simvastatin suppresses the proangiogenic microenvironment...
Post on 10-Jan-2020
0 Views
Preview:
TRANSCRIPT
Simvastatin suppresses the proangiogenic microenvironment of human hepatic stellate cells via the Kruppel-like factor 2 pathway
Qing Miao, Xiaoqing Zeng, Guifen Ma, Na Li, Yimei Liu, Tiancheng Luo, Jingjing Lian and Shiyao Chen
Department of Gastroenterology. Zhongshan Hospital affiliated to Fudan University. Shanghai, China
1130-0108/2015/107/2/63-71Revista española de enfeRmedades digestivasCopyRight © 2015 aRán ediCiones, s. l.
Rev esp enfeRm dig (MadridVol. 107, N.º 2, pp. 63-71, 2015
ORIGINAL PAPERS
ABSTRACT
Background and aims: Statins are reported to have a beneficial effect on portal hypertension (PTH); however, the exact mechanism remains unknown. Hepatic stellate cells (HSCs) can be activated by transforming growth factor beta (TGFβ) and play an important role in angiogenesis leading to PTH. Statins potently stimulate the transcription factor, Kruppel-like factor 2 (KLF2), which can negatively regulate angiogenesis. Our present study aimed to investigate the anti-angiogenic potential of statins in HSCs through the KLF2 pathway.
Method: TGFβ-induced human HSCs were exposed to simvastatin. Cell viability and proliferation were determined by MTT and BrdU-proliferation assays, respectively. Cell migration was investigated using a transwell and wound-healing assays. Gene quantification was measured by real-time polymerase chain reaction. Protein expression was detected by western blot analysis and immunohistochemistry. Inflammatory factors were measured using enzyme-linked immunosorbent assays.
Result: Simvastatin was found to reduced cell migration and proliferation and inhibit expression of alpha smooth muscle actin in TGFβ-induced HSCs. Furthermore, simvastatin promoted already increased mRNA and protein levels of KLF2 in TGFβ-induced HSCs. In accordance with KLF2 overexpression, simvastatin increased production of endothelial nitric oxide synthesis (eNOS) and downregulated expression of some proangiogenic proteins, such as vascular endothelial growth factor, hypoxia inducible factor-1a and nuclear factor-kappa B in TGFβ-induced HSCs. At the same time, secretion of interferon-gamma increased in
TGFβ induced HSCs, which was decreased by simultaneous addition of simvastatin.
Conclusion: Simvastatin suppressed the proangiogenic environment of HSCs activated by TGFβ, and KLF2 pathway is involved in the course.
Key words: Simvastatin. Angiogenesis. Hepatic stellate cell. Kruppel-like factor 2.
INTRODUCTION
Portal hypertension (PTH) is one of the most com-mon complications caused by cirrhosis, which commonly leads to variceal hemorrhage and bleeding-related death. The most critical reason for induced PTH is increased in-trahepatic vascular resistance (1). Fibrosis and intrahepat-ic vasoconstriction are classical mechanisms that account for increased intrahepatic vascular resistance in PTH (2). Recently, research has focused on the relationship of in-trahepatic angiogenesis and PTH (3,4).
In the development of PTH, activated hepatic stellate cells (HSCs) are responsible for all pathological changes in the cirrhotic liver. Tissue and serum levels of active TGFβ are elevated in fibrosis, and application of exoge-nous TGFβ can induce liver fibrosis (5). Although previ-ous investigations of HSCs in the liver have focused on their unique capacity to deposit collagen matrix, ensuing a wound-healing response, the contribution of HSCs to hepatic microvascular structure has only recently become
Miao Q, Zeng X, Ma G, Li N, Liu Y, Luo T, Lian J, Chen S. Simvastatin suppresses the proangiogenic microenvironment of human hepatic stellate cells via the Kruppel-like factor 2 pathway. Rev Esp Enferm Dig 2015;107:63-71.
Received: 12-12-2013Accepted: 09-12-2014
Correspondence: Shiyao Chen. Department of Gastroenterology. Zhongshan Hospital affiliated to Fudan University. No. 130 Fenglin Road. Xuhui Dis-trict, Shanghai. 200032, Chinae-mail: chen.shiyao@zs-hospital.sh.cn; syaochen@163.com
Grant support: Xinjiang Uygur Autonomous Region Science and Technology Support Project (No. 200991127).
64 Q. MIAO ET AL. Rev esp enfeRm Dig (maDRiD)
Rev esp enfeRm Dig 2015; 107 (2): 63-71
recognized (6). In response to liver damage, HSCs are ac-tivated and largely proliferate and migrate to the surround-ing sinusoidal endothelial cells (SECs), wrapping around the vascular tubes that have lost their normal phenotype. HSCs may also produce angiogenic molecules, such as vascular endothelial growth factor (VEGF), and contrib-ute to angiogenesis through direct or indirect mechanisms (7). Because of their major role in inducing PTH, HSCs are excellent targets for therapy.
