 Ago2 IP targets were more likely
than nontargets to decrease following transfection with miR-124 (p < 10−61
).
(C) Barplot showing the average change in mRNA abundance (left) and translation rate (right)
following transfection with miR-124 of all miR-124 Ago IP targets (green), IP targets with at least one
3′-UTR 7mer seed match (red), IP targets that lacked a 3′-UTR 7mer seed match (blue). The average
change in mRNA abundance and translation of targets was calculated by subtracting the average change
of nontargets for the mRNA abundance and translation rates after transfection with miR-124.
103
match in their 3′-UTR decreased 17%, compared to nontargets (Figure 4C, left
panel).These results underscore the importance of 3′-UTR seed matches for regulation
at the mRNA level, but also demonstrate that a large fraction of miR-124 IP targets
that lack 7mer seed matches to miR-124 in their 3′-UTR are nevertheless regulated at
the mRNA level by miR-124.
To study the effects of miR-124 on translation of targeted mRNAs, we estimated the
change in the translation rates between miR-124-transfected and mock-transfected
cells (ΔTr) for each mRNA as:
124 124 rr
mock mock r
O D ET
O D E
, (1)
where multiplying O, the fraction of the mRNA that is ribosome-bound (ribosome
occupancy), by D, the average number of ribosomes per 100 nts for bound mRNAs
(ribosome density) provides the weighted ribosome density for each mRNA; Er is an
unmeasured value for the elongation rate of any given mRNA and was assumed not to
change (discussed further below). Values Tr obtained from miR-124 transfected cells
were divided by those from mock-transfected cells to estimate the change. We plotted
the cumulative distribution of Tr for miR-124 Ago IP targets and nontargets (Figure
4B). miR-124 targets (Figure 4B, green curve) were much more likely to decrease in
translation rate than nontarget mRNAs (Figure 4B, black curve) (p < 10−62
, one-sided
Kolmogorov-Smirnov test). The apparent translation rate of 47% of miR-124 Ago IP
targets, but only 10% of nontargets, decreased by at least 10%. In line with what we
observed for changes in mRNA abundance, miR-124 IP targets with at least one 7mer
seed match in their 3′-UTR were more likely to decrease in translation rate than miR-
124 IP targets that lacked a 7mer 3′-UTR seed match (56% percent of miR-124 IP
targets with a 7mer 3′-UTR seed match decreased at least 10% in translation versus
27% of IP targets that lacked a 7mer 3′-UTR seed match). The overall effects on
translation, while highly significant, were very modest; on average, the estimated
translation rates of miR-124 Ago IP targets decreased by 12% relative to nontargets
104
(15% for miR-124 IP targets with a 7mer 3′-UTR seed match and 5% for miR-124 IP
targets without a 7mer 3′-UTR seed match) (Figure 4C, right panel). These results
show that miR-124 has modest effects on the abundance, translation rate, or both for
most its targets.
In some cases, mRNAs that are translationally-repressed are deadenylated and stored,
rather than degraded [220,285,286]. All of our measurements were of mRNAs
amplified based on their poly(A) tails. Therefore, it was possible that the effects on
translation were underestimated and the effects on abundance were overestimated
because a large percentage of targets mRNAs were translationally repressed, and
stored without a poly(A) tail. To test this possibility, we measured the differences in
total RNA levels irrespective of poly(A) tail for each gene between miR-124
transfected and mock-transfected cells. We found that the differences in RNA
abundance between miR-124 transfected and mock-transfected cells as measured with
unamplified total RNA were similar to those measured for amplified poly(A)-selected
mRNA for miR-124 targets (Pearson r = 0.82, slope of least-squares regression fit in
linear space = 0.82) (Figure S4). These data suggest that the apparent decrease in
abundance of miR-124 target mRNAs results primarily from degradation rather than
deadenylation alone.
miR-124 Affects Both the Ribosome Occupancy and Ribosome Density of
Hundreds of Targets
Many steps in protein synthesis have been proposed to be regulated by miRNAs. The
proposed mechanisms include: (i) blocking initiation, e.g., by preventing eiF4F
binding to mRNA caps or joining of the 40S and 60S ribosomal subunits; (ii)
promoting poly(A) tail deadenylation, which can slow initiation by preventing
interactions between the poly(A) tail and 5′-cap, and by increasing the rate of mRNA
decay, which reduces the fraction of the mRNA‟s lifespan spent in the translated pool;
(iii) promoting premature ribosome release during elongation; (iv) slowing translation
elongation; (v) promoting cotranslational proteolysis; and (vi) concerted slowing of
initiation and elongation
105
[28,30,58,60,61,102,201,217,218,221,222,223,225,228,229,230,237,270,277]. The
first four proposed mechanisms make specific predictions about the effects of
miRNAs on the ribosome occupancy and ribosome density of targets. Proposed
mechanisms (i), (ii), and (iii) predict that both occupancy and density will decrease;
mechanism (iv) predicts that ribosome density will increase as a function of the extent
to which elongation is slowed. In contrast, proposed mechanism (v) does not predict
that ribosome occupancy or ribosome density will change, and the effects on ribosome
occupancy and ribosome density in mechanism (vi) depend on the relative effects of
the miRNA on the two steps.
We tested these predictions by comparing ribosome occupancy and density profiles of
mRNAs from miR-124 and from mock-transfected cells. We found that miR-124 Ago
IP targets were much more likely than nontarget mRNAs to exhibit both reduced
ribosome occupancy (Figure 5A) (p < 10−31
, one-sided Kolmogorov-Smirnov test) and
reduced ribosome density (Figure 5B) (p < 10−51
, one-sided Kolmogorov-Smirnov
test) following miR-124 transfection. Thirty-nine percent of miR-124 Ago IP targets
decreased at least 5% in ribosome occupancy, compared to 13% of nontargets; 55% of
miR-124 Ago IP targets decreased at least 5% in ribosome density, compared to 18%
of nontargets. On average, the ribosome occupancy of miR-124 Ago IP targets
decreased by 4%, and their ribosome density decreased by 8% (Figure 5C, green bars).
We hypothesized that mRNAs with fewer associated ribosomes might exhibit larger
changes in ribosome occupancy as a result of the increased likelihood of losing all
ribosomes. In support of this hypothesis, on average, all ten miR-124 target mRNAs
with ribosome occupancy changes greater than 20% had significantly shorter coding
sequences and fewer bound ribosomes than mRNAs that changed less than 20% (p =
0.0003, one-sided Mann-Whitney test) (Figure S5A).
The effects on ribosome occupancy and ribosome density were significantly larger for
miR-124 Ago IP targets that contain at least one 3′-UTR 7mer seed match (45% and
65% decreased at least 5% in ribosome occupancy and ribosome density,
respectively), compared to miR-124 Ago IP targets that lack a 3′-UTR 7mer seed
106
Figure 5. miR-124 Ago IP Targets Decrease in Ribosome Occupancy and
Ribosome Density Due to the Presence of miR-124.
(A) Cumulative distribution of the change in ribosome occupancy following transfection with miR-124,
compared to mock. This analysis compares miR-124 Ago IP targets (1% local FDR) (green), IP targets
with at least one 3′-UTR7mer seed match (red), IP targets that lacked a 3′-UTR 7mer seed match (blue),
and nontargets (black). Changes in ribosome occupancy of miR-124 Ago IP targets were greater than
those for nontargets (p < 10−31
).
(B) Cumulative distribution of the change in ribosome density following transfection with miR-124
compared to mock. This analysis compares miR-124 Ago IP targets (1% local FDR) (green), IP targets
with at least one 3′-UTR7mer seed match (red), IP targets that lacked a 3′-UTR 7mer seed match (blue),
and nontargets (black). Changes in ribosome density of miR-124 Ago IP targets were greater than those
for nontargets (p < 10−51
).
(C) Bar plot of the average change in ribosome occupancy (left) and ribosome density (right) following
transfection with miR-124 of all miR-124 Ago IP targets (green), IP targets with at least one 3′-UTR
7mer seed match (red), IP targets that lacked a 3′-UTR 7mer seed match (blue). The average change in
107
ribosome occupancy and ribosome density of targets was calculated by subtracting the average change
of nontargets for the mRNA abundance and translation rate measurements following transfection with
miR-124. The error bars represent 95% confidence intervals in the mean difference estimated by
bootstrap analysis.
match (26% and 34% decreased at least 5% in ribosome occupancy and ribosome
density, respectively), providing direct evidence for the general importance of 3′-UTR
seed matches for miRNA-mediated translational repression of endogenous mRNAs
[90,91].
The observed effects on ribosome occupancy and density could, in principle, be the
result of multiple independent regulatory mechanisms. For instance, the decrease in
ribosome occupancy and density could be a result of mechanisms (i), (ii), and (iii). If
however, the effects on ribosome occupancy and ribosome density were due to the
same regulatory mechanism, we would expect a large overlap between mRNAs that
show appreciable decreases in ribosome occupancy and ribosome density in the
presence of miR-124. Indeed, 77% of miR-124 IP targets that decreased at least 5% in
ribosome occupancy also decreased at least 5% in ribosome density (30% of all miR-
124 IP targets decreased at least 5% in both ribosome occupancy and ribosome density
compared to 2% of nontargets), which is significantly more than expected by
chance (p < 10−18
, hypergeometric distribution). There was also a modest, but highly
significant, correlation between changes in ribosome occupancy and ribosome density
of miR-124 Ago IP targets (Spearman r = 0.45, p < 10−25
) (Figure S6A), although
many mRNAs appeared to differentially change in either ribosome occupancy or
ribosome density (some miR-124 mRNA targets even appeared to increase
appreciably in ribosome occupancy; Figure S6 and Text S3). These results are
consistent with the effects on ribosome occupancy and ribosome density arising from
the same regulatory mechanism.
If miR-124 induced ribosome drop-off (mechanism (iii)) stochastically along the
coding sequence, the change in ribosome density would be exponentially related to the
length of the coding sequence. To test this, we plotted the change in ribosome density
108
as a function of mRNA length for miR-124 IP targets and found that although they are
correlated (Spearman r = 0.30), it is highly unlikely there is a first-order exponential
relationship between the change in density and the length of the mRNA‟s coding
sequence (p < 10−211
, F-test with the null hypothesis that the observed change in
density fits the predicted change in density from an exponential least-squares fit)
(Figure S5B). Thus, if ribosome drop-off is the predominant mode of miR-124
regulation, it occurs preferentially near the translation start site.
The observation that many miR-124 targets decreased in both ribosome occupancy
and ribosome density after transfection with miR-124 is consistent with regulation of
translation initiation (mechanisms (i) or (ii)) or ribosome drop-off preferentially near
the translation start site (mechanism (iii)) by miR-124 and suggests that slowed
elongation (model (iv)) is not the predominant mode of regulation of translation by
miR-124 under these conditions. Without measurements of the actual effects on
protein synthesis, these results, however, do not rule out the possibility that miR-124
also induces cotranslational proteolysis (v) or coordinately represses translation
initiation and translation elongation (vi), resulting in modest decreases in ribosome
occupancy and ribosome density, but large effects on protein synthesis.
The Effects of miR-124 Transfection on Protein Products of miR-124 Targets
To analyze the overall effect of the observed decreases in mRNA abundance and
translation on protein production, we calculated the estimated change in protein
synthesis as:
124c r
mock
AP T
A
, (2)
where the estimated change in protein synthesis (Pc) can then be derived by
multiplying the change in mRNA abundance by the estimated change in translation
rate (Tr). The change in relative mRNA abundance is calculated by dividing relative
mRNA abundance values from miR-124 transfection experiments by values from the
mock-condition124
mock
A
A
. Although the overall effect on predicted protein production
109
was on average quite modest (~2-fold decrease compared to nontargets), for a small
fraction of miR-124 targets the predicted changes in protein production were fairly
large; 45 of the 560 identified miR-124 targets were predicted to have a decrease of at
least 4-fold in protein production 12 h after miR-124 transfection. A disproportionate
fraction of the most significantly affected mRNAs encoded proteins associated with
membrane compartments (28, p = 0.001), including endoplasmic reticulum (seven)
and plasma membrane (nine); these mRNAs are likely to be translated on the rough
endoplasmic reticulum. A similar observation was reported with different miRNAs in
a recent study [91]. These results suggest that mRNAs that are translated on the rough
endoplasmic reticulum might be particularly susceptible to miRNA-mediated
regulation, possibly while stalled prior to engagement with the endoplasmic reticulum
[287].
To test whether our estimated changes in protein synthesis predict actual changes in
protein abundance, we measured changes in protein abundance of a diverse set of
proteins encoded by mRNAs that are highly enriched in miR-124 Ago IPs by Western
blot analysis based on the availability of reliable antibodies. We chose 14 proteins
encoded by mRNAs that are highly enriched in miR-124 Ago IPs, with predicted
decreases in protein synthesis ranging from no change to 3-fold (Table S1). We
collected cell lysates 60 h (four to five cell divisions) after miR-124 or mock-
transfection to reduce the likelihood of underestimating the change in protein synthesis
for long-lived proteins. Twelve of the 14 antibodies detected bands at the predicted
molecular weight (Figure 6A). We observed a significant correlation between the
estimated changes in protein synthesis (Figure 6B, x-axis) and the measured changes
in protein levels (Figure 6B, y-axis) in response to miR-124 transfection (Spearman r
= 0.54, p = 0.07, slope of least-squares regression fit = 0.54, grey line in Figure 6B),
with one exception. Only RNF128, with a predicted 3.7-fold reduction in protein
synthesis, drastically disagreed with our measured decrease of 1.2-fold reduction. It is
possible that the discordance in RNF128 protein levels is due to posttranslational
autoregulation, which is common among ring finger proteins [288,289,290]. After
excluding RNF128 from analyses, there is a strong concordance between the two
110
measurements (Spearman r = 0.90, p = 0.0001, slope = 0.95; red line, Figure 6B) for
the remaining 11 proteins. The high correlation and the fact that the slope of the best-
fit line excluding RNF128 is close to one, suggests that miR-124–induced changes in
transcript abundance and translation rate can almost completely account for the
changes in abundance of the targeted proteins. Thus, cotranslation proteolysis
(proposal (v)) and coordinate repression of initiation and elongation (proposal (vi)) are
unlikely to play more than a minor role in miR-124 regulation under these conditions.
Concordant Changes in Abundance and Translation of mRNAs Targeted by
miR-124 Suggests That These Two Regulatory Outcomes Are Functionally
Linked
Multiple distinct miRNA regulatory pathways have been proposed, such that
translational repression and mRNA degradation can be regulated independently, and
these two regulatory consequences are differentially affected by specific features of
miRNA–mRNA interaction [60,62,200,217,236]. The relative magnitude of effects on
translation and decay of targeted mRNAs might be influenced by the sequence context
of the miRNA–mRNA interaction and the particular suite of RNA-binding proteins
associated with the mRNA [55,56,101,214]. If the balance between effects on
translation and effects on decay were influenced in a gene-specific way by features of
the mRNA, we would expect that some targets of miR-124 would have relatively large
changes in translation with little change in mRNA abundance or vice versa. If,
however, miRNA–mRNA interactions act through a single dominant regulatory
pathway that affects both translation and decay, we would expect a strong correlation
between the changes in abundance and translation of mRNA targets of miR-124.
We compared the changes in mRNA abundance (Figure 7, x-axis) to apparent changes
in translation rate (Figure 7, y-axis) for miR-124 Ago IP targets following miR-124
transfection. There was strong correlation between these two regulatory effects
(Pearson r = 0.60, see Text S4 and Figure S7 for estimates of significance of the
correlation), and we found no subpopulation of mRNAs whose translation was
appreciably diminished without corresponding changes in mRNA abundance, and few
111
Figure 6. The Effect of miR-124 Transfection on Protein Production of miR-124
Targets
(A) Western blots of 12 proteins encoded by mRNAs highly enriched in miR-124 Ago IPs from mock-
transfected cells (−) and miR-124 transfected cells (+).The bottom bands are loading controls. The
proteins are arranged according to increasing estimated fold-change in protein synthesis from left to
right.
(B) Scatterplot between estimated changes in protein synthesis (x-axis) and observed changes in protein
levels (y-axis) from Western blots. The gray line is a least-squares linear regression fit of all 12
proteins, and the red line is a least-squares fit of 11 proteins, excluding RNF128 (upper left protein,
shown in blue).
112
mRNAs whose abundance changed significantly without a corresponding change in
translation. To test whether the apparent correlation might be driven solely by mRNAs
with the largest measured changes in abundance and translation, we calculated the
average changes in mRNA abundance and translation in moving windows of ten
mRNAs ranked by their change in mRNA abundance. As shown in Figure 7 (red
curve), we found a persistent, nearly monotonic, relationship between changes in
mRNA abundance and translation that closely matches the least-squares fit of all the
data (Pearson r = 0.91). We obtained similar results when we analyzed miR-124 Ago
IP targets with 7mer 3′-UTR seed matches and those that lacked a 7mer 3′-UTR seed
match (Figure S8), although the correlation was stronger for targets with 7mer 3′-UTR
seed matches (r = 0.60 versus 0.42).
The correlation between changes in mRNA abundance and estimated translation rate,
and the absence of a subgroup of mRNAs regulated at the translational level without
corresponding effects on abundance, is consistent with a model in which these two
regulatory programs are functionally linked. Although there was a measurable
decrease in mRNA abundance for almost all miR-124 targets that significantly
decreased in translation, only about half of the targets that decreased in mRNA
abundance registered a measurable reduction in translation. It is possible that some
mRNA targets are degraded without any appreciable effect on translation (e.g., the
mRNAs are degraded while still associated with ribosomes) or that translation of these
mRNAs is indirectly stimulated in response to miR-124, resulting in no apparent effect
on translation at the time we performed translation assays. Alternatively, as the
changes in translation tended to be smaller than the changes in mRNA abundance, we
may have been unable to accurately measure the small effects on translation of many
targets.
113
Figure 7. Concordant Changes in mRNA Abundance and Translation of miR-124
Ago IP Targets.
Scatterplot between changes in mRNA abundance (x-axis) and the estimated translation rate (y-axis) for
miR-124 Ago IP targets following transfection with miR-124 compared to mock. The gray line is a
least-squares linear regression fit of the data, and the red line is a moving average plot (window of 10).
The slope of the least-squares fit of the data is 0.24 (in linear space, 0.36), and the Pearson correlation is
0.60.
