october 31, 2012
Post on 29-Mar-2016
220 Views
Preview:
DESCRIPTION
TRANSCRIPT
S H U S W A PS H U S W A P
REAL ESTATE WEEKLYREAL ESTATE WEEKLY
A publication of the
PROFESSIONALS
who will help you
find the right home
Printed in partnership with Shuswap Zone - Okanagan Mainline Real Estate Board
October 31 & November 2, 2012October 31 & November 2, 2012
P2 www.saobserver.net Wed. & Fri., October 31 & November 2, 2012 Salmon Arm Observer & Shuswap Market News
250.833.2062Marg Kentel
www.margkentel.com marg.kentel@century21.ca
LOTSLOTS
MLS® 10044076 $99,800
LOT 23 VALLEY PLACE, BLIND BAYBeautiful, level building lot in Shuswap Lake Estates. Nice building site in a quiet cul-de-sac. Close to golf and only minutes to lake access. Services at lot line.
MLS® 10051830 $119,900
LOT 2 1130 0LD AUTO ROAD SESimplicity is the appeal of this economical lot. Plan available to construct basement entry design with potential of a one bdrm. suite in the lower level. Great location, close to schools, town and recreation.
MLS® 10053358 $179,000
260 BEATTY AVENUE NWFully serviced .32 acre commercial lot in Salmon Arm’s Harbourfront area. This fl at, corner lot allows great visibility and access. Location, location, location!
MLS® 10053361 $159,900
351 BEATTY AVENUE NWFully serviced 50x125 commercial lot in Salmon Arm’s popular Harbourfront area. Flat, accessible, visible and great location.
Cell 250.804.7955 www.LisaSells.calisa.butler@century21.ca
Lisa ButlerReal Estate Professional
LIFESTYLES
When you want to Sell ...
Call the Butler!facebook.com/www.LisaSells.caLisa Butler Real Estate Agent
Cell 250.804.7955Offi ce 250.832.6060
Toll Free 1.800.830.0545lisa.butler@century21.ca
www.LisaSells.ca
Need a quick sale?Call me!
Free Market
Evaluation
✁
618040 Street NWSalmon Arm
2601Willowbrae Dr.,
Kamloops
$$217,500217,500
$$549,900549,900
#3 - 1431Auto Road SESalmon Arm
SOLD!SOLD!
SOLD!SOLD! SOLD!SOLD!
2414 Mt. Tuam Cres.
Blind Bay
A Haven Nestled In 4-Season Recreation Paradise - Beautiful Salmon Arm! Townhome in family friendly Orchard Grove ~ New again with heritage features! New solid wood maple cabinets in kitchen. Rustic vinyl planking fl oors. 3 bdrm., 2 baths.
An exceptional 180 debree lake view, modern (2010) home by Stillwater Design. Bird sanctuary, nature trail and Shuswap Lake
MLS® 10049494
3211 18 Avenue NE, Salmon Arm
MLS® 10046208
1060 47 Avenue NE, Salmon Arm
SOLD!SOLD!
New Price
NEW
LISTIN
G
250 832-7871 250 833-2088 • 1-800-890-9166
johng2@shaw.caCell 833-2088
66HIGHER
STANDARDS
If it is privacy you are looking for this is the home for you. 1 acre, lakeview, 3 bedroom 3 bathroom home in Magna Vista Estates, propane forced air heat and woodstove.
#25 - 6471 Lindsay Road
$259,000MLS® 10036389
Semi-lakeshore only steps to swimming beach, 3 bedroom, 2 full bathrooms, large 27’x12’ deck with glass railings to enjoy the view. Carport, park area behind unit, Garden shed, close to clubhouse and boat launch.
#83 Sorrento Place
MLS® 10041920 $224,500
VIEW, VIEW, VIEW!VIEW, VIEW, VIEW!Location and lakeview speak for itself. The home you’ve been hoping for! New paint & fl ooring. 4 bdrms., 2 baths, near schools, short stroll to Little Mtn. Park. Must be seen to be appreciated.