Statins are widely used in the clinic for their choles-terol-lowering properties. However, several clinical trials have shown that statins also have cholesterol-independent benefits, including the improvement of liver fibrosis and PTH (8,9). Researchers have demonstrated that statins can inhibit activation of HSCs (10-12); however, the actu-al mechanism of action for statin therapy on the proangio-genic environment of HSCs and relevant signal pathway remains yet to be elucidated.
Some reports have shown that statins can strongly in-duce the vasoprotective transcription factor, Kruppel-like factor 2 (KLF2), in the vascular system (13-16). This in turn can protect the endothelial cell phenotype against in-flammation and negatively regulate angiogenesis (17,18). We therefore hypothesize that statins may suppress the proangiogenic microenvironment of HSCs through the KLF2 pathway. The aim of this study was to investigate the effect of statins on the activation of human HSCs and their proangiogenic microenvironment.
METHODS
Cells and cell culture
LX-2 cells (kindly provided by Dr. Guo), a low passage cell line, were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 5 % heat-inacti-vated fetal bovine serum (FBS). Cells were subcultured two or three times a week by trypsinization in a 0.25 % trypsin-ethylenediamine tetraacetic acid solution and in-cubated at 37 °C in a humidified atmosphere of 5 % CO
2.
Cells were seeded in tissue culture plates (Nunc). Before simvastatin and TGFβ (Sigma-Aldrich, USA) treatment, cells were starved of serum for 20 h. We chose HSC-stim-ulation with 1 µM simvastatin for 24 h for further study, because in this condition HSC viability remained high (data not shown).
MTT assay
Cell viability was determined using the MTT assay. This method is based on the capability of living cells to reduce light colored tetrazolium salts into an intense col-or formazan derivation. This reduction process requires functional mitochondria, which become inactive within
a few minutes after cell death. HSC cells (2×103) were seeded in a 96-well culture plate for 24 h and then starved for 24 h in serum-free DMEM. Medium was then re-placed with DMEM containing 5 % FBS with 10 ng/ml TGFβ, or in the presence of simvastatin. HSCs were then incubated for 4 h with MTT solution (5 mg/ml), and light absorbance was detected at a wavelength of 570 nm. The results were plotted as means ± standard deviations (SD) of two independent experiments, having three determina-tions per sample for each experiment.
BrdU-proliferation assay
The effect of simvastatin on DNA synthesis of activat-ed HSC cells was investigated by performing BrdU en-zyme-linked immunoabsorbent assay (ELISA). Briefly, 2×103 cells were seeded in 96-well plates. Subconfluent cell cultures were treated with 10 ng/ml TGFβ alone or 10 ng/ml TGFβ combined with simvastatin for 24 h. During the 24 h experimental time point, cells were labeled with 10 µM BrdU and incorporation was measured according to the manufacturer’s instructions (Roche). This experi-ment was conducted three times.
Wound-healing assay
Cell migration was studied using an in vitro wound healing assay. HSC cells (3×105) were seeded onto 4-cm culture dishes (Nunc) in 5 % FBS-DMEM for 24 h. One linear wound was then scraped in each well with a ster-ile pipette tip (p300). All cellular debris were removed and medium was replaced with fresh 0.5 % FBS-DMEM alone or together with simvastatin and 10 ng/ml TGFβ. Control cells were cultured in 0.5 % FBS-DMEM. The number of cells that had migrated into the wounded area after 24 h was estimated in the control and in the cultures treated with TGFβ and simvastatin. Migrated cells were observed on micrographs, and the results were shown as the mean number of cells from 100 randomly chosen wounded areas. This experiment was conducted three times.
Transwell migration assay
To mimic the HSC perisinusoidal (Disse) space mi-croenvironment in vivo, polyvinyl/pyrrolidone-free poly-carbonate membranes with 8 µm pores, which separate the upper and lower wells in a transwell chamber (Corn-ing), were coated with type IV collagen on the upper side (50 µg/ml) and type I collagen on the lower side (50 µg/ml). The bottom wells of the chamber were filled with DMEM, and 2×104 of serum-starved LX-2 cells/well, were added into the upper chambers. TGFβ or simvas-
Vol. 107, N.º 2, 2015 SIMVASTATIN SUPPRESSES THE PROANGIOGENIC MICROENVIRONMENT OF HUMAN HEPATIC STELLATE CELLS VIA 65 THE KRUPPEL-LIKE FACTOR 2 PATHWAY
Rev esp enfeRm Dig 2015; 107 (2): 63-71
tatin were added into the upper chambers as direct hapto-tactic stimulants, and into the lower chamber as indirect chemotactic stimulants, to mimic the in vivo autocrine and paracrine mechanisms of cytokines, respectively. The transwell chamber was incubated at 37 °C for 24 h to allow migration of cells through the membrane into the lower chamber. The migrated cells were stained with May-Grunwald-Giemsa and counted in six random fields of view on a phase contrast microscope. This experiment was conducted three times and each time was assessed in three fields.