114
Changes in Abundance and Translation of miR-124 Ago IP Targets with Seed
Matches in 3′-UTRs, Coding Sequences, and 5′-UTRs
Although most functional microRNA seed matches are located in 3′-UTRs as judged
by mRNA expression data, phylogenetic conservation analysis, Ago IPs, and reporter
studies, some sites in coding sequences and 5′-UTRs can also confer regulation by
miRNAs [83,88,90,91,200,201,202,239,279,280,291]. The 560 high-confidence miR-
124 Ago IP targets for which we obtained high-quality measurements in expression
and translation analyses were strongly enriched for mRNAs that contained miR-124
seed matches in 3′-UTRs and coding sequences (Figure 1B), but they were also
significantly, albeit weakly, enriched, for seed matches in 5′-UTRs (16, p = 0.009).
We compared the effectiveness of 7mer seed matches in the 3′-UTR, coding sequence,
and 5′-UTR, and 6mer seed matches in the 3′-UTR in effecting changes in mRNA
abundance and estimated translation rate. We found that both the abundance and
translation rate of IP targets, regardless of the location of seed matches, decreased
relative to nontarget mRNAs in miR-124 transfected cells compared to mock-
transfected cells (Figure S9). The estimated effects on protein production were
greatest for mRNAs with 7mer seed matches in the 3′-UTR, consistent with previous
studies reporting that 3′-UTR seed matches confer the highest degree of regulation
[29,88,200,239]. Changes in mRNA abundance were significantly greater than
changes in translation for miR-124 Ago IP targets with 3′-UTR and coding sequence
seed matches (Figure S9). IP targets that did not contain any 6mer seed matches were
also significantly more likely to decrease in mRNA abundance than nontargets (Figure
S9), which suggests that many of these mRNAs are specifically recruited to Agos by
miR-124 and regulated by miR-124, even though they do not appear to have canonical
recognition elements.
115
Efficiency of Recruitment to Argonautes by miR-124 Seed Matches Correlates
with Effects on Both mRNA Abundance and Translation
The extent to which each of the thousands of genes expressed in a given mammalian
cell is regulated by the suite of (often hundreds of) miRNAs expressed in that cell is
not known. We reasoned that our Ago immunopurification strategy, by quantitatively
measuring association of mRNAs with microRNA effector complexes, could serve as
a direct readout of the potency of the regulatory effects of miRNAs on each mRNA.
We compared the change in Ago IP enrichment following transfection with miR-124
to the estimated changes in protein production (equation 2) for mRNAs with seed
matches to miR-124 in their 3′-UTR or coding sequence (Figure S10). For mRNAs
with 7mer or 8mer seed matches to miR-124 in their 3′-UTR, there was a strong
negative correlation between the magnitude of their enrichment by the Ago IP and the
estimated changes in production of the protein they encode (3′-UTR 7mer: Pearson r =
−0.72, p < 10−192
; 3′-UTR 8mer: r = −0.72, p < 10−26
) (Figure S10A). For mRNAs
with 7mer or 8mer seed matches to miR-124 in their coding sequences, but no 7mer
seed matches in their 3′-UTRs, there was also a significant, albeit weaker, correlation
(CODING SEQUENCE 7mer: r = -0.39, p < 10−33
; CODING SEQUENCE 8mer: r =
−0.38, p < 10−4
) (Figure S10B). There was also a weak, but still significant,
correlation between IP enrichment and the estimated change in protein production for
mRNAs that lacked 7mer seed matches in their 3′-UTR or coding sequence or that
lacked even 6mer seed matches in their 3′-UTR or coding sequence, respectively (3′-
UTR 6mer: r= −0.40, p < 10−75
; no 3′-UTR or CODING SEQUENCE 6mer: r =
−0.23, p < 10−24
) (Figure S10C). Most of the mRNAs with 7mer or 8mer seed matches
in their 3′-UTR or coding sequence that decreased significantly in protein production
were enriched in the Ago IPs. Thus, Ago IP enrichment following transfection with a
specific miRNA appears to be a good predictor of the corresponding effects on protein
production. Because changes in mRNA abundance and translation following
transfection of a specific miRNA are quantitatively smaller and less specific than their
change in association with Agos, the IP method appears to be a more sensitive assay to
identify the direct regulatory targets of specific miRNAs.
116
Discussion
miRNAs regulate the posttranscriptional fates of most mammalian mRNAs, yet for
endogenous mRNAs, the effects of miRNAs on translation, the steps in translation that
are regulated by miRNAs, and the relationship between regulation of translation and
mRNA decay by miRNAs have not been systematically explored. To address these
effects and relationships, we determined the effect of a human miRNA, miR-124, on
translation and abundance of hundreds of endogenous mRNAs that were recruited to
Argonaute proteins in response to ectopic expression of miR-124 in HEK293T cells.
We developed a simple and economical method to quantitatively measure two key
parameters of translation, ribosome occupancy and average ribosome density, on a
genome-wide scale with single DNA microarray hybridizations for each (Figure 2).
This method allowed us to address the effects of miR-124 on translation of
endogenous mRNAs; it is also more broadly applicable to the study of translational
regulation. In this initial application, we found many parallels between the translation
programs in proliferating human embryonic kidney cells and S. cerevisiae (Figure 3),
suggesting common features of translational programs in eukaryotes [281]. Direct
identification of the mRNAs specifically recruited by miR-124 to Ago proteins, core
components of miRNA-effector complexes, defined functional targets of this miRNA
in this model system, providing a starting point for dissecting miRNA regulation
[200,239,262,263,292]. mRNA expression profiling then allowed us to recognize the
specific effects of miR-124 on the abundance of these targets.
Three major conclusions emerged from our studies: (i) miR-124 reduces translation
and abundance of its mRNA targets over a broad range; changes in mRNA abundance
accounted for ~75% of the estimated effect on protein production; (ii) miR-124
predominantly targets translation at the initiation stage or stimulates ribosome drop-off
preferentially near the translation start site; and (iii) miR-124–mediated regulation of
translation and mRNA decay are correlated, indicating that most mRNAs are not
differentially targeted for translational repression versus mRNA decay.
117
Transfection of miR-124 consistently reduced the translation and abundance of most
of its several hundred high-confidence targets; the resulting decrease in translation
averaged 12% and the decrease in target mRNA abundance averaged 35% (Figure 4).
The observation that there were several mRNAs (CD164, VAMP3, and DNAJC1) that
had about 10-fold reductions in mRNA levels (Figure S7), and the fact that 90% of
control-transfected cells expressed the transfected GFP marker, suggests that more
than 90% cells were transfected with functionally significant quantities of miR-124;
thus the small magnitude of the effects on translation and abundance of most of the
mRNA targets of miR-124 identified by Ago IP was not likely a result of poor
transfection efficiency. The correlation between predicted changes in protein synthesis
and observed changes in protein levels for 11 of 12 proteins following miR-124
transfection (Figure 6), suggests that our assays capture most (or all) of the effects of
miR-124 on protein synthesis.
Although we need to be cautious in generalizing from these model systems, in these
cells under the condition examined, miRNAs appears to modulate production for
hundreds of proteins through joint regulation of target mRNA translation and stability
over a strikingly large dynamic range. While the repressive effects on most targets
were modest (1–3-fold), there were eight targets (DNAJC1, VAMP3, CD164, SYPL1,
MAGT1, HADHB, ATP6V0E1, and SGMS2) that were substantially down-regulated
with decreases in protein synthesis of 10-fold or greater. In addition, 47 targets were
estimated to have greater than 4-fold changes in protein synthesis. Regardless of the
magnitude of regulation, mRNA destabilization accounted for ~75% of the change in
estimated protein synthesis. This range of regulation is in good accord with previous
studies with genetically characterized endogenous miRNAs as well as with studies
introducing exogenous miRNAs introduced into human tissue culture [8,26,30,90,91].
However, our observation that miR-124 had only modest effects on the translation of
hundreds of targets contrasts dramatically with several previous studies in which
miRNAs reduced protein expression by 5–25-fold while only modestly decreasing
mRNA levels (1.1–2-fold), suggesting substantial inhibitory effects on translation
118
[60,62,108,229,238]. The previous studies, however, measured the effect of a specific
miRNA on reporter constructs in which the 3′-UTRs of the encoded mRNAs were not
derived from mammalian mRNAs, but were either short (~250 nts) modified viral
sequences or artificial. In contrast, mammalian mRNA 3′-UTRs tend to be much
longer (on average ~1,000 nts) and include regulatory sites for RNA-binding proteins
and regulatory RNAs that influence mRNA localization, translation, and decay. The
basis for the discrepancy in the results from these two experimental designs remains to
be determined, and the answer is likely to provide useful mechanistic insights. One
possibility is that mRNAs containing exogenous 3′-UTRs might have anomalously
long mRNA half-lives that obscure the normal contribution of mRNA degradation to
the miRNA-directed inhibition of protein expression. The large magnitude of effects
observed in reporter-based assays, compared to what we and others have observed
with endogenous mRNAs, is likely to be partially due to the multiple (four to eight)
engineered miRNA binding sites in the reporter constructs used in those studies
[60,62,108,229,238]. Further, these sites were in close proximity, and adjacent
miRNA binding sites have been reported to act cooperatively [58,88,197]. Indeed, two
studies that measured the effects of specific miRNAs on protein and mRNA levels of
reporters with endogenous mammalian 3′-UTRs found more modest effects on
translation, less than 2-fold on average [29,263]. Moreover, the magnitude of the
effects we observed on translation of the mRNAs targeted by miR-124 were in
agreement with two recent studies that inferred the repressive effect of miRNAs on
translation by measuring miRNA-mediated effects on mRNA and protein abundance
[90,91]. Those reports, based on directly measured changes in protein levels by
quantitative mass spectrometry, concluded that the effects of miRNAs on translation
were small (less than 2-fold for hundreds of target mRNAs).
Although we believe that our experimental design provided a good model of miRNA
regulation as it normally operates in vivo, our results do represent the full range of
possible regulatory consequences of miRNA–mRNA interactions. Our results suggest
that miRNAs have a large dynamic range of effects on endogenous protein expression,
achieved via regulation of both translation and mRNA abundance; this pattern is
119
generally quite consistent with previous results from cells grown in culture and limited
in vivo observations. However, in specific developmental or physiological programs,
or for specific mRNAs, the effects on abundance and translation, as well as the
apparent mode of translation regulation may differ from what we observed in this
study [8,30,228,230,293]. Thus, the effects we observed for miR-124 targets after
ectopically expressing the microRNA in Hek293T cells may not capture the full scope
of regulation by miRNAs in their endogenous context; miR-124 is endogenously
expressed in neuronal cells, and the regulatory effects of miR-124 interactions may be
modulated by the physiological demands of the cell and the specific suite of specific
RNA-binding proteins and regulatory RNAs that also associate with miR-124 target
mRNAs.
miR-124 negatively affected both the ribosome occupancy and ribosome density of
hundreds of its targets (Figure 6). These parallel effects, combined with the close
match between changes in protein synthesis predicted from miRNA-induced effects on
mRNA abundance and translation and changes in protein levels for 11 of 12 proteins,
suggest that the step in translation principally targeted by miR-124 and presumably
other miRNAs is initiation or elongation processivity near the translation start site. We
favor the initiation model because it is in accord with several previous studies that
focused on one or a few mRNAs [28,61,108,221,222,223,225,277], and there is a
paucity of empirical evidence supporting ribosome drop-off, which predicts that
ribosome density of miRNA-regulated mRNAs declines between the 5'- and 3'-ends of
the coding sequence and that there should be an overrepresentation of incompletely
synthesized N-terminal nascent polypeptides [229].
The small apparent magnitude of the effects on translation initiation, combined with
the strong correlation between changes in translation and mRNA abundance, can be
explained by a model in which repression of translational by miR-124 rapidly leads to
mRNA decay. Such a model would explain why observable effects on translation
appear to be smaller than the changes in mRNA abundance: if mRNAs whose
translation is inhibited are quickly destroyed, their diminished translation would not be
120
detected in our translation assay. There is already compelling evidence that
translational repression and mRNA decay are linked
[215,231,232,233,234,294,295,296,297,298,299,300,301,302]. Our observation that
an overwhelming majority of polyadenylated mRNAs are associated with ribosomes
in HEK293T cells may be a manifestation of this relationship (Figure 3A). Thus,
miRNA-mediated inhibition of translation may be linked to a general system for
removal of the mRNA from the translational pool, involving recruitment to P-bodies
and subsequent destruction [56,108,194,195,215,216]. Regulated decoupling of
miRNA-mediated translation repression and mRNA decay would then allow
organisms to tilt the balance of effects in favor of translational repression during
physiological and developmental conditions where mRNA destruction is a
disadvantage [293]. Our results are also consistent with a model in which miRNA-
mediated regulation of translation and mRNA decay are functionally independent, but
are similarly controlled by the same cis-elements. Determining whether the concordant
regulation of translation and mRNA abundance represents a mechanistic coupling of
miRNA-mediated regulation of translation and mRNA decay, and understanding the
molecular links between these two regulatory consequences of miRNA–mRNA
interactions are important goals for future investigation.
121
Materials and Methods
Plasmids and Oligonucleotides
miR-124 siRNA:
sense: 5′-UAA GGC ACG CGG UGA AUG CCA-3′
antisense: 5′-GCA UUC ACC GCG UGC CUU AAU-3′
Cell Culture and Transfection
HEK293T cells were obtained from ATCC (Cat# CRL-11268) and grown in
Dulbecco‟s modified Eagle‟s medium (DMEM) (Invitrogen) with 10% fetal bovine
serum (Invitrogen) and supplemented with 100 U/ml penicillin, 100 mg/ml
streptomycin, and 4 mM glutamineat 37 °C and 5% CO2. Transfections of HEK293T
cells were carried out with calcium phosphate. Cells were plated in 15 cm dishes 12 h
prior to transfection at 2 × 105 cells per ml (25 ml total). We made mock-transfection
mixture (1/10 volume of growth medium) by diluting 152 µl of 2 M CaCl2 into 1.25
ml of nuclease-free H2O and then slowly adding this solution to 1.25 ml of 2× HBS
(50 mM Hepes [pH 7.1], 280 mM NaCl, 1.5 mM Na2HPO4). After 1 min, the mixture
was added to a 15-cm plate at a medium pace. Transfections with miR-124
oligonucleotides were performed analogously with 30 nM of oligonucleotides in 2.5
ml of transfection mixture.
Preparation of Beads for Immunopurifications
Ago-specific 4f9 hybridoma was grown in suspension and adapted to 10% FBS-
enriched DMEM [278]. We purified the antibody by passing supernatant from 1 l of
culture over a 5-ml protein L-agarose column (Pierce Cat# 89929) as per the vendor‟s
instructions. Eluent fractions were pooled and dialyzed into PBS with Slide-A-Lyzer
Dialysis Cassettes (Pierce Cat# 66382). We then biotinylated the purified 4f9 antibody
with No-Weigh NHS-PEG4-Biotin Microtubes (Pierce Cat# 21329). We quantified
biotinylation with EZ Biotin Quantitation Kit (Pierce Cat# 28005). Biotinylated 4f9
antibody was aliquoted and stored at -80 oC until use. For Ago immunopurifications,
we coupled biotinylated 4f9 antibody to DYNAL Dynabeads M-280 Streptavidin
122
magnetic beads (Invitrogen Cat# 112-06D) (50 μg of antibody per ml of beads) as per
vendor‟s instructions and stored the coupled beads at 4 °C for up to 1 wk before use.
Immunoaffinity Purifications
Twelve hours after transfection, we washed each 15-cm plate once with phosphate-
buffered saline (usually two plates were used per IP), then added 1 ml of 4 °C lysis
buffer (150 mM KCl, 25 mM Tris-HCl [pH 7.4], 5 mM Na-EDTA [pH 8.0], 0.5%
Nonidet P-40, 0.5 mM DTT, 10 μl protease inhibitor cocktail [Pierce Cat# 78437], 100
U/ml SUPERase•In [Ambion Cat# AM2694]). Following a 30-min incubation at 4 °C,
we scraped the plates, combined the lysates, and then spun them at 4 °C for 30 min at
14,000 RPM in a microcentrifuge. We collected the supernatant and filtered it through
a 0.45-µm syringe filter. We froze an aliquot of lysate in liquid nitrogen for reference
RNA isolation. We then added 0.22 mg/ml heparin to the lysate. We mixed the lysate
with 2.5 mg of Dynal m-280 streptavidin beads (250 ul from original storage solution)
coupled to biotinylated 4F9 ago antibody (~12.5 µg), which we equilibrated
immediately prior to use by washing twice with 1 ml of lysis buffer. We incubated the
beads with the lysate for 2 h at 4 °C and then washed the beads twice with 1.25 ml of
ice-cold lysis buffer for 5-min each. Five percent of the beads were frozen for SDS
PAGE analysis after the second wash. RNA was extracted directly from the remaining
beads using lysis buffer from Invitrogen‟s Micro-to-Midi kit (Invitrogen Cat# 12183-
018). We purified RNA from the lysate and RNA extracted from the beads with the
Micro-to-Midi kit as per vender‟s instructions, except that the percentage isopropanol
used for binding to the column was 70%, instead of 33%, to promote the binding of
small RNAs.
Western Blots
Sixty hours after transfection, Hek293T cell lysate was prepared using the same
protocol for immunoaffinity purifications. The concentration of protein in each sample
was quantified using the BCA assay (Pierce Cat#23255). For SDS-PAGE separation,
25 µg of protein from each sample was used. Protein was then transferred on to a
123
polyvinylidene fluoride (PVDF) membrane for detection with the following specific
antibodies:DUSP9 (Abcam Cat# ab54941-100); PTPN11 (Bethyl Laboraties Cat#
a301–544a); ITGB1 (BD Transduction Laboraties Cat# 610467); AURKA, DHCR24,
MAPK14, PLK1 (Cell Signaling Cat# 4718, 2033s, 9212, 4513, respectively); AHR,
ACTN4, CDK4, RNF128, NRAS, PTBP2, (Santa Cruz Biotechnology Cat# sc-5579,
sc-17829, sc-260, sc-101967, sc-519, sc-101183, respectively); TUBA1A (Sigma Cat#
096K4777). GAPDH and TUBB1 (Abcam Cat# ab9484, ab6046) were used as loading
controls to check for lane-specific differences from loading, transfer, and detection
errors. Protein bands were quantified using the BioRad Quantity One software
package.