3221 Okanagan Avenue NE
$298,000MLS® 10052139
New Rancher with unfi nished B/smt, 1229 sq ft, Open concept great room, 2 bedroom, 2 bathroom, Extra parking, Rustic Birch Cabinets, 45+, HST and kitchen appliances included. Comes with 2-5-10 new home warranty.
#10-2850 7th Ave. NE
MLS® 10038125 $312,000NEW PRICE
Lakeview from this 2 bed, 1 bath with newer windows and siding, covered deck/sunroom, 2 garden sheds, short walk to lake, boat launch, beach and clubroom in the 55+ Park. Pad rent is $460 per month.
#40 Sorrento Place
MLS® 10052633 $28,300
Neat as a pin! 2 bedroom, 1 bath doublewide – must be seen to be appreciated in this 55+ park. Lakeview, close to boat launch, clubhouse and looking on to the greenspace.
#101 Sorrento Place
$119,500MLS® 10055198NEW LIS
TING
Salmon Arm Observer & Shuswap Market News Wed. & Fri., October 31 & November 2, 2012 www.saobserver.net P3
Your Real Estate Professional
ale
Y
ochelle
SHUSWAP®
1111 Lakeshore Drive SW, Salmon Arm 250-832-7051cell: 250-804-9327 • www.rochelledale.comEach offi ce independently owned and operated
mls® 10007201mlsmls® 10 10007007201201®
4531 Auto Road SERancher/.76 Ac. Lot
mls®10055371$254,900
• 3 bdrm., 1 bath home• 1,000 sq. ft., some recent
renos• .76 acre lot• Access off two roads• Near Industrial Park,
perfect location for a home-based business
1780 16th Street NE
mls® 10053956
$299,900
Location/Lakeview
• 3 bdrm., 2 bath on .38 acre lot
• Backs onto park• Renovate kitchen,
covered deck• Incredible lakeview
#138 Evergreen MHP
mls® 10053524
$58,900
Affordable• 2 bdrm. 14x70• New roof,
furnace, central air
• All appliances, shed, covered deck
mls® 10007201mlsmlsmls® 10 100070077201201®
SunnybraeProperties
mls® 10043073$364,900
• 4 bdrm., 3 bath• Stunning lakeview,
.32 acre lot• RV parking• Spacious fl oorlan,
sunroom
3681 Braelyn Road
MacArthur Heights ~ The Summit
Starting at $175,000
This View Could be Yours!New 10 lot subdivision in MacArthur Heights. Breathtaking lakeviews, natural gas, Hydro, water and telephone are available. Quiet setting in an area of prestigious homes. Lots of elbow room between neighbours. Lot sizes vary from 2.5 to 4 acres.