Cytokine ELISAs
HSCs were cultured for 72 h and serum-starved for 24 h prior to assaying. HSC supernatants were collect-ed for analysis of interferon-gamma (INFγ), interleukin (IL)-2, IL-4 and IL-5 with ELISA kits, following the man-ufacture’s protocol (eBioscience). All experiments were performed for 3 times.
Immunohistochemistry study
LX-2 cells were stimulated for 24 h with TGFβ in the presence or absence of simvastatin. Cells were fixed in phosphate-buffered saline containing 4 % paraformalde-hyde at room temperature for 30 minutes and were pene-trated in blocking solution containing 0.3 % Triton X-100, and incubated overnight at 4 °C with either anti-alpha smooth muscle actin (anti-aSMA. 1:100, Sigma-Aldrich) or anti-KLF2 (1:100, Abcam) in 1 % BSA solution. Cells were then incubated with secondary antibodies for 1 h at 37 °C. After incubation, cell staining was observed in 10 fields of view at ×40 magnification. This experiment was conducted twice.
Western blotting analysis
HSC cells (1x104) were plated in six-well plates for 48 h and then harvested. Total protein was extracted, sep-arated on 10 % sodium dodecyl sulfate polyacrylamide gel electrophoresis gels and transferred to polyvinylidene fluoride membranes (Millipore, Bedford, MA). After blocking with 5 % non-fat dry milk in Tris-buffer solu-tion, membranes were probed with primary monoclonal antibodies specific to aSMA (1:1000; Sigma Aldrich), KLF2 (1:1000, Abcam), endothelial nitric oxide synthe-sis (eNOS), nuclear factor-kappa B (NF-kappaB; 1:1000, Santa Cruz), hypoxia inducible factor (HIF)-1a, and HIF-2a (1:1000, Sigma Aldrich). Horseradish peroxidase-con-jugated secondary antibodies (Beyotime) were then ap-plied, and blots were developed using the western blotting detection system.
Real-time polymerase chain reaction (PCR)
RNA was isolated from LX-2 cells using a Nucleospin RNAII kit (Takara) followed by reverse transcription with M-MLV reverse transcriptase according to the manufactur-er’s instructions (Takara). The primers used for KLF2 were as follows: Forward: AAGACCTACACCAAGAGTTCG; Reverse: CTACATGTGCCGTTTCATGTG. Expression of β-actin was amplified as an internal standard. All exper-iments were performed by the same investigator with no knowledge of the corresponding grouped data.
Statistical analysis
Quantitative results were expressed as means ± SD. Statistical analysis was assessed by the Student-t test (between two groups) or Student-Newman-Keuls test (among three or more groups), with SPSS 16.0 software (SPSS, Chicago, IL). A value of p < 0.05 was considered statistically significant.
RESULTS
Role of simvastatin in TGFβ-induced proliferation and migration of HSCs
We examined whether simvastatin could regulate the two principal indicators of HSC activation, proliferation and migration. TGFβ (10 ng/ml) was found to increase cell proliferation by 1.2-fold and migration by 3-fold com-pared with the control. Conversely, simvastatin (1 mm) significantly reduced HSC cell proliferation and migra-tory rates by about 50 % (Fig. 1). These data demonstrate the importance of simvastatin in TGFβ-mediated HSC proliferation and migration.
Effect of simvastatin on aSMA expression in TGFβ-activated LX-2 cells
aSMA is a major marker of HSC activation. We found that 10 ng/ml TGFβ promoted expression of aSMA twice that of the control, and 1 µM simvastatin suppressed upreg-ulation by 1.5 fold of the control (Fig. 2 A and B). Addition-ally, in LX-2 cells, aSMA was expressed in the cytoplasm according to immunohistochemistry (IHC) results (Fig. 2C).
KLF2 expression in HSCs
We found that simvastatin strongly promoted expression of KLF2 in HSCs. KLF2 mRNA levels increased approxi-mately 1.5-fold in HSCs treated with 1 µM simvastatin, in accordance with increased protein expression (Fig. 3A). In-
66 Q. MIAO ET AL. Rev esp enfeRm Dig (maDRiD)
Rev esp enfeRm Dig 2015; 107 (2): 63-71
duced by TGFβ, both mRNA and protein levels of KLF2 expression increased approximately 2-fold in HSCs, and in-terestingly, simultaneous addition of simvastatin caused ex-pression to increase approximately 4-fold (Fig. 3 A and B).