Preparation of Cell Extracts for Translation Profiling
For translation experiments, two 15-cm dishes of cells (per condition) were seeded,
grown, and transfected as described above. Twelve hours after transfection, high-
purity cyclohexamide (Calbiochem Cat# 239764) was added at a final concentration of
0.1 mg/ml directly into growth media, and the plate was agitated for 1 min at room
temperature. Plates were then placed on ice and washed twice with 10 ml of ice-cold
buffer A (20 mM Tris [pH 8.0], 140 mM KCl, 5 mM MgCl2, 0.1 mg/ml
cycloheximide). After the second wash was aspirated, the plates were tilted and left for
1 min on ice to facilitate removal of excess liquid. Each plate was then washed 1×
with 2 ml of ice-cold buffer A that contained 0.22 mg/ml of heparin. After removal of
excess liquid, cells were scraped from each dish and collected in a 1.5-ml
microcentrifuge tube on ice. Each plate typically yielded about 300 μl (for 600 μl
total) of cells and residual buffer. This mixture was then brought to 1× protease
inhibitor cocktail (Pierce Cat# 78437), 100 U/ml SUPERASin, and 0.5 mM DTT. To
lyse the cells, the cell-buffer mixture was brought to 0.1% Brij 58 (Sigma Aldrich
Cat# P5884-100G) and 0.1% sodium deoxycholate (Sigma Aldrich Cat# D6750-
100G) and vortexed for 1 min. The lysate was subsequently spun at 3,500 rpm in a
microcentrifuge for 5 min at 4 °C. Supernatant was collected in a fresh tube and spun
at 9,500 rpm in a microcentrifuge for 5 min at 4 °C. Supernatant was collected, flash
frozen in liquid nitrogen, and then stored at −80 °C until use.
124
Sucrose Gradient Preparation
Sucrose gradients were prepared using the Gradient Master (Biocomp) according to
the manufacturer‟s suggestions. Five percent and 60% (w/v) sucrose solutions were
prepared by dissolving sucrose in Gradient Buffer (20 mM Tris-HCl [pH 8.0], 140
mM KCl, 5 mM MgCl2, 0.5 mM DTT, 0.1 mg/ml cycloheximide) at room
temperature. The 60% solution was dispensed into an SW41 ultracentrifuge tube
through a cannula underneath the 5% solution. Using an 11-step program (Biocomp,
SW41 SHORT SUCR 5-50 11), the two solutions were mixed on the Gradient Master
to form a linear gradient. After preparation, gradients were placed in chilled SW41
ultracentrifuge buckets and equilibrated for several hours at 4 ºC.
Sucrose Gradient Velocity Sedimentation
Immediately before centrifugation, 300 μl of lysate (~300 μg of total RNA) was
transferred to the surface of the gradient. Gradients were centrifuged at 41,000 rpm
(RCFave = 207,000) for 70 min at 4 ºC using a SW41 rotor and then stored at 4 ºC
until fractionation. The Gradient Station (Biocomp) trumpet tip was pushed into the
ultracentrifuge tube at a rate of 0.17 mm per second. Fractions (550 μl) were collected
into a 96-well plate containing 600 μl of lysis solution (Invitrogen) using a fraction
collector (Teledyne-Isco). The absorbance of the gradient at 260 nm was measured
during fractionation using a UV6 system (Teledyne-Isco).
Gradient Encoding
Immediately after fractionation a unique set of four to five polyadenylate-tailed
control RNAs, corresponding to Methanococcus jannaschii mRNAs that do not share
significant identify to sequences in the human genome, were added at 100 pg each to
fractions that contained the 80S ribosome and polysomes. The solution was mixed
well by inverting the plate several times, and liquid was collected in the well bottom
by a brief centrifugation. A Precision XS liquid handler (BioTek Intruments) was used
to transfer a defined volume of each of the fractions to one of four tubes (Fisher Cat#
14-959-11B); the solutions in each tube are referred to as pool, “A,” “B,” “C,” or “D,”
125
respectively. Upon completion of liquid handling, eight additional control RNAs
(Ambion Cat# 1780) were added to each pool, and the pools were stored at −20 ºC.
Pools A–D were thawed at room temperature for 30 min. Two volumes of isopropanol
was added to each pool, and the RNA in each pool was isolated from the mixture
using the Micro-to-Midi RNA isolation kit (Invitrogen Cat# 12183-018).
DNA Microarray Production and Prehybridization Processing
HEEBO oligonucleotide microarrays were printed on epoxysilane-coated glass (Schott
Nexterion E) by the Stanford Functional Genomic Facility. The HEEBO microarrays
contain ~45,000 70-mer oligonucleotide probes, representing ~30,000 unique genes. A
detailed description of this probe set can be found at
(http://microarray.org/sfgf/heebo.do) [255,303].
Prior to hybridization, slides were first incubated in a humidity chamber (Sigma Cat#
H6644) containing 0.5× SSC (1× SSC = 150 mM NaCl, 15 mM sodium citrate [pH
7.0]) for 30 min at room temperature. Slides were snap-dried at 70–80 oC on an
inverted heat block. The free epoxysilane groups were blocked by incubation with 1M
Tris-HCl (pH 9.0), 100 mM ethanolamine, and 0.1% SDS for 20 min at 50 °C. Slides
were washed twice for 1 min each with 400 ml of water, and then dried by
centrifugation. Slides were used the same day.
DNA Microarray Sample Preparation, Hybridization, and Washing
Amplified RNA was used for most DNA microarray experiments. Poly-adenylated
RNAs were amplified in the presence of aminoallyl-UTP with Amino Allyl
MessageAmp II aRNA kit (Ambion Cat# 1753). For mRNA expression experiments,
universal reference RNA was used as an internal standard to enable reliable
comparison of relative transcript levels in multiple samples (Stratagene Cat# 740000).
Amplified RNA (3–10 μg) was fluorescently labeled with NHS-monoester Cy5 or Cy3
(GE HealthSciences Cat# RPN5661). Dye-labeled RNA was fragmented (Ambion
Cat# 8740), then diluted into in a 50-μl solution containing 3× SSC, 25 mM Hepes-
NaOH (pH 7.0), 20 μg of human Cot-1 DNA (Invitrogen Cat# 15279011), 20 μg of
126
poly(A) RNA (Sigma Cat# P9403), 25 μg of yeast tRNA (Invitrogen Cat# 15401029),
and 0.3% SDS. The sample was incubated at 70 °C for 5 min, spun at 14,000 rpm for
10 min in a microcentrifuge, then hybridized at 65 °C using the MAUI hybridization
system (BioMicro) for 12–16 h. For translation experiments, amplified RNA from
pools A and C was fluorescently labeled with NHS-monoester Cy5, and RNA from
pools B and D was fluorescently labeled with NHS-monoester Cy3. Amplified RNA
from pools A and B were comparatively hybridized to a DNA microarray to obtain the
average ribosome density, and amplified RNA from pools C and D were
comparatively hybridized to a DNA microarray to measure ribosome occupancy.
To compare total RNA levels in miR-124 and mock-transfected cells (Figure S3), 5–
10 μg of total RNA from miR-124–transfected cells or mock-transfected cells or
universal reference RNA (Stratagene Cat# 740000) was reverse transcribed with
Superscript III (Invitrogen Cat# 18080085) in the presence of aminoallul-dUTP 5-(3-
aminoallyl)-dUTP (Ambion Cat# AM8439) and natural dNTPs (GE Healthsciences
Cat# US77212) with 10 μg of N9 primer (Invitrogen). Subsequently, amino-allyl–
containing cDNAs from miR-124 and mock-transfected cells were covalently linked
to Cy5 NHS-monoesters, and universal reference cDNA was covalently linked to Cy3
NHS-monoesters (GE HealthSciences Cat# RPN5661). Cy5- and Cy3-labeled cDNAs
were mixed and diluted into 50 μl of solution containing 3× SSC, 25 mM Hepes-
NaOH (pH 7.0), 20 μg human Cot-1 DNA (Invitrogen Cat# 15279011), 20 μg of
poly(A) RNA (Sigma Cat# P9403), 25 μg of yeast tRNA (Invitrogen Cat# 15401029),
and 0.3% SDS. The sample was incubated at 95 °C for 2 min, spun at 14,000 rpm for
10 mins in a microcentrifuge, then hybridized at 65 °C for 12–16 h.
Following hybridization, microarrays were washed in a series of four solutions
containing 400 ml of 2× SSC with 0.05% SDS, 20058 SSC, 1× SSC, and 0.2× SSC,
respectively. The first wash was performed for 5 min at 65 °C. The subsequent washes
were performed at room temperature for 2 min each. Following the last wash, the
microarrays were dried by centrifugation in a low-ozone environment (<5 ppb) to
prevent destruction of Cy dyes [265]. Once dry, the microarrays were kept in a low-
127
ozone environment during storage and scanning (see
http://cmgm.stanford.edu/pbrown/protocols/index.html).
Scanning and Data Processing
Microarrays were scanned using AxonScanner 400oB (Molecular Devices). PMT
levels were autoadjusted to achieve 0.1–0.25% pixel saturation. Each element was
located and analyzed using SpotReader (Niles Scientific) and GenePix Pro 6.0
(Molecular Devices). For IP and mRNA expression experiments, the microarrays were
submitted to the Stanford Microarray Database for further analysis [266]. Data were
filtered to exclude elements that did not have one of the following: a regression
correlation of ≥0.7 between Cy5 and Cy3 signal over the pixels compromising the
array element, or an intensity/background ratio of ≥3 in at least one channel.
Ribosome density (pool “A” versus “B”) and ribosome occupancy (pool “C” versus
“D”) measurements were normalized using exogenous doping control RNAs to correct
for experimental variation between the two pools from RNA isolation, labeling
efficiency, and scanning levels. In most cases, oligonucleotides that were designed to
measure the exogenous doping control RNAs were represented multiple times on the
DNA microarray (up to eight) and printed from different plates with different print
tips. For ribosome occupancy experiments, the measured Cy5/Cy3 ratios of features
on the microarray that correspond to the eight RNA controls added to pools “C” and
“D” were fit to their expected Cy5/Cy3 ratios using least-squares linear regression in
the statistical computing program R. The slope and y-intercept were used to rescale the
measured Cy5 value of all other features on the DNA microarray. The ribosome
occupancy for each RNA was then calculated as the corrected Cy5 intensity /
(corrected Cy5 intensity + Cy3 intensity) (Figure S3C).
To calculate the average number of ribosomes bound to each mRNA, the measured
Cy5/Cy3 ratios of features on the microarray that correspond to the 85 M. jannaschii
doping control RNAs that were added to fractions that contained ribosomes pools was
fit to their expected Cy5/Cy3 ratios using least-squares linear regression. The slope
128
and y-intercept were used to rescale the measured Cy5 value of all other features on
the DNA microarray (Figure S3B).
The average ribosome density was calculated by dividing the average ribosome
number by coding sequence length and then multiplying the result by 100 to give
density per 100 nts. The average ribosome number was calculated using two
relationships. For each ribosome peak in the profile, the distance traveled from the
start point was determined. In all gradients, we could clearly resolve peaks for up to
seven bound ribosomes, and we used least-squares regression to relate the ribosome
peaks 1–7 to their distance traveled in the gradient according to the following
equation:
bDTaRLog )(10 , (3)
where R represents the number of ribosomes bound, DT represents the distance
traveled, and a and b are the slope and y-intercept, respectively. We then recorded the
distance between the midpoint of each fraction to the start of the profile for each of the
15 ribosome-bound fractions and used the slope and y-intercept from Equation 3 to
calculate the number of ribosomes at each fraction midpoint. The gradient encoding
ratio at each fraction midpoint is the result of differential partitioning of each fraction
in a predetermined manner into the heavy and light pools, and the ratio can be related
to the ribosome number at each fraction midpoint using least-squares linear regression
as described by Equation 4:
10 10( ) ( )Log R a Log ER b , (4)
where R represents the average ribosome number, and ER represents the encoding
ratio. Finally, the average number of ribosomes bound for each gene‟s mRNAs was
calculated using the slope and y-intercept from Equation 4.
Prior to normalization, spots with intensity/background of less than 1.5 for either Cy3
or Cy5 channel were filtered.
The microarray data are available from Gene Expression Omnibus (GEO)
(http://www.ncbi.nlm.nih.gov/geo/) and Stanford Microarray Database .
129
Microarray Analyses
Hierarchical clustering was performed with Cluster 3.0 [267] and visualized with Java
TreeView 1.0.12 [268].
For SAM, unpaired two-class t-tests were performed with default settings (R-package
samr; http://cran.r-project.org/web/packages/samr/index.html). Microarray features
that passed quality filtering in all experiments were used as input. Ago IP experiments
and mRNA expression experiments were mean centered at log2 0 prior to running
SAM. The ribosome occupancy and ribosome number/density measurements from
miR-124 and mock-transfected cells were highly correlated, but had slightly different
means (see main text). Because of the small changes in ribosome occupancy and
ribosome density between miR-124 transfected and mock-transfected samples, we
conservatively adjusted the means of each experiment to be the same by subtracting
the difference between the mean of that experiment and the mean of all the
experiments to ensure that differences observed between miR-124–transfected and
mock-transfected cells were not due to the doping control normalization. Enrichment
of GO terms was performed with Genetrail [304]. p-Values were corrected for
multiple-hypothesis testing by the Bonferroni method [305].
The significance of correlations was estimated in R by recalculating the correlations
with 10,000 permuted sets of data, then estimating the p-value with the normal
distribution function using the mean and standard deviation from the permuted data.
We used a bootstrap method to estimate 95% confidence intervals for the average
changes in mRNA abundance, estimated translation rate, ribosome occupancy, and
ribosome density (Figures 4 and 5, and Figure S8) of IP targets compared to
nontargets. To do this, we sampled with replacement measurements for each gene
from the mock and miR-124 replicates, respectively, 10,000 times, then calculated the
respective changes between miR-124 IP targets and nontargets for the 10,000
bootstrapped samples.
130
Sequence Data
For molecular features that mapped to genomic loci with an entrezID, the RefSeq
sequence with the longest 3′-UTR was used. In cases with multiple RefSeqs with the
same 3′-UTR length, the one that was alphanumerically first was used. RefSeq 3′-
UTR, coding, and 5′-UTR sequences were retrieved from UCSC genome browser
(hg18) http://genome.ucsc.edu/. Seed match sites in these sequences were identified
with Perl scripts. miR-124 seed matches: 6mer_n2-7 “UGCCUU,” 6mer_n3-8
“GUGCCU,” 7mer-m8 “GUGCCUU,” 7mer-A1 “UGCCUUA,” 8mer
“GUGCCUUA.” In many instances, there were multiple probes on the DNA
microarrays that mapped to the same Refseq. In these cases ,we used the probe that
was most enriched in Ago IPs from miR-124–transfected cells compared to mock-
transfected cells.
Acknowledgments
Professor Edward Chan very kindly provided 4F9 Ago hybridoma. We thank Dan
Klass for advice on immunopurifications, Dr. Julia Salzman for advice on statistics,
Greg Hogan, Dr. Delquin Gong, Ari Firestone, Graham Anderson, Dustin Hite, and
Dr. Jamie Geier Bates for comments on the manuscript, as well as members of the
Brown, Ferrell and Herschlag labs for advice and discussions.
131
Supplementary Figures
Figure S1. mRNA Enrichment Profiles in Ago IPs.
Unsupervised hierarchical clustering of the enrichment profiles in Ago IPs from miR-124–transfected
cells (black), mock-transfected cells (blue), and negative control IPs (no Ago antibody) from both types
of cells (orange). Rows correspond to 16,095 sequences (representing 9,729 genomic loci with a Refseq
sequence), and columns represent individual experiments. Unsupervised hierarchical cluster analysis
segregated the Ago IPs from the negative-control IPs. The Ago IPs were further bifurcated into two
subgroups: miR-124 transfected and mock transfected. There was a correlation between Ago and mock
IPs (r = 0.6), even though ~10-fold less RNA was obtained from mock IPs compared to Ago IPs, and
no protein bands were detectable by protein staining. We speculate that Ago complexes bind the beads
nonspecifically and contribute to the weak background binding (Text S1 & Figure S2).
132
Figure S2. Streptavidin-coated Dynal Beads Weakly Enrich miR-124 Targets
After miR-124 Transfection.
(A) Supervised hierarchical clustering of the enrichment profiles of the 500 most enriched mRNAs in
negative-control IPs from miR-124–transfected cells (blue) compared to mock-transfected cells (black).
Rows correspond to mRNAs, and columns represent individual experiments.
(B) Enrichment of seed matches to miR-124 in the 3′-UTRs of mRNAs nonspecifically associated with
magnetic beads. The significance of enrichment of seed matches in Ago IP targets was measured with
the hypergeometric distribution.
133
Figure S3. Polysome Profiles and Doping Control Fits.
(A) Polysome profile traces from lysates prepared from mock-and miR-124 transfected Hek293T cells.
The vertical gray line indicates the division between unbound and ribosome bound fractions.
(B) Scatterplot between the observed “gradient-encoding” ratios of 33 exogenous RNAs doped into
134
each of the ribosome bound fractions and their predicted ratios. The blue circles show the raw data and
the blue line is the least-squares fit of the raw data, while the red circles and red line represent the
corrected data and fit, respectively.
(C) Scatterplot between the observed ratios of eight exogenous RNAs doped into each ribosome bound
and ribosome unbound fractions and their predicted ratios. The blue circles show the raw data, and the
blue line represents the least-squares fit of the raw data, while the red circles and red line represent the
corrected data and fit, respectively.
135
Figure S4. miR-124 Ago IP Targets Are Likely Destroyed, Rather than
Deadenylated and Stored.
Scatterplot between changes in mRNA abundance for miR-124 Ago IP targets following transfection
with miR-124 compared to mock measured with poly(A) amplified mRNA (x-axis) and cDNA
synthesized from randomly primed total RNA (y-axis). The red line has a slope of one and goes through
the y-axis at zero. The black line is a least-squares fit of the data (slope = 0.82 in linear space, Pearson
correlation log2 [mRNA] = 0.82). This analysis compares 208 miR-124 targets for which we obtained
quality measurements in both experiments.
136
Figure S5. Relationship Between the Coding Sequence Length and Changes in
Ribosome Occupancy and Ribosome Density of miR-124 Ago IP Targets
Following Transfection of miR-124.
(A) Scatterplot between coding sequence length (x-axis) and fold-change in ribosome occupancy (y-
axis) for miR-124 Ago IP targets following transfection with miR-124 compared to mock. The
horizontal gray line denotes a 20% reduction in ribosome occupancy.
(B) Scatterplot between coding sequence length (x-axis) and fold-change in ribosome density (y-axis)
for miR-124 Ago IP targets following transfection with miR-124 compared to mock. The red curve is a
nonlinear least-squares fit of the change in ribosome density following a first-order decay as a function
of coding sequence length.
137
Figure S6. Relationship Between Ribosome Occupancy in Mock-transfected Cells
and Change in Ribosome Occupancy Following Transfection of miR-124.