7080 54th Street NEParklike Setting
mls® 10054909
$279,900
• Older well maintained 3 bedroom, 1 bath home
• .76 acre fl at lot, backs onto Canoe Creek• Covered parking fortoys, shop
mls® 10007201mlsmlsmls® 10 10007007201201®
1950 19th Avenue SEGreat Family Home
mls® 10054907$379,900
• 4 bedroom, 3 bath in Hillcrest area
• Large kitchen with oak cupboards
• Hardwood fl ooring, N/G fi replace
• Flat, fenced lot with u/g sprinklers and RVparking
New List
ing
mls® 10007201mlsmlsmls® 10 10 10007007007201201201®
750 2nd Avenue NEHeritage Home
mls® 10054928$309,900
• Charming heritage home on .22 of an acre
• 2 bdrm. plus den, 2 bath, hardwood fl oors
• 9 foot ceilings, private lot
New List
ing
#2 - 51 - 8th Avenue SW
mls® 10050789
$264,900
55+ Living• 3 bdrm., 2 full
baths• Single garage plus
carport• Master on main
fl oor• Patio
New Price
3885 Sunnybrae-Canoe Pt. Rd.
mls®10043765
Semi-Waterfront• Stunning 2300 sq. ft. home
• 3 bdrm. + den, 2 1/2 baths
• Engineered hardwood, granite counters
• Landscaped, fenced, 12x12 shop, .32 acre lot
• Extra lane access$549,900
ue SSSSSSSSSSSSSSS55555555555555555555555555555555555555555+++++++++++++++++++++ LiLiLiLiLiLiLiLiLiLiLiLiLiLiLiLiLiLiLiLi
• 3 bbbbbbdbddddddbddbbbddddb rmmmmmmmmmmmmmmmmmmmmm.,,,,,,,,,,,,, 2 fffffffffffffffffffubabaaaaaaatthhhhhhhhhhhhhhhhhthhhs
• SSSSSSSSiSiSiSiSiSiSSSiSiSSSS ngngngngngngngngnnngngngngngngngngngngnglelelelelelelelelelelelelelele ggggggggccccccccSOLD
HeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHHH iririririririiririiririiririririririritattatatatatatatatatatatatatattagegegegegegegegegeegegeegegegege HHH HH HHH H H H H H HH HH HH HH••••••••• C••••••• haaararrrrrarararrrrarrrrarrrmiiiiiininnniiiininiiiiiii gggg g g hg g g g gg g g g g g g g errrrrerrrrrrrrrrrrrririr
hommmmmmmmmmmmmmmmme oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe on .n .n .n .n .n .n .n .n .n .nnn .n .n .nn .n .22 222222 22 22 22 2222 22 222222 oooofooooacacrcrcrcrcrcrcrcrcrcrcrcrcrcrcrcrcrcrcrcreeeeeeeeeeeeeeeee
• 2• 2• 2• 2• 2• 2• 2• 2• 2• 2• 2• 2• 2• 2• 2• 2• 2• 2• 2• 2• 2 bd bd bd bd bd bd bdbdbddbdbdbd bd bd bd bdbdbdddrmrmrmrmrmrmrmrmrmrmrmrmrmrmrmrrrbbbbbbbbbbSOLD
mls® 10007201mlsmlsmls® 10 10 10007007007201201201®
220 Okanagan Avenue SEC-2 Zoned
mls® 10052703$320,000
• Perfect lot for commercial on the main and residential above also has lane access.
• 50 x 100 lot
#206 160 5th Avenue SW
mls® 10049066
$179,900
Corner Unit in Secure Building
• 2nd fl oor corner unit in The Okanagan
• 2 spacious bedrooms• N/gas fi replace, maple
cupboards in kitchen, deck, A/C
• All appliances
New Price
250.833.2062Marg Kentel www.margkentel.com
marg.kentel@century21.ca
Are you looking for more room? Come and view this 5 bdrm, 2 bath home on .76 acre. Home was totally renovated in 2009. Open concept fl oor plan. Dream kitchen with large island and lots of storage. Huge deck for entertaining and summer living. Shop/garage has extra storage on both sides. Lots of open parking for extra vehicles and toys. Fenced garden space. Fruit trees, raspberries, strawberries and more for you and your family to enjoy. Close to public beach and schools.
5881 71ST AVENUE NE
MLS® 10052008 $344,400
This home is currently known as Turner Creek Bed & Breakfast. Centrally located on a .34 acre lot bordering Turner Creek Trail and amenities. Major renovations downstairs include two rental units each with bdrm, bath and LR. Separate walkout entrance to private yard with waterscape and fruit trees. Main fl oor features a third rental unit with bdrm, bath and LR and a fourth rental unit has bdrm, bath, sunroom and kitchen. Main fl oor could be used as a 2 bdrm, 2 bath residence. Zoned R4 and has all approvals from the City.
631 21ST SREET NE
MLS® 10048052 $379,000
Great lakeview. Bright, clean and spacious 3 bdrm., 3 bath home in adult-oriented community. Eating nook, large dining room, natural gas fi replace, main fl oor laundry, family room, games room, loads of storage and full, fully fi nished, walkout lower level. Attached, single garage, and private, fully landscaped yard. Close to walking trails, downtown, shopping and other amenities.
7 - 1120 12TH STREET NE
MLS® 10053261 $379,000
MLS® 10029214 $998,000
3800 HURSTFIELD RD., EAGLE BAYGorgeous lakeview. 4 bdrm, 3.5 bath home on approximately 124 acres of Paradise. Wonderful view property, perfect for development or a great investment as a holding property for a single or group purchase. Fishing and hunting at your back doorstep. Adjacent to crown land, offering endless fun on your ATV, mountain bike or hiking. Only half an hour to Salmon Arm and an hour to Kamloops. Good potential to be set up as a bed and breakfast.