Localization of KLF2 using IHC revealed that KLF2 was barely detected in control HSCs, confirming lower expression of this transcription factor in control HSCs. When induced by TGFβ and simvastatin, KLF2 protein expression was specifically detected in the plasma of LX-2 cells (Fig. 3C).
KLF2-target protein expression
Analysis of KLF2-targeted genes and proteins in-volved in vascular physiology showed that, in the TGFβ
group, eNOS protein decreased compared with the con-trol, while HIF-1a, NF-κB and VEGF showed no differ-ence in TGFβ group. Interestingly, when simvastatin was added simultaneously, compared with the TGFβ group, eNOS expression increased while HIF-1a, NF-κB and VEGF decreased to different extents. Ang-2 showed no difference in 3 groups (Fig. 4A).
Inflammatory factor secretion
After treatment with TGFβ or TGFβ combined with simvastatin, HSC supernatants were harvested for ELI-SA detection. Our experiments demonstrated that INFγ was increased in TGFβ-induced HSC supernatants, but secretion was reduced when co-treated with simvasta-
Fig. 1. Inhibition of proliferation and migration by simvastatin (1 μM). HSCs were untreated (control), treated with 10 ng/ml TGFβ alone and treated with TGFβ combined with 1 μM simvastatin separately for 24 h. Spontaneous migration in serum-free medium served as the control. A. A representative migration image. B. Wound-healing and transwell assays were performed after treatment. C. A BrdU ELISA was performed to determine proliferation of cells. The experiment was repeated three times. Values represent means ± SD. *p < 0.05 vs. control. #p < 0,05 vs. TGFβ group.
A
B C
Vol. 107, N.º 2, 2015 SIMVASTATIN SUPPRESSES THE PROANGIOGENIC MICROENVIRONMENT OF HUMAN HEPATIC STELLATE CELLS VIA 67 THE KRUPPEL-LIKE FACTOR 2 PATHWAY
Rev esp enfeRm Dig 2015; 107 (2): 63-71
tin (Fig. 4B). There was no significant difference in pro-duction of IL-2, IL-4 and IL-5 between the three groups (data not shown).
DISCUSSION
PTH is initiated predominantly through intrahepatic vascular resistance. Recent data suggest that intrahepat-ic angiogenesis may also be involved in sinusoidal re-sistance and PTH (2,19). Angiogenesis is characterized by increased mural cell coverage of vessels by activated HSCs (1).
Recent advances suggest that HSCs are major con-tributors to angiogenesis (20). Activated HSCs prolif-erate, migrate and recruit to the surroundings of vessel lumen, thus providing durability to the vessels in a direct way. Conversely, indirect mechanisms are also likely to
be important and include the ability of HSCs to secrete angiogenic molecules, such as VEGF and Ang-2 (1,21). Additionally, activated HSCs release inflammatory medi-ators, which can elicit an angiogenic response through the induction of HIF-1a (22,23) and NF-κB transcriptional activity (2).
Statins are considered ideal drugs for PTH as they re-duce portal pressure by decreasing intra-hepatic vascular resistance (8,24-26). Some groups have previously inves-tigated the effect of statins on hepatic inflammation and fi-brosis (12). However, studies into the cellular mechanism of this effect are limited. Trebicka has shown that statins can decrease HSC contraction by a nitric oxide-indepen-dent mechanism (10). Other studies have demonstrated that statins can suppress HSC apoptosis (27); however, the exact effect of statins on the proangiogenic microen-vironment of HSC remains unclear. We aimed to inves-tigate the effect of statins on activation of HSCs and the
B
Fig. 2. Expression of aSMA protein in HSCs as determined by immunoblot. A and B. Fold differences between the control and representative western blots are shown. C. aSMA protein expression in HSCs with different treatments. Representative images were visualized with a light microscope and are shown with ×40 magnification. The experiment was repeated three times. *p < 0.05 vs. control; #p < 0.05 vs. TGFβ group; p < 0.05 vs. control; #p < 0.05 vs. TGFβ group.
A
C
B
68 Q. MIAO ET AL. Rev esp enfeRm Dig (maDRiD)
Rev esp enfeRm Dig 2015; 107 (2): 63-71
proangiogenic microenvironment. As TGFβ is the most potent cytokine known to activate HSCs and angiogenesis (28), this study is focused on the specific role of statins in TGFβ-induced HSCs.
Our study explored the multiple effects of the statin sim-vastatin, on TGFβ-activated HSCs. Treatment of HSCs with simvastatin influenced several parameters of TGFβ-induced HSCs activation, including a decrease in aSMA production and inhibition of HSC proliferation and migration. Previous research shows that statins can reduce activation of HSCs in vivo (10,29), and our results support that statins can also suppress TGFβ-induced HSCs activation in vitro.