(A) Scatterplot between changes in ribosome occupancy (x-axis) and ribosome density (y-axis) for miR-
124 Ago IP targets following transfection with miR-124 compared to mock. The gray line is a least-
138
squares linear regression fit of the data (Spearman rank correlation = 0.45), and the red line is a moving
average plot (window of 10).
(B) The logarithm of the ratio of the average ribosome occupancy in miR-124–transfected cells to that
in mock-transfected cells as a function of the average ribosome occupancy in mock-transfected cells
(Spearman rank correlation = −0.78). Black circles correspond to mRNAs that were not enriched by the
Ago IP following miR-124 transfection. Red circles correspond to mRNAs that were enriched by the
Ago IP following miR-124 transfection (1% local FDR). The green curve represents a Lowess
smoothed fit of the data. The gray curve shows the maximum possible increase in ribosome occupancy
in miR-124 cells compared to mock cells.
(C) The ratio in the average ribosome occupancy in miR-124–transfected cells versus mock-transfected
cells minus the Lowess fit of the data (green points in [B]) as a function of the average ribosome
occupancy in mock-transfected cells.
(D) Scatterplot of changes in mRNA abundance (x-axis) versus changes in translation rate (y-axis) for
Ago IP targets following transfection with miR-124. The slope of the least-squares fit of the data is 0.24
(in linear space, 0.36), and the Pearson correlation is 0.60. This is Figure 7 replotted to allow side-by-
side comparison with (E).
(E) Same as in (D), except that the changes in translation rate were obtained using the smoothed-fit
adjusted ribosome occupancy measurements (C). The slope of the least-squares fit of the data is 0.20 (in
linear space, 0.29), and the Pearson correlation is 0.59.
139
Figure S7. Significance of the Correlation Between Changes in mRNA
Abundance and Translation of miR-124 Ago IP Targets.
(A) Histogram of correlations between changes in mRNA abundance and translation for 100,000
permuted sets of miR-124 Ago IP targets. The red curve shows a normal distribution with mean (0.0)
and standard deviation (.04) from the 100,000 permuted sets. The red arrow shows the Pearson
correlation of the actual data (0.60, p < 10−45
).
(B) Moving average plot of the Pearson correlation (window of 500) between changes in mRNA
abundance and translation as a function of enrichment in Ago IPs in miR-124–transfected cells versus
mock-transfected cells (SAM D-score). The horizontal grey line shows the average Pearson correlation
between changes in mRNA abundance and translation across the moving windows (r = 0.09).
(C) Histogram of correlations between changes in mRNA abundance and translation for 10,000
permuted sets of mRNAs that are not miR-124 targets, but have similar distribution in their changes in
mRNA abundance (t-test, p > 0.001) to miR-124 IP targets that change less than 40% in mRNA
abundance. The red curve shows a normal distribution with mean (0.14) and standard deviation (0.04)
from the 10,000 permuted sets. The red arrow shows the Pearson correlation of miR-124 IP targets that
change less than 40% in mRNA abundance (r = 0.30, p < 10−5
).
140
Figure S8. Concordant Changes in mRNA Abundance and Translation of miR-
124 Ago IP Targets with 7mer 3′-UTR Seed Matches and miR-124 Ago IP
Targets that Lack a 7mer 3′-UTR Seed Match.
(A) Scatterplot between changes in mRNA abundance (x-axis) and the estimated translation rate (y-
axis) for miR-124 Ago IP targets with 7mer 3′-UTR seed matches following transfection with miR-124
compared to mock. The gray line is a least-squares linear regression fit of the data, and the black line is
a moving average plot (window of 10). The slope of the least-squares fit of the data = 0.23 (in linear
space = 0.37) and the Pearson correlation = 0.59.
(B) Scatterplot between changes in mRNA abundance (x-axis) and the estimated translation rate (y-axis)
for miR-124 Ago IP targets that lack 7mer 3′-UTR seed matches following transfection with miR-124
compared to mock. The gray line is a least-squares linear regression fit of the data, and the red line is a
moving average plot (window of 10). The slope of the least-squares fit of the data = 0.21 (in linear
space = 0.24) and the Pearson correlation = 0.42.
141
Figure S9. Changes in Abundance and Translation of miR-124 Ago IP Targets
With Seed Matches in 3′-UTRs, Coding Sequences and 5′-UTRs.
(A) Cumulative distribution of the change in mRNA levels following transfection with miR-124
compared to mock. This analysis compares miR-124 Ago IP targets (1% local FDR) with at least one
3′-UTR 7mer seed match, but no coding sequence or 5′-UTR 7mer seed matches (red, 244), IP targets
with at least one 3′-UTR 6mer seed match (green, 47), but no 3′-UTR, coding sequence, or 5′-UTR
7mer seed matches, IP targets with at least one coding sequence 7mer seed match, but no 3′-UTR or 5′-
UTR 7mer seed matches (blue, 70), IP targets that lacked a 6mer seed match in the 3′-UTR, coding
sequence, or 5′-UTR (orange,23), and nontargets (7385, black). This analysis compares Ago IP targets
(red) versus nontargets (black).
(B) Cumulative distribution of the change in translation following transfection with miR-124 compared
to mock. This analysis compares miR-124 Ago IP targets (1% local FDR) with at least one 3′-UTR
7mer seed match, but no coding sequence or 5′-UTR 7mer seed matches (red), IP targets with at least
one 3′-UTR 6mer seed match (green), but no 7mer seed matches in the 3′-UTR, coding sequence, or 5′-
142
UTR, IP targets with at least one coding sequence 7mer seed match, but no 7mer seed match in the 3′-
UTR or 5′-UTR (blue), IP targets that lacked a 6mer seed match in the 3′-UTR, coding sequence, or 5′-
UTR (orange), and nontargets (black). This analysis compares Ago IP targets (red) versus nontargets
(black).
(C) Bar plot of the average change in mRNA abundance (blue) and translation rate (red) of miR-124
Ago IP targets following transfection with miR-124. The average change in mRNA abundance and
translation of targets was calculated by subtracting the average change of nontargets for the mRNA
abundance and translation rate measurements following transfection with miR-124. This analysis
compares miR-124 Ago IP targets (1% local FDR) with at least one 3′-UTR 7mer seed match, but no
coding sequence or 5′-UTR 7mer seed matches, IP targets with at least one 3′-UTR 6mer seed match,
but no 7mer seed matches in the 3′-UTR, coding sequence, or 5′-UTR, IP targets with at least one
coding sequence 7mer seed match, but no 7mer seed match in the 3′-UTR or 5′-UTR, IP targets with at
least one 7mer seed match in the 5′-UTR, but no 7mer seed match in the 3′-UTR or coding sequence,
and IP targets that lacked a 6mer seed match in the 3′-UTR, coding sequence, or 5′-UTR. This analysis
compares Ago IP targets (red) versus nontargets (black). The error bars represent 95% confidence
intervals in the mean difference estimated by bootstrap analysis.
143
Figure S10. Efficiency of Recruitment to Argonautes by miR-124 Seed Matches
Correlates with Effects on Both mRNA Abundance and Translation.
(A) Scatterplot between changes in Ago IP enrichment (x-axis) following transfection with miR-124
compared to mock and estimated changes in protein production (Equation 2) (y-axis) for mRNAs with
either 8mer seed matches (red dots) or 7mer seed matches (blue dots) to miR-124 in their 3′-UTRs. For
8mer seed matches, the slope of the least-squares fit of the log2 data is −0.46 (in linear space, −0.03),
and the log2 Pearson correlation is −0.72. For 7mer seed matches, the slope of the least-squares fit of the
log2 data is −0.39 (in linear space, −0.05), and the log2 Pearson correlation is −0.72.
(B) Same as (A) except for mRNAs with seed matches to miR-124 in their coding sequences and no
7mer seed matches in their 3′-UTRs. For 8mer seed matches, the slope of the least-squares fit of the log2
data is −0.13 (in linear space, −0.008), and the log2 Pearson correlation is −0.39. For 7mer seed
matches, the slope of the least-squares fit of the log2 data = −0.14 (in linear space, −0.02), and the log2
144
Pearson correlation is 0.38.
(C) Same as in (A) except for mRNAs with 6mer seed matches to miR-124 in their 3′-UTR, but no
7mer seed match in their 3′-UTR or coding sequence (red), and mRNAs that lack 6mer seed matches in
their 3′-UTR or coding sequence (blue). For 6mer seed matches, the slope of the least-squares fit of the
log2 data is −0.21 (in linear space, −0.09), and the log2 Pearson correlation is −0.40. For mRNAs
without 6mer seed matches, the slope of the least-squares fit of the log2 data is −0.13 (in linear space,
−0.07), and the log2 Pearson correlation is −0.22.
Table S1. Summary of miR-124 Targets for Western Blot Analysis.
145
Concluding Remarks
Dicer Domain Function
Regardless of the exact role of DUF283, it is satisfying to observe the additive effects
of Dicer domains on proper dicing. The smallest active catalytic unit, RNab, cleaves
dsRNA in an unmeasured manner with no discernable banding pattern, highlighting
the importance of the PAZ domain in Dicer substrate recognition. Addition of the PAZ
to the RNase domains modulates more precise dicing activity; however the products
are of an insufficient size. It is only in the presence of DUF283 and PAZ that the
RNab domains can effectively generate properly sized siRNAs from dsRNA. The
evolution of such meticulous control over such seemingly minor details belies their
superficiality and underscores the selective pressure on Dicer to produce siRNAs
within a narrow size range.
The increased activity and ease of expression of the DPR unit is particularly
interesting from a technological standpoint. Although commercially available Dicer
kits and protocols with proprietary modified Dicer variants that cleave dsRNA more
efficiently are available, the DPR unit is a promising avenue for labs more inclined
towards to take a do-it-yourself position. That DPR may differ slightly it is ability to
make the first cut on a dsRNA substrate lacking 3‟2nt overhangs is an intriguing
hypothesis suggesting that the ATPase/Helicase domain has been selectively retained
to process long dsRNA which argues for the presence of human endo-siRNAs and a
potentially robust anti-viral component in human RNAi.
Overall, these results argue that many details with regards to Dicer domain function
are still unknown and that subtle effects can be revealed with relatively simple
experiments. However, more experiments are necessary before strong conclusions can
be made. The experiments presented must be repeated and done in conjunction with
many of the proposed studies to uphold any of the aforementioned hypotheses. For
instance, all of the in vitro dicing assays were carried out with substrates that do not
146
resemble miRNA precursors processed by human Dicer in vivo. Thus, many of the
observations and insights into the function of the ATPase/Helicase and DUF283
reported might not have any bearing on biologically relevant Dicer activity.
It is safe to say that the basic mechanism by which Dicer generates siRNAs is well
understood. In moving forward with studying Dicer, the most interesting questions
concern the regulation of global miRNA activity through Dicer. The identification of
numerous binding partners with ties to several different cellular pathways suggests
dynamic modulation of Dicer activity. Many of the ubiquitous and highly expressed
miRNAs target cell cycle genes and numerous growth factors. Thus, cellular growth
rate could be determined in part through the global miRNA concentration which is a
function of Dicer activity. Recent work on regulated 3‟UTR shortening provides
evidence for a similar phenomenon in that proliferative cells tend to dial down miRNA
activity by regulating 3‟-UTR length on a genomic scale [306,307]. In much the same
way, Dicer activity may be tuned as another method for regulating growth. The recent
discovery that some miRNAs are on/off toggled through post-transcriptional
modifications to the miRNA precursor raises the possibility that Dicer activity might
also be influenced by specific associative factors; either the modified precursors
themselves or by precursor-specific protein binding partners. Dicer‟s association with
Argonaute proteins and the RISC complex expand the outcomes of dynamic Dicer
regulation. It is not implausible that how and what RISC targets is influenced by either
Dicer‟s binding partners or even through the kinetics of Dicer processing and transfer
of its products to Argonaute. Likewise, the balance between translational inhibition
and mRNA degradation of RISC targeted mRNAs might be influenced upon Dicer
kinetics and the binding partners associated with RISC through Dicer.
147
Systematic Identification of miRNA Targets and Steps in Gene
Expression Regulated by miRNAs
We have presented a successful method for the identification of miRNA targets by
virtue of their association with the RISC complex and specifically with the Argonaute
proteins. One drawback in using microarrays to identify the mRNAs bound to RISC is
the probe limitation of the array in use. To some extent, The HEEBO arrays we
employed discern between transcript variants, but the build is by no means 100%
accurate or exhaustive. Likewise, 3‟-UTR sequences used in our analysis are the
longest retrievable database 3‟UTR entries rather than representative of the actual
sequences bound. This is a weakness because 3‟UTR length varies between cell types
and cell states [306,307]. Although high density tiling arrays are available, next
generation sequencing technology provides the strongest option in terms of an
unbiased approach for the purposes of accurate identification of bound RNAs. Deep
sequencing would also aid in the discovery of novel Ago associated small RNAs (like
endo-siRNAs) if the siRNA generating locus of origin is not included in most array
builds.
Excitingly, one group has already taken the next step and combined Ago IPs with an
RNase step followed by deep sequencing of Ago protected sequence fragments to
hone in on the actual miRNA binding sites in a methodology referred to as high-
throughput sequencing of RNA isolated by crosslinking immunoprecipitation (HITS-
CLIP)[308,309]. Basically, prior to the IP, Ago bound transcripts are cross linked, and
then whittled down by a controlled RNase step leaving only sequence protected by its
physical interaction with Ago and minimal flanking sequence. A post IP size selection
ensures that only fragments of certain sized are used for the production of a
sequencing library. Post sequencing, the small fragments are mapped back to the
genome for miRNA/mRNA identification and binding site mapping. Although in a
few cases our data can be used to infer the seed match(es) important in recruiting an
mRNA to RISC, it does not provide information on the bona fide binding sites. High
resolution miRNA binding site mapping is crucial for teasing out the connections
148
between miRNAs and the mRNAs they recruit to Argonaute from the morass of RISC
associated RNAs one finds in a basic Ago IP snapshot. As we demonstrated, specific
miRNA targets can be identified through the comparison of Ago IP profiles from
naïve cells to cells transfected with a specific miRNA. Alternatively, Ago IPs can be
used to identify miRNAs recruited to RISC by specific gene expression programs
rather than specific miRNAs. Ago IPs preformed along a time course after the
initiation of a developmental program or cell fate decision (stem cell differentiation)
could be used to identify miRNAs and mRNAs important in the engagement of a new
expression program. In this way, Ago IPs can be used to measure the emergence or
disappearance of specific miRNAs and corresponding changes in enrichment of
cognate mRNAs when compared to the null state.
Although this type of analysis bypasses the absolute necessity for discernment of
actual binding sites to explain the recruitment of mRNAs, it would probably require >
~5-fold change in the abundance of a specific miRNA to deconvolute most
miRNA:mRNA target pairs given that most mRNAs have multiple seed matches to
numerous miRNAs. Furthermore, miRNAs expressed together in coherent expression
often have overlapping target sets. We have moved forward with Ago IPs to quantify
changes in RISC recruitment along time courses in stimulated Jurkat cells and in the
macrophage-like HL60 cells induced to differentiate into neutrophil like cells with the
goal of adapting our original IP method into a technology similar to Ago HITS-CLIP.
High resolution miRNA:mRNA binding site mapping analysis preformed in tandem
with gene expression and translational profiling along developmental time courses is
the eventual goal. Indeed, similar experiments are becoming more common in the field
and promise to revolutionize our understanding of miRNA
function[309,310,311,312,313,314].
miRNAs have been characterized largely as micro managers of gene expression
important for clearing out mRNAs no longer required by the gene expression
program, counteracting spurious transcription for maintenance of transcriptome
integrity, and by fine tuning expression levels of expressed genes. Nevertheless,
149
growing evidence is building a case that miRNAs are crucial for driving cell fate
decisions. Recent work in human neurons reveals that proper expression of miR-124
and miR-9* is essential to post mitotic neural development[315]. Precocious
expression of miR-124 and miR-9*inhibits proliferation of the neural progenitors.
Zhang and colleagues systematically identified temporally regulated larval stage-
specific miRNA sets using RISC IPs in C. elegans[314]. They found that these
miRNAs coordinate gene expression programs through targeting of signaling
molecules in a larval stage specific manner. In addition, miRNA expression profiling
suggests that many miRNAs exhibit dynamic responses to cell cycle phase[316].
Debating whether miRNA expression drives cell fate decisions rather than maintains
them is largely a semantic argument, as it well established that disrupting miRNA
expression can results in devastating phenotypic consequences. The classification, to a
large extent, hinges on whether or not experimentally induced miRNA expression can
be sufficient to force cells into a specific differentiation trajectory.
Although in our experiments miRNA expression mirrored miRNA RISC
incorporation, it is likely that cells regulate miRNAs inclusion into functional RISC.
Several studies provide evidence that miRNAs can be localized through sequence
localization motifs and by RBPs associated with target mRNAs[214,317]. It would be
interesting to perform sequential IPs of Ago followed by other interesting RISC
cofactors such as FMRP or HUR to identify subsets of miRNAs:mRNAs that have
specialized function or activity. Although biologically dominant mechanisms and
modes of function provide useful theoretical frameworks from which to proceed from,
it is the anomalous examples that sometimes provide the most interesting or
unexpected biology.
The next step in understanding the mechanisms by which miRNAs regulate gene
expression will be to determine if the concordant relationship between mRNA
abundance and translation rate we reported is potentially a function of our usage of an
exogenous miRNA not native to HEK293T cells. Although the targets we identified
closely parallel those reported in mouse brain, and thus are likely bona fide biological
150
targets, HEK cells may not be equipped to regulate these targeted mRNAs the same
way they would in neuronal cells[309]. Brain specific RBPs may bind many of these
messages and regulate the balance of miRNA mediated repression in favor of
translational inhibition or mRNA degradation. It is also possible that in a neuronal
context brain specific RBPs might protect or sequester a subset of miR-124 targets.
We are currently knocking down endogenous let-7 in an effort to measure all the same
parameters of gene expression and determine if there is a strong correlation between
let-7 specific de-repression of mRNA stability and translation. We are also attempting
to incorporate methodologies similar to those described by Ingolia e al to generate
high resolution ribosome positional data to test if there are interesting patterns of
ribosome stalling in miRNA repressed mRNAs [284]. The method is similar to the
Ago HITS-CLP, in that ribosomes are used as an RNA protective agent in a controlled
RNase reaction. Monosomes are then isolated and the associated small RNA
fragments are used for deep sequencing library generation.
