poland - a country in central europe molecular … · molecular phylogeny of insects, mainly...

Poland - a country in central Europe

Molecular phylogeny of insects, mainly Orthoptera

Beata Grzywacz JSPS Postdoctoral Fellow

University of the Ryukyus, Okinawa 2016

Poland – general information

• Located in central Europe • Area: 312 685 km2

• Capital: Warsaw • Population: 38 495 659 (2014) • Official language: Polish • Currency: Polish Złoty PLN • Major religion: Christianity

Poland – general information

• Vistula (651mi; 1,047 kilometres long) and Oder (480 mi; 772 kilometres long) – the longest rivers • Lake Śniardwy and Lake Mamry in Masuria, Lake Łebsko and Lake Drawsko in Pomerania – the largest lakes • Polish Tatras – the highest mountain group of Poland • Beskids - the second highest mountain group in Poland • Bieszczady mountains

Poland - Phylogeography

Wisent in the ancient woodland of the Białowieża Forest and in Podlaskie Brown bear in Białowieża, in the Tatras, and in the Beskids The gray wolf and the Eurasian lynx in various forests The moose in northern Poland The beaver in Masuria, Pomerania and Podlaskie Red deer, roe deer and wild boars Migratory birds

Famous Polish People

Lech Wałęsa president, activist (1943 -)

Fryderyk Chopin pianist, composer (1810-1849)

Marie Skłodowska-Curie physicist (1867-1934)

Nicolaus Copernicus astronomer, scientist, mathematician (1473-1543)

John Paul II pope (1920-2005)

Polish inventions

Hand-held mine detector Cloth armor Colorful photo Mine detector Helicopter Car wiper Grafen Kerosene lamp Melex Walkie-talkie

Polish Nobel Prize Lauerates 1903 Maria Skłodowska-Curie - Physics 1905 Henryk Sienkiewicz - Literature 1911 Maria Skłodowska-Curie - Chemistry 1924 Władysław Reymont - Literature 1980 Czesław Miłosz - Literature 1983 Lech Wałęsa - Peace 1996 Wisława Szymborska - Literature

Polish Architecture

Great Armory building in Gdańsk

The Palace of Culture and Science in Warsaw

Wawel Royal Castle and Catedral in Krakow

The Manggha Centre of Japanese Art and Technology in Krakow

Centennial Hall in Wrocław Wieliczka Royal Salt Mine

The Polish national dishes

Sausage Broth (variety of meat broth)

Bigos

Dumplings Tomato soup

Gołąbki (type of cabbage roll)

Pork chop (type of breaded cutlet) Żurek (sour rye soup) Cucumber soup

Polish products

Oscypek

Krosno Stylish glass

Prince Polo

White cheese Marshmallow

Fudges

Bagels

My Institute

Name: Institute of Systematics and Evolution of Animals Polish Academy of Sciences, Krakow Funded: 1989 Department: Experimental Zoology

Why I choose to be a scientist?

I really enjoyed science at school. I am interested in the world we live in. The opportunity to discover something new is also really exciting. I’d definitely recommend it.

Studies insects

?

Orthoptera • Grasshoppers, locusts, crickets,

katydids

• Long bodies

• Rear legs modified for jumping

• Females with egg laying tube (ovipositor on end of abdomen)

• Often communicate with chirping sounds

Orthoptera

Introduction ?

B. constrictus, fot. P. Schlemmer

M. ornatus, fot. V. Hanzlík

Lepthophyes sp., fot Oldbilluk

• insufficient knowledge on the taxonomically important characters • uninformative descriptions based on subtle differences • overstating the isolation significance • working into national borders

Methodological problems arise

• morphologic simplicity in genitalia, tegminal venation and cercus shape • often high number of sibling taxa with restricted ranges • recent origin

Peculiarities of the group

Theoretical problems arise

• taxa with doubtful status described • unclear phylogenetic relationships between the taxa

Why is phylogeny important?

Understanding and classifying the diversity of life on Earth. Testing evolutionary hypotheses: - trait evolution - coevolution - mode and pattern of speciation - correlated trait evolution - biogeography - geographic origins - age of different taxa - nature of molecular evolution - disease epidemiology …and many more applications!

Molecular methods

1. Extract 2. Sequence (e.g. 18S and internal transcribed spacer 2 -

ITS2)

AAGCTTCATAGGAGCAACCATTCTAATAATAAGCCTCATAAAGCC

AAGCTTCACCGGCGCAGTTATCCTCATAATATGCCTCATAATGCC 3. Align

DNA

What is DNA? DNA (dexyribonucleic acid) contains the biological instructions that make each species unique.

What is DNA made? DNA is made of three parts: a phosphate group, a sugar group and one of four types of nitrogen bases).

What does DNA do? DNA contains instructions needed for an organism to develop, survive and reproduce.

How to extract DNA from animal tissue in laboratory?

PCR and sequencing

Molecular data vs Morphology

Strictly heritable entities Can be influenced by environmental factors

Data is unambiguous Ambiguous modifiers: “reduced”, “slightly elongated”, “somewhat flattened”

Regular & predictable evolution Unpredictable evolution

Ease of homology assesment Homology difficult to assess

Relationship of distantly related Only close relationships

organisms can be inffered can be confidently inffered

Why such studies are important?

preparing key to help recognize insects and distribution maps taxa have been synonimized

a revision of the orthoptran taxonomy

new taxa have been investigated

Let’s do the experiment!

Place one starwberry in a plastic zipper-lock bag

Add of DNA extracting solution

Place a piece of gauze over the opening. Of the cup, securing with a rubber band. Carefully pour the starwberry mixture into the cup.

Add a dropper full of the alcohol to the test tube. Do not mix the liquids.

Strawberry DNA extraction

DNA

Appreciation

to JSPS for giving me this great opportunity to my supervisor, Haruki Tatsuta for his continued assistance, cooperation and support to the Science Dialogue Coordinator for making all necessary arrangement to make this day reality

to my wonderful audience – The Students!

Arigato gozaimasu!!!