A large number of studies have shown that KLF2, a vasoprotective transcriptional factor, is endothelial-spe-cific and its expression confers to endothelial protection against inflammation and negative regulation of angio-genesis (30-32). KLF2 can also modulate blood vessel maturation through smooth muscle cell migration (33). Previous studies have shown that simvastatin can potent-ly induce KLF2 in the vascular system (13,14,34,35), which may protect the normal endothelial phenotype and inhibit the angiogenic process. Studies have also shown that KLF2-overexpression happens in the vascu-lature of cirrhotic patients (36), in activated HSCs (37)
Fig. 3. A. Expression of KLF2 protein in HSCs determined by immunoblot. Fold changes between the control and representative western blots are shown. B. KLF2 gene mRNA expression level in HSC with different treatments. Values for KLF2 amplification from cell cDNA were normalized to an endogeneous reference gene. Fold changes compared with the control are shown. All data are shown as means ± SD of triplicates, and were measured twice. C. KLF2 protein expression in HSCs in different condition. Representative images were visualized with a light microscope and are shown at ×40 magnification. The experiment was repeated three times. *p < 0.05 vs. control; #p < 0.05 vs. TGFβ group; p < 0.05 vs. control; #p < 0.05 vs. TGFβ group.
A B
C
Vol. 107, N.º 2, 2015 SIMVASTATIN SUPPRESSES THE PROANGIOGENIC MICROENVIRONMENT OF HUMAN HEPATIC STELLATE CELLS VIA 69 THE KRUPPEL-LIKE FACTOR 2 PATHWAY
Rev esp enfeRm Dig 2015; 107 (2): 63-71
and in cirrhotic SECs (35). Marrone found that statins can promote angio-protective factors in SECs through the KLF2 pathway (16). Our study reports for the first time, that simvastatin upregulated protein expression of KLF2 in human HSCs, and that KLF2 was expressed both in the cytoplasm and nucleus. Interestingly, over-expression of KLF2 protein increased following TGFβ treatment, and the simultaneous addition of simvastatin made the increase more significant. This result suggests that the abundance of KLF2 protein may have a benefi-cial effect on the anti-angiogenic microenvironment of completely activated HSCs.
We also detected KLF2 target gene expression. Ex-pression of KLF2 is reported to stimulate eNOS expres-sion, which increases the bioavailability of vasodilators and reduces intrahepatic resistance (38-41). KLF2 can also potently suppress HIF-1a expression (42-44), which downregulates proangiogenic factors, such as VEGF and Ang-2. HIF-1a, conversely, promotes angiogenesis by stimulating the NF-κB-dependent inflammatory pathway (45,46). The present study investigated for the first time, the expression of angiogenesis-relevant proteins in HSCs. Our findings demonstrated that, TGFβ-induced HSCs ex-pressed high level protein NF-κB, HIF-1a and VEGF, but expression of eNOS decreased. Interestingly, simultane-ous addition of simvastatin suppressed the protein change
caused by TGFβ. Our results suggest that KLF2 overex-pression induced by simvastatin can suppress the increase of proangiogenic factors such as VEGF, NF-κB and HIF-1a, stimulated by TGFβ in HSCs. Moreover, simvasta-tin-induced KLF2 can promote production of eNOS, a vasodilative factor, which decreased in TGFβ-activated HSCs. Therefore, simvastatin inhibited the proangiogenic microenvironment of HSC by modulating KLF2 expres-sion and its downstream gene cascade.
Our study also highlighted some interesting inflam-matory mechanisms by which simvastatin leads to the suppression of TGFβ-induced activation in HSCs. For example, TGFβ stimulation also led to the upregula-tion of INFγ, an angiogenic cytokine and growth factor, while simvastatin inhibited upregulation of IFNγ. Some reports have demonstrated that INFγ is involved in an-giogenesis (47-49), but the exact mechanism remains unclear.
In summary, our data revealed that simvastatin inhib-ited TGFβ-induced migration, proliferation and activa-tion of HSCs, which might be a key mechanism for its inhibitory action on the direct proangiogenic interaction between HSCs and SECs. Additionally, simvastatin ex-erted anti-angiogenic function, which is associated with the expression of KLF2 and its downstream genes and proteins.
Fig. 4. Effect of simvastatin on KLF2 target protein expression and relevant factors. Cells were incubated either untreated, with TGFβ (10 ng/ml) alone or TGFβ combined with simvastatin (1 μM) for 24 h. Endothelial nitric oxide synthase (eNOS), angiopoietin (Ang-2), vascular endothelial growth factor (VEGF), hypoxia inducible factor-1a (HIF-1a) and nuclear factor-kappa B (NF-κB) protein expression were determined in HSCs under different conditions. A. Representative western blots of indicated proteins are shown. B. Level of IFNγ in HSC supernatants by ELISA. The experiment was repeated for 3 times in triplicate. *p < 0.05 vs. control; #p < 0.05 vs. TGFβ group. p < 0.05 vs. control; #p < 0.05 vs. TGFβ group. Values represent means ± SEM. Each experiment was repeated three times. *p < 0.05 vs. control; #p < 0.05 vs. TGFβ group. p < 0.05 vs. control; #p < 0.05 vs. TGFβ group.