Another unanswered question regarding the concordant relationship between miRNA-
mediated reductions in mRNA abundance and translation surrounds the nature of the
functional linkage between the two regulatory fates. Two separate models can account
for this relationship. One possibility is that miRNAs impose an initial translational
repression that leads to deadenylation and subsequent degradation and thus accounting
for the high correlation between these two parameters. On the other hand, miRNA
induced changes in mRNA stability and translation rate may be mechanistically
distinct but initiated by the same RISC cofactors. The situation is even more tangled
when considering that even if the second model were correct, reduced translation
increases degradation and vice versa as translation and degradation are inexorably
linked in a miRNA independent manner. We know that the correlation we reported
between reduced translation and mRNA abundance is much stronger than for non-
targets, and is thus primarily miRNA dependent. However the linkage serves to
complicate attempts to discern between the two models.
151
In part, the question is best framed as one of miRNA induced deadenylation and
translational repression. Recent work from Chen and colleagues carefully measured
the kinetics of miRNA induced deadenylation and degradation[189]. They found that
miRNA specific degradation requires the CCR4/CAF1 deadenylase complex and is
faster than nonsense mediated decay and ARE mediated decay suggesting that miRNA
mediated decay is an intrinsic property of functional RISC[189]. Importantly, the
authors argue that this directed deadenylation is not driven by specific recruitment of
the deadenylating and decapping complexes as there is a notable lack of protein-
protein interaction data between RISC complexes and deadenylation
machinery[191,264,318,319]. Instead the argument is made, based on two separate
studies that the RISC cofactor GW182 interacts with Poly A binding protein (PABP)
to disrupt and inhibit mRNA circularization which has the effect of increasing a
targeted mRNAs susceptibility to engagement with the deadenylation
complex[184,189].
Two recent studies measuring miRNA specific translation repression and
deadenylation found contrasting results[184,320]. In a cell free in vitro system Fabien
et al found that an initial translation repression occurs within 15 minutes of an mRNAs
exposure to a targeting miRNA followed by a slow increase in deadenylation leading
to decay [184]. The authors also found compelling evidence for a dependence on
GW182 and PABP for efficient repression. This study provides strong biochemical
support for the sequential model of miRNA mediated translational inhibition and
mRNA decay. However, the contrasting work from Beilharz et al reports that GW182
dependant polyA tail shortening induced by miRNA targeting precedes translational
repression and can occur in the absence of active translation albeit less
efficiently[320]. It is unclear why these two groups came to such conflicting
conclusions, and this chicken or the egg issue will remain unresolved until more data
is acquired. One possibility for the confusion is that perhaps miRNA targeted mRNAs
can re-enter the translation pool if they are not rapidly destroyed, thus masking
measurable effects on translation in one system versus the other. It is clear however,
152
that miRNAs can directly induce translational repression that is independent from
deadenylation (decay) of their targets and vice versa.
153
Appendix
Text S1. miRNA-effector Complexes Appear to Nonspecifically Bind
Streptavidin Coated Dynal Beads.
One explanation for the high correlation (r=0.6) we observed between the enrichment
profiles of the Ago IPs and negative controls is that the “background” signature of the
negative control IPs was in part driven by non-specific binding of miRNA effector
proteins, such as the Agos, to the beads in the absence of an Ago specific antibody.
We reasoned that if the beads were nonspecifically enriching miRNA effector
proteins, there would be enrichment for mRNAs that are recruited to Agos by miR-
124 in miR-124 negative control IPs compared to negative control IPs from mock
transfected cells.
To test this hypothesis, we determined if mRNAs most enriched in miR-124 negative
control IPs compared to negative control IPs from mock transfected cells were more
likely to contain seed matches to miR-124 in their 3‟UTRs than expected by chance.
First, we tested if any RNAs were specifically recruited to the beads by miR-124 using
SAM to compare negative control IPs from mock versus miR-124 transfected cells.
Only two of the three samples from mock transfected cells yielded microarray data of
high enough quality for use in this analysis. No mRNAs were significantly enriched in
the miR-124 negative control IPs at a 1%, 10%, or 50% FDR. However, hierarchical
cluster analysis of the 500 most enriched sequences from SAM analysis (without
recourse to statistical significance) segregated the miR-124 negative control IPs from
the control IPs with mock transfected cells (Figure S1A). This population was slightly
enriched for mRNAs that contained miR-124 seed matches in their 3‟-UTRs (Figure
S1B). These results suggest that the enrichment profiles from the negative control IPs
are in part, generated from binding of miRNA effector proteins to the beads alone. The
nonspecific binding is relatively weak as evidenced by the low amount of RNA and
154
protein isolated from the beads (10x less than Ago IPs) and the fact that no individual
mRNAs were enriched with high-statistical confidence in miR-124 negative control
IPs compared to negative control IPs from mock transfected cells. Perhaps recruitment
of miRNA effector proteins to the beads is driven by the association of Ago proteins
with chaperones, such as Hsp90 [292,319, unpublished data].
155
Text S2. Enrichment of Seed Matches to Highly-expressed miRNAs in
Ago IPs from Mock Transfected Cells.
To test whether association with Ago is largely a reflection of the relative occupancy
of each mRNA with the suite of endogenously expressed miRNAs in HEK293T cells,
we first determined if there were sequence motifs in mRNA untranslated regions that
significantly correlated with Ago IP enrichment, and if so, if these motifs
corresponded to known miRNA seed matches. Such sequence motifs might be
identifiable if one or a few highly expressed miRNAs dominated the IP enrichment.
To search for possible sequence motifs, we used the motif prediction algorithm
FIRE[321].Two motifs, located in 3‟-UTRs, significantly correlated with Ago IP
enrichment; these motifs overlapped and corresponded to seed match sequences of the
very abundant miR-17-5p/20/92/106/591.d and miR-19 families of miRNAs. mRNAs
with seed matches to these miRNAs in good sequence contexts (TargetScan 4.2,
context score < -0.3) were more likely to be enriched in Ago IPs than mRNAs with
seed matches in poor sequence contexts (context score > -0.1) (for miR-17: 2.9 mean
fold-enrichment for mRNAs in good context versus 0.91 mean fold-enrichment for
mRNAs in poor context, p < 10-12
, one-sided Kolmogorov-Smirnov test)[88]. This
result suggests that these abundant miRNAs contribute significantly to recruitment to
RISC and Ago IP enrichment. For a majority of expressed miRNAs, however, we did
not find that predicted targets with seed matches in a good context were more likely to
be enriched than mRNAs with seed matches in a poor context. This negative finding
may result because mRNA enrichment in Ago IPs arises from multiple miRNAs so
that the enrichment signal for any specific miRNA is diluted.
156
Text S3. Relationship Between Ribosome Occupancy in Mock-
Transfected Cells and the Change in Ribosome Occupancy Following
Transfection of miR-124.
Twenty-one miR-124 Ago IP targets appeared to increase at least 20% in ribosome
occupancy due to the presence of miR-124. Strikingly, a large fraction of mRNAs that
increased at least 20% in ribosome occupancy encode transcription factors (11/21, p <
10-4
).
We asked if miR-124 targets that increase at least 20% in ribosome occupancy behave
anomalously in other ways, which might provide some insight into their apparent
increase in occupancy. We compared mRNAs that increase at least 20% in ribosome
occupancy to the other miR-124 Ago IP targets with regards to several factors. While
there was no difference in terms of the fraction of each group that contained seed
matches to miR-124 or their ribosome density, targets that increased in ribosome
occupancy were less likely to decrease in abundance (13% vs 33%) and had much
lower ribosome occupancy in untreated cells than the other miR-124 targets (49% vs
87%).
The fact that the mRNA targets that appeared to increase in ribosome occupancy
tended to have low occupancy in mock transfected cells prompted us to ask if this was
a general phenomenon. We found that across all mRNAs there was a strong negative
correlation between the miR-124-induced change in ribosome occupancy of a gene‟s
mRNAs and its ribosome occupancy in mock transfected cells (Spearman rank
correlation = -0.78) (Figure S4B). This relationship could, in principle, be due to
errors in our microarray measurements, which would tend to have a larger effect on
the estimated ribosome occupancy as ribosome occupancy decreases. If this were the
case we would expect significant correlations between the change in ribosome
occupancy and ribosome occupancy between biological replicate experiments.
However, the relationship between the change in ribosome occupancy as a function of
157
ribosome occupancy is much weaker between biological replicates (r = -0.07, 0.24 and
0.02 for mock replicates and -0.11 for miR-124 replicate) than between mock and
miR-124 experiments (r = -0.55, -0.45, -0.66, -0.60, -0.74 and -0.77 between mock
and miR-124 experiments), which suggests it may actually be due to bona fide
biological differences between mock and miR-124 transfected cells. Indeed, mRNAs
that have low initial ribosome occupancy have more potential to increase in ribosome
occupancy between experimental conditions (Figure S4B, gray curve). For instance, a
gene whose mRNAs are 10% occupied can increase up to 10-fold, while a gene whose
mRNAs are 90% occupied increase no more than 1.1 fold.
While the origin of the relationship between changes in ribosome occupancy and
starting ribosome occupancy might be biological, we still wished to investigate the
effect of this potential artifact on our results. We attempted to remove the relationship
between changes in ribosome occupancy and starting ribosome occupancy by fitting a
locally weighted scatterplot smoothing (Lowess) function to the scatterplot between
mock ribosome occupancy and change in ribosome occupancy and subtracting the
fitted values (Figure S4B – green circles)[322]. As expected, after this transformation,
there was no longer a correlation between ribosome occupancy in mock experiments
and the miR-124-induced change in ribosome occupancy (Figure S4C). The overall
effects on ribosome occupancy and translation were very similar between the
renormalized data and raw data (mean difference in occupancy between targets and
nontargets with Lowess normalization = 4%, and without Lowess normalization = 4%)
and the correlation between changes in translation and abundance for miR-124 Ago IP
targets were very similar (Lowess-normalized = 0.59, without Lowess normalization =
0.60) (Figure S4D and S4E). However, the group of mRNAs that, prior to this
transformation, had appeared to increase in translation in the miR-124 transfected cells
no longer appeared to do so after the Lowess normalization. Following the Lowess
normalization, the IP targets that previously appeared to increase in occupancy by at
least 20% had, on average, no change in occupancy, there were no IP targets with >
13% apparent increase in occupancy, and there was no functional bias among mRNAs
that appeared to increase in occupancy.
158
Text S4. Evaluation of the Significance of the Correlation between
Changes in mRNA Abundance and Translation of miR-124 Ago IP
targets Following Transfection with miR-124.
We evaluate the significance of the correlation between expression changes and
translation changes in several ways. First, we asked from a purely statistical
perspective, what was the likelihood of observing the correlation by chance, given the
values we had. To test this, we calculated the correlation between expression and
translation after resampling the expression data. We did this 100,000 times.
According the normal distribution function, the likelihood of getting a correlation of
0.60 by chance is 10-45
(Figure S5A). Second, we tested if the correlation persisted in
nontarget mRNAs. We found that the Pearson correlation between expression
changes and translation changes for mRNAs that are not IP targets was 0.11. We
ranked mRNAs by IP enrichment and plotted the correlation between changes in
expression and translation as a moving window, and found that the correlation
monotonically falls off to baseline level after the several hundred most enriched
mRNAs, indicating the correlation is specific to mRNAs most enriched in Ago IPs due
to the presence of miR-124 (Figure S5B). Third, we tested if the correlation was
specific to miR-124 targets, or if the observed relationship between mRNA abundance
and translation was a general phenomenon. It is well documented that changes in
abundance and translation tend to correlate and so it may not be specific to miR-124
response, but rather reflect a common relationship between effects on translation and
mRNA abundance in this system
[215,231,232,233,234,294,295,296,298,299,300,301,302]. To estimate the difference
in the strength of the correlation between translation and mRNA abundance we chose
nontarget mRNAs that decreased at the mRNA level similarly to miR-124 target
mRNAs. We had to focus on miR-124 targets that changed less than 40% in mRNA
abundance as there were not any nontargets that decreased more than 40%. We
compared the miR-124 IP targets that decreased less than 40% in mRNA abundance to
10,000 random sets of nontargets of the same size with similar distributions of
expression changes (t-test, p > 0.001). The average correlation for the 10,000 sets of
159
nontargets was 0.14, whereas the correlation between translation and expression for
miR-124 IP targets changing in mRNA abundance <40% was 0.30 (1/10,000
permuted nontargets sets had a correlation greater than the IP targets – we estimated
the actual p-value using normal distribution function to be < 10-5
) (Figure S5C). We
also observed a modest, but significant, positive correlation between changes in
expression and translation for mRNAs whose abundance increases (0.19 for 662
mRNAs that increase at least 25%.) These data suggest changes in abundance and
translation are generally correlated under these growth conditions, but tend to be more
so for miR-124 targets.
160
References
1. Ghaemmaghami S, Huh WK, Bower K, Howson RW, Belle A, et al. (2003) Global
analysis of protein expression in yeast. Nature 425: 737-741.
2. Gry M, Rimini R, Stromberg S, Asplund A, Ponten F, et al. (2009) Correlations
between RNA and protein expression profiles in 23 human cell lines. BMC
Genomics 10: 365.
3. Gygi SP, Rochon Y, Franza BR, Aebersold R (1999) Correlation between protein
and mRNA abundance in yeast. Mol Cell Biol 19: 1720-1730.
4. Kuhn KM, DeRisi JL, Brown PO, Sarnow P (2001) Global and specific
translational regulation in the genomic response of Saccharomyces cerevisiae
to a rapid transfer from a fermentable to a nonfermentable carbon source. Mol
Cell Biol 21: 916-927.
5. Lu P, Vogel C, Wang R, Yao X, Marcotte EM (2007) Absolute protein expression
profiling estimates the relative contributions of transcriptional and translational
regulation. Nat Biotechnol 25: 117-124.
6. Newman JR, Ghaemmaghami S, Ihmels J, Breslow DK, Noble M, et al. (2006)
Single-cell proteomic analysis of S. cerevisiae reveals the architecture of
biological noise. Nature 441: 840-846.
7. Shankavaram UT, Reinhold WC, Nishizuka S, Major S, Morita D, et al. (2007)
Transcript and protein expression profiles of the NCI-60 cancer cell panel: an
integromic microarray study. Mol Cancer Ther 6: 820-832.
8. Wightman B, Ha I, Ruvkun G (1993) Posttranscriptional regulation of the
heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C.
elegans. Cell 75: 855-862.
9. Lee RC, Feinbaum RL, Ambros V (1993) The C. elegans heterochronic gene lin-4
encodes small RNAs with antisense complementarity to lin-14. Cell 75: 843-
854.
161
10. Lau NC, Lim LP, Weinstein EG, Bartel DP (2001) An abundant class of tiny
RNAs with probable regulatory roles in Caenorhabditis elegans. Science 294:
858-862.
11. Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T (2001) Identification of
novel genes coding for small expressed RNAs. Science 294: 853-858.
12. Lee RC, Ambros V (2001) An extensive class of small RNAs in Caenorhabditis
elegans. Science 294: 862-864.
13. van der Krol AR, Mur LA, de Lange P, Mol JN, Stuitje AR (1990) Inhibition of
flower pigmentation by antisense CHS genes: promoter and minimal sequence
requirements for the antisense effect. Plant Mol Biol 14: 457-466.
14. Napoli C, Lemieux C, Jorgensen R (1990) Introduction of a Chimeric Chalcone
Synthase Gene into Petunia Results in Reversible Co-Suppression of
Homologous Genes in trans. Plant Cell 2: 279-289.
15. Anandalakshmi R, Pruss GJ, Ge X, Marathe R, Mallory AC, et al. (1998) A viral
suppressor of gene silencing in plants. Proc Natl Acad Sci U S A 95: 13079-
13084.
16. Ruiz MT, Voinnet O, Baulcombe DC (1998) Initiation and maintenance of virus-
induced gene silencing. Plant Cell 10: 937-946.
17. Angell SM, Baulcombe DC (1997) Consistent gene silencing in transgenic plants
expressing a replicating potato virus X RNA. Embo J 16: 3675-3684.
18. Dougherty WG, Lindbo JA, Smith HA, Parks TD, Swaney S, et al. (1994) RNA-
mediated virus resistance in transgenic plants: exploitation of a cellular
pathway possibly involved in RNA degradation. Mol Plant Microbe Interact 7:
544-552.
19. Kumagai MH, Donson J, della-Cioppa G, Harvey D, Hanley K, et al. (1995)
Cytoplasmic inhibition of carotenoid biosynthesis with virus-derived RNA.
Proc Natl Acad Sci U S A 92: 1679-1683.
20. Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, et al. (1998) Potent and
specific genetic interference by double-stranded RNA in Caenorhabditis
elegans. Nature 391: 806-811.
162
21. Carrington JC, Ambros V (2003) Role of microRNAs in plant and animal
development. Science 301: 336-338.
22. Provost P, Silverstein RA, Dishart D, Walfridsson J, Djupedal I, et al. (2002)
Dicer is required for chromosome segregation and gene silencing in fission
yeast cells. Proc Natl Acad Sci U S A 99: 16648-16653.
23. Verdel A, Jia S, Gerber S, Sugiyama T, Gygi S, et al. (2004) RNAi-mediated
targeting of heterochromatin by the RITS complex. Science 303: 672-676.
24. Xie Z, Johansen LK, Gustafson AM, Kasschau KD, Lellis AD, et al. (2004)
Genetic and functional diversification of small RNA pathways in plants. PLoS
Biol 2: E104.
25. Ambros V (2004) The functions of animal microRNAs. Nature 431: 350-355.
26. Bagga S, Bracht J, Hunter S, Massirer K, Holtz J, et al. (2005) Regulation by let-7
and lin-4 miRNAs results in target mRNA degradation. Cell 122: 553-563.
27. Filipowicz W, Bhattacharyya SN, Sonenberg N (2008) Mechanisms of post-
transcriptional regulation by microRNAs: are the answers in sight? Nat Rev
Genet 9: 102-114.
28. Humphreys DT, Westman BJ, Martin DI, Preiss T (2005) MicroRNAs control
translation initiation by inhibiting eukaryotic initiation factor 4E/cap and
poly(A) tail function. Proc Natl Acad Sci U S A 102: 16961-16966.
29. Lim LP, Lau NC, Garrett-Engele P, Grimson A, Schelter JM, et al. (2005)
Microarray analysis shows that some microRNAs downregulate large numbers
of target mRNAs. Nature 433: 769-773.
30. Olsen PH, Ambros V (1999) The lin-4 regulatory RNA controls developmental
timing in Caenorhabditis elegans by blocking LIN-14 protein synthesis after
the initiation of translation. Dev Biol 216: 671-680.
31. Valencia-Sanchez MA, Liu J, Hannon GJ, Parker R (2006) Control of translation
and mRNA degradation by miRNAs and siRNAs. Genes Dev 20: 515-524.