A B
70 Q. MIAO ET AL. Rev esp enfeRm Dig (maDRiD)
Rev esp enfeRm Dig 2015; 107 (2): 63-71
ACKNOWLEDGMENTS
We thank Mei-Yu Hu and Jian-Jun Jin from the Bio-medical Research Center for their technical support and thank the Biomedical Research Center of Zhongshan Hospital for experimental equipment supply.
REFERENCES
1. Thabut D, Shah V. Intrahepatic angiogenesis and sinusoidal remod-eling in chronic liver disease: New targets for the treatment of portal hypertension? J Hepatol 2010;53:976-80.
2. Coulon S, Heindryckx F, Geerts A, Van Steenkiste C, Colle I, Van Vlierberghe H. Angiogenesis in chronic liver disease and its complica-tions. Liver Int 2011;31:146-62.
3. Dill MT, Rothweiler S, Djonov V, Hlushchuk R, Tornillo L, Terrac-ciano L, et al. Disruption of Notch1 induces vascular remodeling, intussusceptive angiogenesis, and angiosarcomas in livers of mice. Gastroenterology 2012;142:967-77.
4. Steenkiste CV, Ribera J, Geerts A, Pauta M, Tugues S, Casteleyn C, et al. Inhibition of placental growth factor activity reduces the severity of fibrosis, inflammation, and portal hypertension in cirrhotic mice. Hepatology 2011;53:1629-40.
5. Shi YF, Zhang Q, Cheung PY, Shi L, Fong CC, Zhang Y, et al. Effects of rhDecorin on TGF-beta1 induced human hepatic stellate cells LX-2 activation. Biochim Biophys Acta 2006;1760:1587-95.
6. Lee JS, Semela D, Iredale J, Shah VH. Sinusoidal remodeling and angiogenesis: A new function for the liver-specific pericyte? Hepatol-ogy 2007;45:817-25.
7. Bosch J, Abraldes JG, Fernandez M, Garcia-Pagan JC. Hepatic endothelial dysfunction and abnormal angiogenesis: New targets in the treatment of portal hypertension. J Hepatol 2010;53:558-67.
8. Huang HC, Wang SS, Lee JY, Chen YC, Lee FY, Lin HC, et al. Sim-vastatin effects on portal-systemic collaterals of portal hypertensive rats. J Gastroenterol Hepatol 2010;25:1401-9.
9. Trebicka J, Hennenberg M, Laleman W, Shelest N, Biecker E, Schepke M, et al. Atorvastatin lowers portal pressure in cirrhotic rats by inhi-bition of RhoA/Rho-kinase and activation of endothelial nitric oxide synthase. Hepatology 2007;46:242-53.
10. Trebicka J, Hennenberg M, Odenthal M, Shir K, Klein S, Granzow M, et al. Atorvastatin attenuates hepatic fibrosis in rats after bile duct ligation via decreased turnover of hepatic stellate cells. J Hepatol 2010;53:702-12.
11. Yang JI, Yoon JH, Bang YJ, Lee SH, Lee SM, Byun HJ, et al. Syn-ergistic antifibrotic efficacy of statin and protein kinase C inhibi-tor in hepatic fibrosis. Am J Physiol Gastrointest Liver Physiol 2010;298:G126-32.
12. Moreno M, Ramalho LN, Sancho-Bru P, Ruiz-Ortega M, Ramalho F, Abraldes JG, et al. Atorvastatin attenuates angiotensin II-induced inflammatory actions in the liver. Am J Physiol Gastrointest Liver Physiol 2009;296:G147-56.
13. Gracia-Sancho J, Russo L, Garcia-Caldero H, Garcia-Pagan JC, Gar-cia-Cardena G, Bosch J. Endothelial expression of transcription factor Kruppel-like factor 2 and its vasoprotective target genes in the normal and cirrhotic rat liver. Gut 2011;60:517-24.
14. Rossi J, Rouleau L, Tardif JC, Leask RL. Effect of simvastatin on Kruppel-like factor2, endothelial nitric oxide synthase and thrombo-modulin expression in endothelial cells under shear stress. Life Sci 2010;87:92-9.
15. Parmar KM, Nambudiri V, Dai G, Larman HB, Gimbrone MJ, Garcia-Cardena G. Statins exert endothelial atheroprotective effects via the KLF2 transcription factor. J Biol Chem 2005;280:26714-9.