32. Wu L, Belasco JG (2008) Let me count the ways: mechanisms of gene regulation
by miRNAs and siRNAs. Mol Cell 29: 1-7.
33. Wu L, Fan J, Belasco JG (2006) MicroRNAs direct rapid deadenylation of mRNA.
Proc Natl Acad Sci U S A 103: 4034-4039.
163
34. Drinnenberg IA, Weinberg DE, Xie KT, Mower JP, Wolfe KH, et al. (2009) RNAi
in Budding Yeast. Science.
35. Hannon GJ (2002) RNA interference. Nature 418: 244-251.
36. Bernstein E, Caudy AA, Hammond SM, Hannon GJ (2001) Role for a bidentate
ribonuclease in the initiation step of RNA interference. Nature 409: 363-366.
37. Hutvagner G, McLachlan J, Pasquinelli AE, Balint E, Tuschl T, et al. (2001) A
cellular function for the RNA-interference enzyme Dicer in the maturation of
the let-7 small temporal RNA. Science 293: 834-838.
38. Ketting RF, Fischer SE, Bernstein E, Sijen T, Hannon GJ, et al. (2001) Dicer
functions in RNA interference and in synthesis of small RNA involved in
developmental timing in C. elegans. Genes Dev 15: 2654-2659.
39. Golden TA, Schauer SE, Lang JD, Pien S, Mushegian AR, et al. (2002) SHORT
INTEGUMENTS1/SUSPENSOR1/CARPEL FACTORY, a Dicer homolog, is
a maternal effect gene required for embryo development in Arabidopsis. Plant
Physiol 130: 808-822.
40. Hutvagner G, Zamore PD (2002) A microRNA in a multiple-turnover RNAi
enzyme complex. Science 297: 2056-2060.
41. Provost P, Dishart D, Doucet J, Frendewey D, Samuelsson B, et al. (2002)
Ribonuclease activity and RNA binding of recombinant human Dicer. Embo J
21: 5864-5874.
42. Zhang H, Kolb FA, Brondani V, Billy E, Filipowicz W (2002) Human Dicer
preferentially cleaves dsRNAs at their termini without a requirement for ATP.
Embo J 21: 5875-5885.
43. Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, et al. (2001) Duplexes
of 21-nucleotide RNAs mediate RNA interference in cultured mammalian
cells. Nature 411: 494-498.
44. Elbashir SM, Lendeckel W, Tuschl T (2001) RNA interference is mediated by 21-
and 22-nucleotide RNAs. Genes Dev 15: 188-200.
45. Elbashir SM, Martinez J, Patkaniowska A, Lendeckel W, Tuschl T (2001)
Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila
melanogaster embryo lysate. Embo J 20: 6877-6888.
164
46. Schwarz DS, Hutvagner G, Haley B, Zamore PD (2002) Evidence that siRNAs
function as guides, not primers, in the Drosophila and human RNAi pathways.
Mol Cell 10: 537-548.
47. Hutvagner G, Zamore PD (2002) RNAi: nature abhors a double-strand. Curr Opin
Genet Dev 12: 225-232.
48. Martinez J, Patkaniowska A, Urlaub H, Luhrmann R, Tuschl T (2002) Single-
stranded antisense siRNAs guide target RNA cleavage in RNAi. Cell 110: 563-
574.
49. Hammond SM, Boettcher S, Caudy AA, Kobayashi R, Hannon GJ (2001)
Argonaute2, a link between genetic and biochemical analyses of RNAi.
Science 293: 1146-1150.
50. Schwarz DS, Hutvagner G, Du T, Xu Z, Aronin N, et al. (2003) Asymmetry in the
assembly of the RNAi enzyme complex. Cell 115: 199-208.
51. Song JJ, Liu J, Tolia NH, Schneiderman J, Smith SK, et al. (2003) The crystal
structure of the Argonaute2 PAZ domain reveals an RNA binding motif in
RNAi effector complexes. Nat Struct Biol 10: 1026-1032.
52. Carmell MA, Xuan Z, Zhang MQ, Hannon GJ (2002) The Argonaute family:
tentacles that reach into RNAi, developmental control, stem cell maintenance,
and tumorigenesis. Genes Dev 16: 2733-2742.
53. Hutvagner G, Simard MJ, Mello CC, Zamore PD (2004) Sequence-specific
inhibition of small RNA function. PLoS Biol 2: E98.
54. Liu J, Carmell MA, Rivas FV, Marsden CG, Thomson JM, et al. (2004)
Argonaute2 Is the Catalytic Engine of Mammalian RNAi. Science.
55. Behm-Ansmant I, Rehwinkel J, Doerks T, Stark A, Bork P, et al. (2006) mRNA
degradation by miRNAs and GW182 requires both CCR4:NOT deadenylase
and DCP1:DCP2 decapping complexes. Genes Dev 20: 1885-1898.
56. Rehwinkel J, Behm-Ansmant I, Gatfield D, Izaurralde E (2005) A crucial role for
GW182 and the DCP1:DCP2 decapping complex in miRNA-mediated gene
silencing. Rna 11: 1640-1647.
57. Eulalio A, Huntzinger E, Nishihara T, Rehwinkel J, Fauser M, et al. (2009)
Deadenylation is a widespread effect of miRNA regulation. Rna 15: 21-32.
165
58. Doench JG, Petersen CP, Sharp PA (2003) siRNAs can function as miRNAs.
Genes Dev 17: 438-442.
59. Bartel DP (2004) MicroRNAs: genomics, biogenesis, mechanism, and function.
Cell 116: 281-297.
60. Doench JG, Sharp PA (2004) Specificity of microRNA target selection in
translational repression. Genes Dev 18: 504-511.
61. Wakiyama M, Takimoto K, Ohara O, Yokoyama S (2007) Let-7 microRNA-
mediated mRNA deadenylation and translational repression in a mammalian
cell-free system. Genes Dev 21: 1857-1862.
62. Zeng Y, Yi R, Cullen BR (2003) MicroRNAs and small interfering RNAs can
inhibit mRNA expression by similar mechanisms. Proc Natl Acad Sci U S A
100: 9779-9784.
63. Meister G, Landthaler M, Patkaniowska A, Dorsett Y, Teng G, et al. (2004)
Human Argonaute2 mediates RNA cleavage targeted by miRNAs and siRNAs.
Mol Cell 15: 185-197.
64. Carthew RW, Sontheimer EJ (2009) Origins and Mechanisms of miRNAs and
siRNAs. Cell 136: 642-655.
65. Motamedi MR, Verdel A, Colmenares SU, Gerber SA, Gygi SP, et al. (2004) Two
RNAi complexes, RITS and RDRC, physically interact and localize to
noncoding centromeric RNAs. Cell 119: 789-802.
66. Noma K, Sugiyama T, Cam H, Verdel A, Zofall M, et al. (2004) RITS acts in cis
to promote RNA interference-mediated transcriptional and post-transcriptional
silencing. Nat Genet 36: 1174-1180.
67. Ekwall K (2004) The RITS complex-A direct link between small RNA and
heterochromatin. Mol Cell 13: 304-305.
68. Bagasra O, Prilliman KR (2004) RNA interference: the molecular immune system.
J Mol Histol 35: 545-553.
69. Okamura K, Lai EC (2008) Endogenous small interfering RNAs in animals. Nat
Rev Mol Cell Biol 9: 673-678.
70. Nilsen TW (2008) Endo-siRNAs: yet another layer of complexity in RNA
silencing. Nat Struct Mol Biol 15: 546-548.
166
71. Ghildiyal M, Seitz H, Horwich MD, Li C, Du T, et al. (2008) Endogenous siRNAs
derived from transposons and mRNAs in Drosophila somatic cells. Science
320: 1077-1081.
72. Lee RC, Hammell CM, Ambros V (2006) Interacting endogenous and exogenous
RNAi pathways in Caenorhabditis elegans. Rna 12: 589-597.
73. Chung WJ, Okamura K, Martin R, Lai EC (2008) Endogenous RNA interference
provides a somatic defense against Drosophila transposons. Curr Biol 18: 795-
802.
74. Deddouche S, Matt N, Budd A, Mueller S, Kemp C, et al. (2008) The DExD/H-
box helicase Dicer-2 mediates the induction of antiviral activity in drosophila.
Nat Immunol 9: 1425-1432.
75. Smardon A, Spoerke JM, Stacey SC, Klein ME, Mackin N, et al. (2000) EGO-1 is
related to RNA-directed RNA polymerase and functions in germ-line
development and RNA interference in C. elegans. Curr Biol 10: 169-178.
76. Sijen T, Fleenor J, Simmer F, Thijssen KL, Parrish S, et al. (2001) On the role of
RNA amplification in dsRNA-triggered gene silencing. Cell 107: 465-476.
77. Alder MN, Dames S, Gaudet J, Mango SE (2003) Gene silencing in
Caenorhabditis elegans by transitive RNA interference. Rna 9: 25-32.
78. Lipardi C, Paterson BM (2009) Identification of an RNA-dependent RNA
polymerase in Drosophila involved in RNAi and transposon suppression. Proc
Natl Acad Sci U S A 106: 15645-15650.
79. Stark JJ, Dillman RO, Schulof R, Wiemann MC, Barth NM, et al. (1998)
Interferon-alpha and chemohormonal therapy for patients with advanced
melanoma: final results of a phase I-II study of the Cancer Biotherapy
Research Group and the Mid-Atlantic Oncology Program. Cancer 82: 1677-
1681.
80. Hannon GJ, Conklin DS (2004) RNA interference by short hairpin RNAs
expressed in vertebrate cells. Methods Mol Biol 257: 255-266.
81. Myers JW, Jones JT, Meyer T, Ferrell JE, Jr. (2003) Recombinant Dicer efficiently
converts large dsRNAs into siRNAs suitable for gene silencing. Nat
Biotechnol 21: 324-328.
167
82. Paddison PJ, Caudy AA, Sachidanandam R, Hannon GJ (2004) Short hairpin
activated gene silencing in mammalian cells. Methods Mol Biol 265: 85-100.
83. Lewis BP, Burge CB, Bartel DP (2005) Conserved seed pairing, often flanked by
adenosines, indicates that thousands of human genes are microRNA targets.
Cell 120: 15-20.
84. Friedman RC, Farh KK, Burge CB, Bartel D (2008) Most mammalian mRNAs are
conserved targets of microRNAs. Genome Res.
85. Grimson A, Srivastava M, Fahey B, Woodcroft BJ, Chiang HR, et al. (2008) Early
origins and evolution of microRNAs and Piwi-interacting RNAs in animals.
Nature 455: 1193-1197.
86. Farh KK, Grimson A, Jan C, Lewis BP, Johnston WK, et al. (2005) The
widespread impact of mammalian MicroRNAs on mRNA repression and
evolution. Science 310: 1817-1821.
87. Bartel DP (2009) MicroRNAs: target recognition and regulatory functions. Cell
136: 215-233.
88. Grimson A, Farh KK, Johnston WK, Garrett-Engele P, Lim LP, et al. (2007)
MicroRNA targeting specificity in mammals: determinants beyond seed
pairing. Mol Cell 27: 91-105.
89. Lewis BP, Shih IH, Jones-Rhoades MW, Bartel DP, Burge CB (2003) Prediction
of mammalian microRNA targets. Cell 115: 787-798.
90. Baek D, Villen J, Shin C, Camargo FD, Gygi SP, et al. (2008) The impact of
microRNAs on protein output. Nature 455: 64-71.
91. Selbach M, Schwanhausser B, Thierfelder N, Fang Z, Khanin R, et al. (2008)
Widespread changes in protein synthesis induced by microRNAs. Nature 455:
58-63.
92. Abbott AL, Alvarez-Saavedra E, Miska EA, Lau NC, Bartel DP, et al. (2005) The
let-7 MicroRNA family members mir-48, mir-84, and mir-241 function
together to regulate developmental timing in Caenorhabditis elegans. Dev Cell
9: 403-414.
93. Alvarez-Garcia I, Miska EA (2005) MicroRNA functions in animal development
and human disease. Development 132: 4653-4662.
168
94. Hatfield SD, Shcherbata HR, Fischer KA, Nakahara K, Carthew RW, et al. (2005)
Stem cell division is regulated by the microRNA pathway. Nature 435: 974-
978.
95. Kloosterman WP, Plasterk RH (2006) The diverse functions of microRNAs in
animal development and disease. Dev Cell 11: 441-450.
96. Linsley PS, Schelter J, Burchard J, Kibukawa M, Martin MM, et al. (2007)
Transcripts targeted by the microRNA-16 family cooperatively regulate cell
cycle progression. Mol Cell Biol 27: 2240-2252.
97. Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J, et al. (2005) MicroRNA
expression profiles classify human cancers. Nature 435: 834-838.
98. Reinhart BJ, Slack FJ, Basson M, Pasquinelli AE, Bettinger JC, et al. (2000) The
21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis
elegans. Nature 403: 901-906.
99. Jackson RJ, Standart N (2007) How do microRNAs regulate gene expression? Sci
STKE 2007: re1.
100. Esau C, Davis S, Murray SF, Yu XX, Pandey SK, et al. (2006) miR-122
regulation of lipid metabolism revealed by in vivo antisense targeting. Cell
Metab 3: 87-98.
101. Eulalio A, Rehwinkel J, Stricker M, Huntzinger E, Yang SF, et al. (2007) Target-
specific requirements for enhancers of decapping in miRNA-mediated gene
silencing. Genes Dev 21: 2558-2570.
102. Giraldez AJ, Mishima Y, Rihel J, Grocock RJ, Van Dongen S, et al. (2006)
Zebrafish MiR-430 promotes deadenylation and clearance of maternal
mRNAs. Science 312: 75-79.
103. Krutzfeldt J, Rajewsky N, Braich R, Rajeev KG, Tuschl T, et al. (2005) Silencing
of microRNAs in vivo with 'antagomirs'. Nature 438: 685-689.
104. Rehwinkel J, Natalin P, Stark A, Brennecke J, Cohen SM, et al. (2006) Genome-
wide analysis of mRNAs regulated by Drosha and Argonaute proteins in
Drosophila melanogaster. Mol Cell Biol 26: 2965-2975.
169
105. Schmitter D, Filkowski J, Sewer A, Pillai RS, Oakeley EJ, et al. (2006) Effects of
Dicer and Argonaute down-regulation on mRNA levels in human HEK293
cells. Nucleic Acids Res 34: 4801-4815.
106. Wu L, Belasco JG (2005) Micro-RNA regulation of the mammalian lin-28 gene
during neuronal differentiation of embryonal carcinoma cells. Mol Cell Biol
25: 9198-9208.
107. Nilsen TW (2007) Mechanisms of microRNA-mediated gene regulation in
animal cells. Trends Genet 23: 243-249.
108. Pillai RS, Bhattacharyya SN, Artus CG, Zoller T, Cougot N, et al. (2005)
Inhibition of translational initiation by Let-7 MicroRNA in human cells.
Science 309: 1573-1576.
109. Yekta S, Shih IH, Bartel DP (2004) MicroRNA-directed cleavage of HOXB8
mRNA. Science 304: 594-596.
110. Kozak M (2008) Faulty old ideas about translational regulation paved the way for
current confusion about how microRNAs function. Gene 423: 108-115.
111. Nissan T, Parker R (2008) Computational analysis of miRNA-mediated
repression of translation: implications for models of translation initiation
inhibition. Rna 14: 1480-1491.
112. Shyu AB, Wilkinson MF, van Hoof A (2008) Messenger RNA regulation: to
translate or to degrade. Embo J 27: 471-481.
113. Aravin AA, Hannon GJ, Brennecke J (2007) The Piwi-piRNA pathway provides
an adaptive defense in the transposon arms race. Science 318: 761-764.
114. Song JJ, Smith SK, Hannon GJ, Joshua-Tor L (2004) Crystal Structure of
Argonaute and Its Implications for RISC Slicer Activity. Science.
115. Yan KS, Yan S, Farooq A, Han A, Zeng L, et al. (2003) Structure and conserved
RNA binding of the PAZ domain. Nature 426: 468-474.
116. Lingel A, Simon B, Izaurralde E, Sattler M (2003) Structure and nucleic-acid
binding of the Drosophila Argonaute 2 PAZ domain. Nature 426: 465-469.
117. Ma JB, Ye K, Patel DJ (2004) Structural basis for overhang-specific small
interfering RNA recognition by the PAZ domain. Nature 429: 318-322.
170
118. Macrae IJ, Zhou K, Li F, Repic A, Brooks AN, et al. (2006) Structural basis for
double-stranded RNA processing by Dicer. Science 311: 195-198.
119. MacRae IJ, Zhou K, Doudna JA (2007) Structural determinants of RNA
recognition and cleavage by Dicer. Nat Struct Mol Biol 14: 934-940.
120. Lund E, Guttinger S, Calado A, Dahlberg JE, Kutay U (2004) Nuclear export of
microRNA precursors. Science 303: 95-98.
121. Yi R, Doehle BP, Qin Y, Macara IG, Cullen BR (2005) Overexpression of
exportin 5 enhances RNA interference mediated by short hairpin RNAs and
microRNAs. Rna 11: 220-226.
122. Zeng Y, Yi R, Cullen BR (2005) Recognition and cleavage of primary
microRNA precursors by the nuclear processing enzyme Drosha. Embo J 24:
138-148.
123. Bohnsack MT, Czaplinski K, Gorlich D (2004) Exportin 5 is a RanGTP-
dependent dsRNA-binding protein that mediates nuclear export of pre-
miRNAs. Rna 10: 185-191.
124. Lee Y, Ahn C, Han J, Choi H, Kim J, et al. (2003) The nuclear RNase III Drosha
initiates microRNA processing. Nature 425: 415-419.
125. Ambros V (2001) microRNAs: tiny regulators with great potential. Cell 107:
823-826.
126. Murchison EP, Hannon GJ (2004) miRNAs on the move: miRNA biogenesis and
the RNAi machinery. Curr Opin Cell Biol 16: 223-229.
127. Ying SY, Lin SL (2004) Intron-derived microRNAs--fine tuning of gene
functions. Gene 342: 25-28.
128. Chan SP, Slack FJ (2007) And now introducing mammalian mirtrons. Dev Cell
13: 605-607.
129. Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC (2007) Mammalian mirtron
genes. Mol Cell 28: 328-336.
130. Okamura K, Hagen JW, Duan H, Tyler DM, Lai EC (2007) The mirtron pathway
generates microRNA-class regulatory RNAs in Drosophila. Cell 130: 89-100.
131. Ruby JG, Jan CH, Bartel DP (2007) Intronic microRNA precursors that bypass
Drosha processing. Nature 448: 83-86.