16. Marrone G, Russo L, Rosado E, Hide D, Garcia-Cardena G, Garcia-Pagan JC, et al. The transcription factor KLF2 mediates hepatic endothelial protection and paracrine endothelial-stellate cell deacti-vation induced by statins. J Hepatol 2013;58:98-103.
17. Kawanami D, Mahabeleshwar GH, Lin Z, Atkins GB, Hamik A, Hal-dar SM, et al. Kruppel-like factor 2 inhibits hypoxia-inducible fac-
tor 1alpha expression and function in the endothelium. J Biol Chem 2009;284:20522-30.
18. Wu J, Bohanan CS, Neumann JC, Lingrel JB. KLF2 transcription fac-tor modulates blood vessel maturation through smooth muscle cell migration. J Biol Chem 2008;283:3942-50.
19. Rosmorduc O. Antiangiogenic therapies in portal hypertension: A breakthrough in hepatology. Gastroenterol Clin Biol 2010;34:446-9.
20. Das A, Shergill U, Thakur L, Sinha S, Urrutia R, Mukhopadhyay D, et al. Ephrin B2/EphB4 pathway in hepatic stellate cells stimulates Erk-dependent VEGF production and sinusoidal endothelial cell recruit-ment. Am J Physiol Gastrointest Liver Physiol 2010;298:G908-15.
21. Zhao Y, Wang Y, Wang Q, Liu Z, Liu Q, Deng X. Hepatic stellate cells produce vascular endothelial growth factor via phospho-p44/42 mitogen-activated protein kinase/cyclooxygenase-2 pathway. Mol Cell Biochem 2012;359:217-23.
22. Copple BL, Bai S, Burgoon LD, Moon JO. Hypoxia-inducible factor-1alpha regulates the expression of genes in hypoxic hepatic stellate cells important for collagen deposition and angiogenesis. Liver Int 2011;31:230-44.
23. Troeger JS, Schwabe RF. Hypoxia and hypoxia-inducible factor 1alpha: Potential links between angiogenesis and fibrogenesis in hepatic stellate cells. Liver Int 2011;31:143-5.
24. Bosch J, Abraldes JG, Fernandez M, Garcia-Pagan JC. Hepatic endothelial dysfunction and abnormal angiogenesis: new targets in the treatment of portal hypertension. J Hepatol 2010;53:558-67.
25. Abraldes JG, Albillos A, Banares R, Turnes J, Gonzalez R, Garcia-Pagan JC, et al. Simvastatin lowers portal pressure in patients with cirrhosis and portal hypertension: A randomized controlled trial. Gas-troenterology 2009;136:1651-8.
26. Vuppalanchi R, Chalasani N. Nonalcoholic fatty liver disease and non-alcoholic steatohepatitis: Selected practical issues in their evaluation and management. Hepatology 2009;49:306-17.
27. Aprigliano I, Dudas J, Ramadori G, Saile B. Atorvastatin induces apop-tosis by a caspase-9-dependent pathway: An in vitro study on activated rat hepatic stellate cells. Liver Int 2008;28:546-57.
28. Hayashi H, Sakai T. Biological significance of local TGF-beta Activa-tion in liver diseases. Front Physiol 2012;3:12.
29. Trebicka J, Hennenberg M, Laleman W, Shelest N, Biecker E, Schepke M, et al. Atorvastatin lowers portal pressure in cirrhotic rats by inhi-bition of RhoA/Rho-kinase and activation of endothelial nitric oxide synthase. Hepatology 2007;46:242-53.
30. SenBanerjee S, Lin Z, Atkins GB, Greif DM, Rao RM, Kumar A, et al. KLF2 Is a novel transcriptional regulator of endothelial proinflam-matory activation. J Exp Med 2004;199:1305-15.
31. Lin Z, Kumar A, SenBanerjee S, Staniszewski K, Parmar K, Vaughan DE, et al. Kruppel-like factor 2 (KLF2) regulates endothelial throm-botic function. Circ Res 2005;96:e48-57.
32. Boon RA, Fledderus JO, Volger OL, van Wanrooij EJ, Pardali E, Weesie F, et al. KLF2 suppresses TGF-beta signaling in endotheli-um through induction of Smad7 and inhibition of AP-1. Arterioscler Thromb Vasc Biol 2007;27:532-9.
33. Wu J, Bohanan CS, Neumann JC, Lingrel JB. KLF2 transcription fac-tor modulates blood vessel maturation through smooth muscle cell migration. J Biol Chem 2008;283:3942-50.
34. Tuomisto TT, Lumivuori H, Kansanen E, Hakkinen SK, Turunen MP, van Thienen JV, et al. Simvastatin has an anti-inflammatory effect on macrophages via upregulation of an atheroprotective transcription fac-tor, Kruppel-like factor 2. Cardiovasc Res 2008;78:175-84.
35. Gracia-Sancho J, Russo L, Garcia-Caldero H, Garcia-Pagan JC, Gar-cia-Cardena G, Bosch J. Endothelial expression of transcription factor Kruppel-like factor 2 and its vasoprotective target genes in the normal and cirrhotic rat liver. Gut 2011;60:517-24.
36. Kobus K, Kopycinska J, Kozlowska-Wiechowska A, Urasinska E, Kempinska-Podhorodecka A, Haas TL, et al. Angiogenesis within the duodenum of patients with cirrhosis is modulated by mechano-sensitive Kruppel-like factor 2 and microRNA-126. Liver Int 2012; 32:1222-32.
37. Das A, Shergill U, Thakur L, Sinha S, Urrutia R, Mukhopadhyay D, et al. Ephrin B2/EphB4 pathway in hepatic stellate cells stimu-lates Erk-dependent VEGF production and sinusoidal endothelial cell recruitment. Am J Physiol Gastrointest Liver Physiol 2010; 298:G908-15.
Vol. 107, N.º 2, 2015 SIMVASTATIN SUPPRESSES THE PROANGIOGENIC MICROENVIRONMENT OF HUMAN HEPATIC STELLATE CELLS VIA 71 THE KRUPPEL-LIKE FACTOR 2 PATHWAY
Rev esp enfeRm Dig 2015; 107 (2): 63-71
38. Huang HC, Chang CC, Wang SS, Lee FY, Teng TH, Lee JY, et al. The roles of angiotensin II receptors in the portosystemic collaterals of portal hypertensive and cirrhotic rats. J Vasc Res 2012;49:160-8.
39. Sakamoto M, Nakamura T, Torimura T, Iwamoto H, Masuda H, Koga H, et al. Transplantation of EPCs ameliorates vascular dysfunction and portal hypertension in CCl(4) -induced rat liver cirrhotic model. J Gastroenterol Hepatol 2013;28:168-78.
40. Sato Y, Sawada S, Kozaka K, Harada K, Sasaki M, Matsui O, et al. Sig-nificance of enhanced expression of nitric oxide syntheses in splenic sinus lining cells in altered portal hemodynamics of idiopathic portal hypertension. Dig Dis Sci 2007;52:1987-94.
41. Goh BJ, Tan BT, Hon WM, Lee KH, Khoo HE. Nitric oxide synthase and heme oxygenase expressions in human liver cirrhosis. World J Gastroenterol 2006;12:588-94.
42. Mahabeleshwar GH, Qureshi MA, Takami Y, Sharma N, Lingrel JB, Jain MK. A myeloid hypoxia-inducible factor 1alpha-Kruppel-like fac-tor 2 pathway regulates gram-positive endotoxin-mediated sepsis. J Biol Chem 2012;287:1448-57.
43. Chakroborty D, Sarkar C, Yu H, Wang J, Liu Z, Dasgupta PS, et al. Dopamine stabilizes tumor blood vessels by up-regulating angiopoi-etin 1 expression in pericytes and Kruppel-like factor-2 expression in tumor endothelial cells. Proc Natl Acad Sci U S A 2011;108:20730-5.
44. Kawanami D, Mahabeleshwar GH, Lin Z, Atkins GB, Hamik A, Hal-dar SM, et al. Kruppel-like factor 2 inhibits hypoxia-inducible fac-tor 1alpha expression and function in the endothelium. J Biol Chem 2009;284:20522-30.
45. Rosmorduc O, Housset C. Hypoxia: A link between fibrogenesis, angiogenesis, and carcinogenesis in liver disease. Semin Liver Dis 2010;30:258-70.
46. Li BY, Wang LN, Yue XQ, Li B. Characteristics of sublingual vein and expressions of vascular endothelial growth factor and hypoxia-inducible factor 1alpha proteins in sublingual tissues of Beagle dogs with portal hypertension. Zhong Xi Yi Jie He Xue Bao 2009;7:463-7.
47. Kitajima K, Miura S, Mastuo Y, Uehara Y, Saku K. Newly developed PPAR-alpha agonist (R)-K-13675 inhibits the secretion of inflamma-tory markers without affecting cell proliferation or tube formation. Atherosclerosis 2009;203:75-81.
48. Azizan A, Sweat J, Espino C, Gemmer J, Stark L, Kazanis D. Differ-ential proinflammatory and angiogenesis-specific cytokine production in human pulmonary endothelial cells, HPMEC-ST1.6R infected with dengue-2 and dengue-3 virus. J Virol Methods 2006;138:211-7.
49. Lee H, Baek S, Joe SJ, Pyo SN. Modulation of IFN-gamma production by TNF-alpha in macrophages from the tumor environment: Signifi-cance as an angiogenic switch. Int Immunopharmacol 2006;6:71-8.
top related