171
132. Kim VN (2004) MicroRNA precursors in motion: exportin-5 mediates their
nuclear export. Trends Cell Biol 14: 156-159.
133. Lee YS, Nakahara K, Pham JW, Kim K, He Z, et al. (2004) Distinct roles for
Drosophila Dicer-1 and Dicer-2 in the siRNA/miRNA silencing pathways. Cell
117: 69-81.
134. Pham JW, Pellino JL, Lee YS, Carthew RW, Sontheimer EJ (2004) A Dicer-2-
dependent 80s complex cleaves targeted mRNAs during RNAi in Drosophila.
Cell 117: 83-94.
135. Nykanen A, Haley B, Zamore PD (2001) ATP requirements and small interfering
RNA structure in the RNA interference pathway. Cell 107: 309-321.
136. Maniataki E, Mourelatos Z (2005) A human, ATP-independent, RISC assembly
machine fueled by pre-miRNA. Genes Dev 19: 2979-2990.
137. Gregory RI, Chendrimada TP, Cooch N, Shiekhattar R (2005) Human RISC
couples microRNA biogenesis and posttranscriptional gene silencing. Cell 123:
631-640.
138. Chendrimada TP, Gregory RI, Kumaraswamy E, Norman J, Cooch N, et al.
(2005) TRBP recruits the Dicer complex to Ago2 for microRNA processing
and gene silencing. Nature 436: 740-744.
139. Myers JW, Ferrell JE (2005) Silencing gene expression with Dicer-generated
siRNA pools. Methods Mol Biol 309: 93-196.
140. Jaskiewicz L, Filipowicz W (2008) Role of Dicer in posttranscriptional RNA
silencing. Curr Top Microbiol Immunol 320: 77-97.
141. Park W, Li J, Song R, Messing J, Chen X (2002) CARPEL FACTORY, a Dicer
homolog, and HEN1, a novel protein, act in microRNA metabolism in
Arabidopsis thaliana. Curr Biol 12: 1484-1495.
142. Tabara H, Yigit E, Siomi H, Mello CC (2002) The dsRNA binding protein RDE-
4 interacts with RDE-1, DCR-1, and a DExH-box helicase to direct RNAi in C.
elegans. Cell 109: 861-871.
143. Liu Q, Rand TA, Kalidas S, Du F, Kim HE, et al. (2003) R2D2, a bridge between
the initiation and effector steps of the Drosophila RNAi pathway. Science 301:
1921-1925.
172
144. Soifer HS, Sano M, Sakurai K, Chomchan P, Saetrom P, et al. (2008) A role for
the Dicer helicase domain in the processing of thermodynamically unstable
hairpin RNAs. Nucleic Acids Res 36: 6511-6522.
145. Dlakic M (2006) DUF283 domain of Dicer proteins has a double-stranded RNA-
binding fold. Bioinformatics 22: 2711-2714.
146. Zhang H, Kolb FA, Jaskiewicz L, Westhof E, Filipowicz W (2004) Single
processing center models for human Dicer and bacterial RNase III. Cell 118:
57-68.
147. Duchaine TF, Wohlschlegel JA, Kennedy S, Bei Y, Conte D, Jr., et al. (2006)
Functional proteomics reveals the biochemical niche of C. elegans DCR-1 in
multiple small-RNA-mediated pathways. Cell 124: 343-354.
148. Caudy AA, Ketting RF, Hammond SM, Denli AM, Bathoorn AM, et al. (2003) A
micrococcal nuclease homologue in RNAi effector complexes. Nature 425:
411-414.
149. Ishizuka A, Siomi MC, Siomi H (2002) A Drosophila fragile X protein interacts
with components of RNAi and ribosomal proteins. Genes Dev 16: 2497-2508.
150. Kotaja N, Bhattacharyya SN, Jaskiewicz L, Kimmins S, Parvinen M, et al. (2006)
The chromatoid body of male germ cells: similarity with processing bodies and
presence of Dicer and microRNA pathway components. Proc Natl Acad Sci U
S A 103: 2647-2652.
151. Tahbaz N, Kolb FA, Zhang H, Jaronczyk K, Filipowicz W, et al. (2004)
Characterization of the interactions between mammalian PAZ PIWI domain
proteins and Dicer. EMBO Rep 5: 189-194.
152. Pare JM, Tahbaz N, Lopez-Orozco J, LaPointe P, Lasko P, et al. (2009) Hsp90
regulates the function of argonaute 2 and its recruitment to stress granules and
P-bodies. Mol Biol Cell 20: 3273-3284.
153. Barber GN (2009) The NFAR's (nuclear factors associated with dsRNA):
evolutionarily conserved members of the dsRNA binding protein family. RNA
Biol 6: 35-39.
154. Laraki G, Clerzius G, Daher A, Melendez-Pena C, Daniels S, et al. (2008)
Interactions between the double-stranded RNA-binding proteins TRBP and
173
PACT define the Medipal domain that mediates protein-protein interactions.
RNA Biol 5: 92-103.
155. Murphy D, Dancis B, Brown JR (2008) The evolution of core proteins involved
in microRNA biogenesis. BMC Evol Biol 8: 92.
156. Kok KH, Ng MH, Ching YP, Jin DY (2007) Human TRBP and PACT directly
interact with each other and associate with dicer to facilitate the production of
small interfering RNA. J Biol Chem 282: 17649-17657.
157. Lee Y, Hur I, Park SY, Kim YK, Suh MR, et al. (2006) The role of PACT in the
RNA silencing pathway. Embo J 25: 522-532.
158. Myers JW, Chi JT, Gong D, Schaner ME, Brown PO, et al. (2006) Minimizing
off-target effects by using diced siRNAs for RNA interference. J RNAi Gene
Silencing 2: 181-194.
159. Yuan YR, Pei Y, Ma JB, Kuryavyi V, Zhadina M, et al. (2005) Crystal structure
of A. aeolicus argonaute, a site-specific DNA-guided endoribonuclease,
provides insights into RISC-mediated mRNA cleavage. Mol Cell 19: 405-419.
160. Yuan YR, Pei Y, Chen HY, Tuschl T, Patel DJ (2006) A potential protein-RNA
recognition event along the RISC-loading pathway from the structure of A.
aeolicus Argonaute with externally bound siRNA. Structure 14: 1557-1565.
161. Wang Y, Sheng G, Juranek S, Tuschl T, Patel DJ (2008) Structure of the guide-
strand-containing argonaute silencing complex. Nature 456: 209-213.
162. Parker JS, Roe SM, Barford D (2005) Structural insights into mRNA recognition
from a PIWI domain-siRNA guide complex. Nature 434: 663-666.
163. Parker JS, Roe SM, Barford D (2004) Crystal structure of a PIWI protein
suggests mechanisms for siRNA recognition and slicer activity. Embo J 23:
4727-4737.
164. Okamura K, Ishizuka A, Siomi H, Siomi MC (2004) Distinct roles for Argonaute
proteins in small RNA-directed RNA cleavage pathways. Genes Dev 18: 1655-
1666.
165. Rand TA, Petersen S, Du F, Wang X (2005) Argonaute2 cleaves the anti-guide
strand of siRNA during RISC activation. Cell 123: 621-629.
174
166. Peters L, Meister G (2007) Argonaute proteins: mediators of RNA silencing. Mol
Cell 26: 611-623.
167. Hammond SM, Bernstein E, Beach D, Hannon GJ (2000) An RNA-directed
nuclease mediates post-transcriptional gene silencing in Drosophila cells.
Nature 404: 293-296.
168. Liu J, Carmell MA, Rivas FV, Marsden CG, Thomson JM, et al. (2004)
Argonaute2 is the catalytic engine of mammalian RNAi. Science 305: 1437-
1441.
169. Tomari Y, Matranga C, Haley B, Martinez N, Zamore PD (2004) A protein
sensor for siRNA asymmetry. Science 306: 1377-1380.
170. Hutvagner G (2005) Small RNA asymmetry in RNAi: function in RISC assembly
and gene regulation. FEBS Lett 579: 5850-5857.
171. Lin SL, Chang D, Ying SY (2005) Asymmetry of intronic pre-miRNA structures
in functional RISC assembly. Gene 356: 32-38.
172. Khvorova A, Reynolds A, Jayasena SD (2003) Functional siRNAs and miRNAs
exhibit strand bias. Cell 115: 209-216.
173. Kim K, Lee YS, Carthew RW (2007) Conversion of pre-RISC to holo-RISC by
Ago2 during assembly of RNAi complexes. Rna 13: 22-29.
174. Leuschner PJ, Ameres SL, Kueng S, Martinez J (2006) Cleavage of the siRNA
passenger strand during RISC assembly in human cells. EMBO Rep 7: 314-
320.
175. Miyoshi K, Tsukumo H, Nagami T, Siomi H, Siomi MC (2005) Slicer function
of Drosophila Argonautes and its involvement in RISC formation. Genes Dev
19: 2837-2848.
176. Matranga C, Tomari Y, Shin C, Bartel DP, Zamore PD (2005) Passenger-strand
cleavage facilitates assembly of siRNA into Ago2-containing RNAi enzyme
complexes. Cell 123: 607-620.
177. Tomari Y, Du T, Zamore PD (2007) Sorting of Drosophila small silencing
RNAs. Cell 130: 299-308.
178. Leuschner PJ, Obernosterer G, Martinez J (2005) MicroRNAs: Loquacious
speaks out. Curr Biol 15: R603-605.
175
179. Forstemann K, Tomari Y, Du T, Vagin VV, Denli AM, et al. (2005) Normal
microRNA maturation and germ-line stem cell maintenance requires
Loquacious, a double-stranded RNA-binding domain protein. PLoS Biol 3:
e236.
180. Saito K, Ishizuka A, Siomi H, Siomi MC (2005) Processing of pre-microRNAs
by the Dicer-1-Loquacious complex in Drosophila cells. PLoS Biol 3: e235.
181. Kanellopoulou C, Muljo SA, Kung AL, Ganesan S, Drapkin R, et al. (2005)
Dicer-deficient mouse embryonic stem cells are defective in differentiation and
centromeric silencing. Genes Dev 19: 489-501.
182. Forstemann K, Horwich MD, Wee L, Tomari Y, Zamore PD (2007) Drosophila
microRNAs are sorted into functionally distinct argonaute complexes after
production by dicer-1. Cell 130: 287-297.
183. Lazzaretti D, Tournier I, Izaurralde E (2009) The C-terminal domains of human
TNRC6A, TNRC6B, and TNRC6C silence bound transcripts independently of
Argonaute proteins. Rna 15: 1059-1066.
184. Fabian MR, Mathonnet G, Sundermeier T, Mathys H, Zipprich JT, et al. (2009)
Mammalian miRNA RISC recruits CAF1 and PABP to affect PABP-
dependent deadenylation. Mol Cell 35: 868-880.
185. Eulalio A, Tritschler F, Izaurralde E (2009) The GW182 protein family in animal
cells: new insights into domains required for miRNA-mediated gene silencing.
Rna 15: 1433-1442.
186. Eulalio A, Tritschler F, Buttner R, Weichenrieder O, Izaurralde E, et al. (2009)
The RRM domain in GW182 proteins contributes to miRNA-mediated gene
silencing. Nucleic Acids Res 37: 2974-2983.
187. Eulalio A, Helms S, Fritzsch C, Fauser M, Izaurralde E (2009) A C-terminal
silencing domain in GW182 is essential for miRNA function. Rna 15: 1067-
1077.
188. Ding XC, Grosshans H (2009) Repression of C. elegans microRNA targets at the
initiation level of translation requires GW182 proteins. Embo J 28: 213-222.
189. Chen CY, Zheng D, Xia Z, Shyu AB (2009) Ago-TNRC6 triggers microRNA-
mediated decay by promoting two deadenylation steps. Nat Struct Mol Biol.
176
190. Chekulaeva M, Filipowicz W, Parker R (2009) Multiple independent domains of
dGW182 function in miRNA-mediated repression in Drosophila. Rna 15: 794-
803.
191. Baillat D, Shiekhattar R (2009) Functional dissection of the human TNRC6
(GW182-related) family of proteins. Mol Cell Biol 29: 4144-4155.
192. Li S, Lian SL, Moser JJ, Fritzler ML, Fritzler MJ, et al. (2008) Identification of
GW182 and its novel isoform TNGW1 as translational repressors in Ago2-
mediated silencing. J Cell Sci 121: 4134-4144.
193. Eulalio A, Huntzinger E, Izaurralde E (2008) GW182 interaction with Argonaute
is essential for miRNA-mediated translational repression and mRNA decay.
Nat Struct Mol Biol 15: 346-353.
194. Liu J, Rivas FV, Wohlschlegel J, Yates JR, 3rd, Parker R, et al. (2005) A role for
the P-body component GW182 in microRNA function. Nat Cell Biol 7: 1261-
1266.
195. Ding L, Spencer A, Morita K, Han M (2005) The developmental timing regulator
AIN-1 interacts with miRISCs and may target the argonaute protein ALG-1 to
cytoplasmic P bodies in C. elegans. Mol Cell 19: 437-447.
196. Brennecke J, Stark A, Russell RB, Cohen SM (2005) Principles of microRNA-
target recognition. PLoS Biol 3: e85.
197. Enright AJ, John B, Gaul U, Tuschl T, Sander C, et al. (2003) MicroRNA targets
in Drosophila. Genome Biol 5: R1.
198. John B, Enright AJ, Aravin A, Tuschl T, Sander C, et al. (2004) Human
MicroRNA targets. PLoS Biol 2: e363.
199. Krek A, Grun D, Poy MN, Wolf R, Rosenberg L, et al. (2005) Combinatorial
microRNA target predictions. Nat Genet 37: 495-500.
200. Easow G, Teleman AA, Cohen SM (2007) Isolation of microRNA targets by
miRNP immunopurification. Rna 13: 1198-1204.
201. Lytle JR, Yario TA, Steitz JA (2007) Target mRNAs are repressed as efficiently
by microRNA-binding sites in the 5' UTR as in the 3' UTR. Proc Natl Acad Sci
U S A 104: 9667-9672.
177
202. Stark A, Lin MF, Kheradpour P, Pedersen JS, Parts L, et al. (2007) Discovery of
functional elements in 12 Drosophila genomes using evolutionary signatures.
Nature 450: 219-232.
203. Gu S, Jin L, Zhang F, Sarnow P, Kay MA (2009) Biological basis for restriction
of microRNA targets to the 3' untranslated region in mammalian mRNAs. Nat
Struct Mol Biol 16: 144-150.
204. Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, et al. (2005) Systematic
discovery of regulatory motifs in human promoters and 3' UTRs by
comparison of several mammals. Nature 434: 338-345.
205. Vella MC, Choi EY, Lin SY, Reinert K, Slack FJ (2004) The C. elegans
microRNA let-7 binds to imperfect let-7 complementary sites from the lin-41
3'UTR. Genes Dev 18: 132-137.
206. Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, et al. (2003) The
microRNAs of Caenorhabditis elegans. Genes Dev 17: 991-1008.
207. Wang Y, Juranek S, Li H, Sheng G, Wardle GS, et al. (2009) Nucleation,
propagation and cleavage of target RNAs in Ago silencing complexes. Nature
461: 754-761.
208. Sethupathy P, Megraw M, Hatzigeorgiou AG (2006) A guide through present
computational approaches for the identification of mammalian microRNA
targets. Nat Methods 3: 881-886.
209. Kertesz M, Iovino N, Unnerstall U, Gaul U, Segal E (2007) The role of site
accessibility in microRNA target recognition. Nat Genet 39: 1278-1284.
210. Miranda KC, Huynh T, Tay Y, Ang YS, Tam WL, et al. (2006) A pattern-based
method for the identification of MicroRNA binding sites and their
corresponding heteroduplexes. Cell 126: 1203-1217.
211. Hall TM (2005) Structure and function of argonaute proteins. Structure 13: 1403-
1408.
212. Song JJ, Smith SK, Hannon GJ, Joshua-Tor L (2004) Crystal structure of
Argonaute and its implications for RISC slicer activity. Science 305: 1434-
1437.
178
213. Meister G, Tuschl T (2004) Mechanisms of gene silencing by double-stranded
RNA. Nature 431: 343-349.
214. Bhattacharyya SN, Habermacher R, Martine U, Closs EI, Filipowicz W (2006)
Relief of microRNA-mediated translational repression in human cells
subjected to stress. Cell 125: 1111-1124.
215. Chu CY, Rana TM (2006) Translation repression in human cells by microRNA-
induced gene silencing requires RCK/p54. PLoS Biol 4: e210.
216. Liu J, Valencia-Sanchez MA, Hannon GJ, Parker R (2005) MicroRNA-
dependent localization of targeted mRNAs to mammalian P-bodies. Nat Cell
Biol 7: 719-723.
217. Zeng Y, Cullen BR (2003) Sequence requirements for micro RNA processing
and function in human cells. Rna 9: 112-123.
218. Zeng Y, Wagner EJ, Cullen BR (2002) Both natural and designed micro RNAs
can inhibit the expression of cognate mRNAs when expressed in human cells.
Mol Cell 9: 1327-1333.
219. Decker CJ, Parker R (1994) Mechanisms of mRNA degradation in eukaryotes.
Trends Biochem Sci 19: 336-340.
220. Wormington M (1993) Poly(A) and translation: development control. Curr Opin
Cell Biol 5: 950-954.
221. Kiriakidou M, Tan GS, Lamprinaki S, De Planell-Saguer M, Nelson PT, et al.
(2007) An mRNA m7G cap binding-like motif within human Ago2 represses
translation. Cell 129: 1141-1151.
222. Mathonnet G, Fabian MR, Svitkin YV, Parsyan A, Huck L, et al. (2007)
MicroRNA inhibition of translation initiation in vitro by targeting the cap-
binding complex eIF4F. Science 317: 1764-1767.
223. Thermann R, Hentze MW (2007) Drosophila miR2 induces pseudo-polysomes
and inhibits translation initiation. Nature 447: 875-878.
224. Chendrimada TP, Finn KJ, Ji X, Baillat D, Gregory RI, et al. (2007) MicroRNA
silencing through RISC recruitment of eIF6. Nature 447: 823-828.
225. Wang B, Yanez A, Novina CD (2008) MicroRNA-repressed mRNAs contain 40S
but not 60S components. Proc Natl Acad Sci U S A 105: 5343-5348.
179
226. Sanvito F, Piatti S, Villa A, Bossi M, Lucchini G, et al. (1999) The beta4 integrin
interactor p27(BBP/eIF6) is an essential nuclear matrix protein involved in 60S
ribosomal subunit assembly. J Cell Biol 144: 823-837.
227. Ceci M, Gaviraghi C, Gorrini C, Sala LA, Offenhauser N, et al. (2003) Release of
eIF6 (p27BBP) from the 60S subunit allows 80S ribosome assembly. Nature
426: 579-584.
228. Nottrott S, Simard MJ, Richter JD (2006) Human let-7a miRNA blocks protein
production on actively translating polyribosomes. Nat Struct Mol Biol 13:
1108-1114.
229. Petersen CP, Bordeleau ME, Pelletier J, Sharp PA (2006) Short RNAs repress
translation after initiation in mammalian cells. Mol Cell 21: 533-542.
230. Maroney PA, Yu Y, Fisher J, Nilsen TW (2006) Evidence that microRNAs are
associated with translating messenger RNAs in human cells. Nat Struct Mol
Biol 13: 1102-1107.
231. Jacobson A, Peltz SW (1996) Interrelationships of the pathways of mRNA decay
and translation in eukaryotic cells. Annu Rev Biochem 65: 693-739.
232. Kruys V, Marinx O, Shaw G, Deschamps J, Huez G (1989) Translational
blockade imposed by cytokine-derived UA-rich sequences. Science 245: 852-
855.
233. Kruys V, Wathelet M, Poupart P, Contreras R, Fiers W, et al. (1987) The 3'
untranslated region of the human interferon-beta mRNA has an inhibitory
effect on translation. Proc Natl Acad Sci U S A 84: 6030-6034.
234. Kruys VI, Wathelet MG, Huez GA (1988) Identification of a translation
inhibitory element (TIE) in the 3' untranslated region of the human interferon-
beta mRNA. Gene 72: 191-200.
235. Wu L, Fan J, Belasco JG (2008) Importance of translation and nonnucleolytic
ago proteins for on-target RNA interference. Curr Biol 18: 1327-1332.
236. Aleman LM, Doench J, Sharp PA (2007) Comparison of siRNA-induced off-
target RNA and protein effects. Rna 13: 385-395.
180
237. Standart N, Jackson RJ (2007) MicroRNAs repress translation of m7Gppp-
capped target mRNAs in vitro by inhibiting initiation and promoting
deadenylation. Genes Dev 21: 1975-1982.
238. Kong YW, Cannell IG, de Moor CH, Hill K, Garside PG, et al. (2008) The
mechanism of micro-RNA-mediated translation repression is determined by
the promoter of the target gene. Proc Natl Acad Sci U S A 105: 8866-8871.
239. Hendrickson DG, Hogan DJ, Herschlag D, Ferrell JE, Brown PO (2008)
Systematic identification of mRNAs recruited to argonaute 2 by specific
microRNAs and corresponding changes in transcript abundance. PLoS ONE 3:
e2126.
240. Grishok A, Pasquinelli AE, Conte D, Li N, Parrish S, et al. (2001) Genes and
mechanisms related to RNA interference regulate expression of the small
temporal RNAs that control C. elegans developmental timing. Cell 106: 23-34.
241. Haley B, Zamore PD (2004) Kinetic analysis of the RNAi enzyme complex. Nat
Struct Mol Biol 11: 599-606.
242. Lai EC (2002) Micro RNAs are complementary to 3' UTR sequence motifs that
mediate negative post-transcriptional regulation. Nat Genet 30: 363-364.
243. Wang Y, Juranek S, Li H, Sheng G, Tuschl T, et al. (2008) Structure of an
argonaute silencing complex with a seed-containing guide DNA and target
RNA duplex. Nature 456: 921-926.
244. Rashid UJ, Paterok D, Koglin A, Gohlke H, Piehler J, et al. (2007) Structure of
Aquifex aeolicus argonaute highlights conformational flexibility of the PAZ
domain as a potential regulator of RNA-induced silencing complex function. J
Biol Chem 282: 13824-13832.
245. Blaszczyk J, Tropea JE, Bubunenko M, Routzahn KM, Waugh DS, et al. (2001)
Crystallographic and modeling studies of RNase III suggest a mechanism for
double-stranded RNA cleavage. Structure (Camb) 9: 1225-1236.
246. Tomari Y, Du T, Haley B, Schwarz DS, Bennett R, et al. (2004) RISC assembly
defects in the Drosophila RNAi mutant armitage. Cell 116: 831-841.
181
247. Cook HA, Koppetsch BS, Wu J, Theurkauf WE (2004) The Drosophila SDE3
homolog armitage is required for oskar mRNA silencing and embryonic axis
specification. Cell 116: 817-829.
248. Pellino JL, Jaskiewicz L, Filipowicz W, Sontheimer EJ (2005) ATP modulates
siRNA interactions with an endogenous human Dicer complex. Rna 11: 1719-
1724.
249. Pellino JL, Sontheimer EJ (2003) R2D2 leads the silencing trigger to mRNA's
death star. Cell 115: 132-133.
250. Doi N, Zenno S, Ueda R, Ohki-Hamazaki H, Ui-Tei K, et al. (2003) Short-
interfering-RNA-mediated gene silencing in mammalian cells requires Dicer
and eIF2C translation initiation factors. Curr Biol 13: 41-46.
251. Caudy AA, Myers M, Hannon GJ, Hammond SM (2002) Fragile X-related
protein and VIG associate with the RNA interference machinery. Genes Dev
16: 2491-2496.
252. Carthew RW (2006) Gene regulation by microRNAs. Curr Opin Genet Dev 16:
203-208.
253. Chen PY, Meister G (2005) microRNA-guided posttranscriptional gene
regulation. Biol Chem 386: 1205-1218.
254. Didiano D, Hobert O (2006) Perfect seed pairing is not a generally reliable
predictor for miRNA-target interactions. Nat Struct Mol Biol 13: 849-851.
255. SFGF (2008) Human Exonic Evidence Based Oligonucleotide (HEEBO) Arrays
256. Ambion (2008) mirVana™ miRNA Probe Set
257. Ferea TL, Brown PO (1999) Observing the living genome. Curr Opin Genet Dev
9: 715-722.
258. Tusher VG, Tibshirani R, Chu G (2001) Significance analysis of microarrays
applied to the ionizing radiation response. Proc Natl Acad Sci U S A 98: 5116-
5121.
259. Efron B, Tibshirani R (2002) Empirical bayes methods and false discovery rates
for microarrays. Genet Epidemiol 23: 70-86.
182
260. Bailey TL, Elkan C (1994) Fitting a mixture model by expectation maximization
to discover motifs in biopolymers. Proc Int Conf Intell Syst Mol Biol 2: 28-36.
261. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, et al. (2005)
Gene set enrichment analysis: a knowledge-based approach for interpreting
genome-wide expression profiles. Proc Natl Acad Sci U S A 102: 15545-
15550.
262. Beitzinger M, Peters L, Zhu JY, Kremmer E, Meister G (2007) Identification of
Human microRNA Targets From Isolated Argonaute Protein Complexes. RNA
Biol 4.
263. Karginov FV, Conaco C, Xuan Z, Schmidt BH, Parker JS, et al. (2007) A
biochemical approach to identifying microRNA targets. Proc Natl Acad Sci U
S A 104: 19291-19296.
264. Zhang L, Ding L, Cheung TH, Dong MQ, Chen J, et al. (2007) Systematic
identification of C. elegans miRISC proteins, miRNAs, and mRNA targets by
their interactions with GW182 proteins AIN-1 and AIN-2. Mol Cell 28: 598-
613.
265. Fare TL, Coffey EM, Dai H, He YD, Kessler DA, et al. (2003) Effects of
atmospheric ozone on microarray data quality. Anal Chem 75: 4672-4675.
266. Demeter J, Beauheim C, Gollub J, Hernandez-Boussard T, Jin H, et al. (2007)
The Stanford Microarray Database: implementation of new analysis tools and
open source release of software. Nucleic Acids Res 35: D766-770.
267. Eisen MB, Spellman PT, Brown PO, Botstein D (1998) Cluster analysis and
display of genome-wide expression patterns. Proc Natl Acad Sci U S A 95:
14863-14868.
268. Saldanha AJ (2004) Java Treeview--extensible visualization of microarray data.
Bioinformatics 20: 3246-3248.
269. Hosack DA, Dennis G, Jr., Sherman BT, Lane HC, Lempicki RA (2003)
Identifying biological themes within lists of genes with EASE. Genome Biol 4:
R70.
183
270. Seggerson K, Tang L, Moss EG (2002) Two genetic circuits repress the
Caenorhabditis elegans heterochronic gene lin-28 after translation initiation.
Dev Biol 243: 215-225.
271. Slack F, Ruvkun G (1997) Temporal pattern formation by heterochronic genes.
Annu Rev Genet 31: 611-634.
272. Bachvarova RF (1992) A maternal tail of poly(A): the long and the short of it.
Cell 69: 895-897.
273. Deshpande AK, Chatterjee B, Roy AK (1979) Translation and stability of rat
liver messenger RNA for alpha 2 mu-globulin in Xenopus oocyte. The role of
terminal poly(A). J Biol Chem 254: 8937-8942.
274. Drummond DR, Armstrong J, Colman A (1985) The effect of capping and
polyadenylation on the stability, movement and translation of synthetic
messenger RNAs in Xenopus oocytes. Nucleic Acids Res 13: 7375-7394.
275. Gallie DR (1991) The cap and poly(A) tail function synergistically to regulate
mRNA translational efficiency. Genes Dev 5: 2108-2116.
276. Gallie DR, Lucas WJ, Walbot V (1989) Visualizing mRNA expression in plant
protoplasts: factors influencing efficient mRNA uptake and translation. Plant
Cell 1: 301-311.
277. Wang B, Love TM, Call ME, Doench JG, Novina CD (2006) Recapitulation of
short RNA-directed translational gene silencing in vitro. Mol Cell 22: 553-560.
278. Ikeda K, Satoh M, Pauley KM, Fritzler MJ, Reeves WH, et al. (2006) Detection
of the argonaute protein Ago2 and microRNAs in the RNA induced silencing
complex (RISC) using a monoclonal antibody. J Immunol Methods 317: 38-
44.
279. Forman JJ, Legesse-Miller A, Coller HA (2008) A search for conserved
sequences in coding regions reveals that the let-7 microRNA targets Dicer
within its coding sequence. Proc Natl Acad Sci U S A 105: 14879-14884.
280. Tay Y, Zhang J, Thomson AM, Lim B, Rigoutsos I (2008) MicroRNAs to
Nanog, Oct4 and Sox2 coding regions modulate embryonic stem cell
differentiation. Nature 455: 1124-1128.
184
281. Arava Y, Wang Y, Storey JD, Liu CL, Brown PO, et al. (2003) Genome-wide
analysis of mRNA translation profiles in Saccharomyces cerevisiae. Proc Natl
Acad Sci U S A 100: 3889-3894.
282. Wolin SL, Walter P (1988) Ribosome pausing and stacking during translation of
a eukaryotic mRNA. Embo J 7: 3559-3569.
283. Arava Y, Boas FE, Brown PO, Herschlag D (2005) Dissecting eukaryotic
translation and its control by ribosome density mapping. Nucleic Acids Res 33:
2421-2432.
284. Ingolia NT, Ghaemmaghami S, Newman JR, Weissman JS (2009) Genome-wide
analysis in vivo of translation with nucleotide resolution using ribosome
profiling. Science 324: 218-223.
285. Richter JD (1999) Cytoplasmic polyadenylation in development and beyond.
Microbiol Mol Biol Rev 63: 446-456.
286. Wormington M (1994) Unmasking the role of the 3' UTR in the cytoplasmic
polyadenylation and translational regulation of maternal mRNAs. Bioessays
16: 533-535.
287. Hegde RS, Kang SW (2008) The concept of translocational regulation. J Cell
Biol 182: 225-232.
288. Fang S, Jensen JP, Ludwig RL, Vousden KH, Weissman AM (2000) Mdm2 is a
RING finger-dependent ubiquitin protein ligase for itself and p53. J Biol Chem
275: 8945-8951.
289. Ito K, Adachi S, Iwakami R, Yasuda H, Muto Y, et al. (2001) N-Terminally
extended human ubiquitin-conjugating enzymes (E2s) mediate the
ubiquitination of RING-finger proteins, ARA54 and RNF8. Eur J Biochem
268: 2725-2732.
290. Yang Y, Fang S, Jensen JP, Weissman AM, Ashwell JD (2000) Ubiquitin protein
ligase activity of IAPs and their degradation in proteasomes in response to
apoptotic stimuli. Science 288: 874-877.
291. Marson A, Levine SS, Cole MF, Frampton GM, Brambrink T, et al. (2008)
Connecting microRNA genes to the core transcriptional regulatory circuitry of
embryonic stem cells. Cell 134: 521-533.
185
292. Landthaler M, Yalcin A, Tuschl T (2004) The human DiGeorge syndrome critical
region gene 8 and Its D. melanogaster homolog are required for miRNA
biogenesis. Curr Biol 14: 2162-2167.
293. Holtz J, Pasquinelli AE (2009) Uncoupling of lin-14 mRNA and protein
repression by nutrient deprivation in Caenorhabditis elegans. Rna 15: 400-405.
294. Coller J, Parker R (2005) General translational repression by activators of mRNA
decapping. Cell 122: 875-886.
295. Kawai T, Fan J, Mazan-Mamczarz K, Gorospe M (2004) Global mRNA
stabilization preferentially linked to translational repression during the
endoplasmic reticulum stress response. Mol Cell Biol 24: 6773-6787.
296. Sheth U, Parker R (2003) Decapping and decay of messenger RNA occur in
cytoplasmic processing bodies. Science 300: 805-808.
297. Schwartz DC, Parker R (1999) Mutations in translation initiation factors lead to
increased rates of deadenylation and decapping of mRNAs in Saccharomyces
cerevisiae. Mol Cell Biol 19: 5247-5256.
298. Bandyopadhyay R, Coutts M, Krowczynska A, Brawerman G (1990) Nuclease
activity associated with mammalian mRNA in its native state: possible basis
for selectivity in mRNA decay. Mol Cell Biol 10: 2060-2069.
299. Caruccio N, Ross J (1994) Purification of a human polyribosome-associated 3' to
5' exoribonuclease. J Biol Chem 269: 31814-31821.
300. Grafi G, Sela I, Galili G (1993) Translational regulation of human beta interferon
mRNA: association of the 3' AU-rich sequence with the poly(A) tail reduces
translation efficiency in vitro. Mol Cell Biol 13: 3487-3493.
301. Marinx O, Bertrand S, Karsenti E, Huez G, Kruys V (1994) Fertilization of
Xenopus eggs imposes a complete translational arrest of mRNAs containing
3'UUAUUUAU elements. FEBS Lett 345: 107-112.
302. Muhlrad D, Decker CJ, Parker R (1995) Turnover mechanisms of the stable yeast
PGK1 mRNA. Mol Cell Biol 15: 2145-2156.
303. Klapholz-Brown Z, Walmsley GG, Nusse YM, Nusse R, Brown PO (2007)
Transcriptional program induced by Wnt protein in human fibroblasts suggests
186
mechanisms for cell cooperativity in defining tissue microenvironments. PLoS
ONE 2: e945.
304. Backes C, Keller A, Kuentzer J, Kneissl B, Comtesse N, et al. (2007) GeneTrail--
advanced gene set enrichment analysis. Nucleic Acids Res 35: W186-192.
305. Holm S (1979) A simple sequentially rejective multiple test procedure. Scand J
Statist 6: 65–70
306. Mayr C, Bartel DP (2009) Widespread shortening of 3'UTRs by alternative
cleavage and polyadenylation activates oncogenes in cancer cells. Cell 138:
673-684.
307. Sandberg R, Neilson JR, Sarma A, Sharp PA, Burge CB (2008) Proliferating
cells express mRNAs with shortened 3' untranslated regions and fewer
microRNA target sites. Science 320: 1643-1647.
308. Licatalosi DD, Mele A, Fak JJ, Ule J, Kayikci M, et al. (2008) HITS-CLIP yields
genome-wide insights into brain alternative RNA processing. Nature 456: 464-
469.
309. Chi SW, Zang JB, Mele A, Darnell RB (2009) Argonaute HITS-CLIP decodes
microRNA-mRNA interaction maps. Nature 460: 479-486.
310. Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, et al. (2009) Ago2
immunoprecipitation identifies predicted microRNAs in human embryonic
stem cells and neural precursors. PLoS One 4: e7192.
311. Tan LP, Seinen E, Duns G, de Jong D, Sibon OC, et al. (2009) A high throughput
experimental approach to identify miRNA targets in human cells. Nucleic
Acids Res.
312. Huang X, Ding L, Bennewith KL, Tong RT, Welford SM, et al. (2009) Hypoxia-
inducible mir-210 regulates normoxic gene expression involved in tumor
initiation. Mol Cell 35: 856-867.
313. Kadener S, Menet JS, Sugino K, Horwich MD, Weissbein U, et al. (2009) A role
for microRNAs in the Drosophila circadian clock. Genes Dev 23: 2179-2191.
187
314. Zhang L, Hammell M, Kudlow BA, Ambros V, Han M (2009) Systematic
analysis of dynamic miRNA-target interactions during C. elegans
development. Development 136: 3043-3055.
315. Yoo AS, Staahl BT, Chen L, Crabtree GR (2009) MicroRNA-mediated switching
of chromatin-remodelling complexes in neural development. Nature 460: 642-
646.
316. Zhou JY, Ma WL, Liang S, Zeng Y, Shi R, et al. (2009) Analysis of microRNA
expression profiles during the cell cycle in synchronized HeLa cells. BMB Rep
42: 593-598.
317. Hwang HW, Wentzel EA, Mendell JT (2007) A hexanucleotide element directs
microRNA nuclear import. Science 315: 97-100.
318. Landthaler M, Gaidatzis D, Rothballer A, Chen PY, Soll SJ, et al. (2008)
Molecular characterization of human Argonaute-containing ribonucleoprotein
complexes and their bound target mRNAs. Rna.
319. Meister G, Landthaler M, Peters L, Chen PY, Urlaub H, et al. (2005)
Identification of novel argonaute-associated proteins. Curr Biol 15: 2149-2155.
320. Beilharz TH, Humphreys DT, Clancy JL, Thermann R, Martin DI, et al. (2009)
microRNA-mediated messenger RNA deadenylation contributes to
translational repression in mammalian cells. PLoS One 4: e6783.
321. Elemento O, Slonim N, Tavazoie S (2007) A universal framework for regulatory
element discovery across all genomes and data types. Mol Cell 28: 337-350.
322. Cleveland WS (1979) Robust Locally Weighted Fitting and Smoothing
Scatterplots. Journal of the American Statistical Association 74: 829-836.
top related