MLS® 10051095 $419,900
641 8TH AVENUE SEGorgeous lake and town view. This 2800 sq.ft. home has 3 bdrms, 3 full baths, and is on a quiet no thru road, only minutes to downtown. Hardwood, laminate, and ceramic tile fl ooring. Full, fully fi nished lower level that can easily be modifi ed for a suite. Main fl oor laundry, central air, security system, steam bath and loads of storage. Large master bedroom with ensuite and soaker tub. Double garage, fully landscaped yard and 3 decks. On a short street surrounded by protected parkland and wooded area with no neighbors to the rear.
Panoramic lakeview. Gorgeous, nearly new, custom 4 bdrm plus den, 3 bath home with geothermal heating. Gourmet kitchen features quartz countertops, island with glass cooktop, double wall ovens, fl oor to ceiling pantry, and maple hardwood fl oors. Master suite has in-fl oor heat, double glass shower and hot tub. Lifetime European windows, in-fl oor heating throughout the lower level, built in vacuum, large covered patio with natural gas bbq, and a covered front deck to enjoy the magnifi cent lakeview. This executive home is situated on a large, private, beautifully landscaped lot with waterfall, u/g sprinklers including drip system, heated driveway and large oversized garage. MLS® 10053075 $649,000
1811 28TH AVENUE NE
P4 www.saobserver.net Wed. & Fri., October 31 & November 2, 2012 Salmon Arm Observer & Shuswap Market News
Free Real Estate Evaluations
Call: 250-832-0111OPEN 7 DAYS A WEEK
Visit Assist-2-Sell online at www.4ShuswapHomes.com
Serving the South Shuswap
since 2008Doug Hubscher
Full MLS® Service for ONLY
$3,995Paid at closing when Assist-2-Sell represents all parties to the sale.Rates vary for properties over $400,000.
PERFECT COMMUNITYPERFECT LOCATION
$335,000MLS® 10025035
• Popular adult strata on the Golf Course
• Spacious main fl oor 1 bdrm and 1 1/2 bath
• Vaulted ceiling, patio, mountain views
• Basement 1 bdrm, 1 bath complete guest in-law suite
~ Blind Bay ~~ Blind Bay ~
PANABODE LOG HOME ON 5 AC.
$399,900MLS® 10050575
• 3 bdrms., 2 bathrooms, good water
• Country kitchen wood stove• European style windows and
doors• Post & beam design, covered
deck• Carport and fruit trees
~ Ranchero ~~ Ranchero ~
LOCATION, LOCATION, LOCATION
$339,900MLS® 10054459
• Great family home 3 bedrooms, 2 1/2 bathrooms
• Subdividable lakeview lot• Walk-out basement with suite-
able potential• New roof 4 years ago, quick
possession• Quiet no thru road, near
schools, college, walking trails, tennis courts, etc.
~ Salmon Arm NE ~~ Salmon Arm NE ~
SUPERBLAKEVIEW
$449,000MLS® 10053778
• 1989 3 bedrooms, 2 1/2 bathrooms
• New roof, eavestrough and paint
• Private room with hot tub• Fireplace, covered veranda and
patio• Near Cedar Heights Hall, golf,
beach and boating
~ Blind Bay ~~ Blind Bay ~
PICTURE PERFECTLAKEVIEW
$529,900MLS® 10048017
• Carefully designed and Custom built
• 5 bdrm, 3 bathroom on 0.44 acre lot
• Quality thoughout, hardwood and tile fl oors
• Maple kitchen with breakfast bar• Fireplace, garage, workshop,
sundecks
~ Blind Bay ~~ Blind Bay ~
QUIET AREA CLOSE TO NATURE, LAKE AND
VALLEY VIEWS
$599,900MLS® 10046042
• 5 acres, pasture, creek, tennis court
• 2006 3 bdrms., 3 bathrooms, 2700 sq. ft. passionately built with attention to detail
• Spectacular lake, city and valley views
• Indoor riding arena or explore the Fly Hills
~ SW Salmon Arm ~~ SW Salmon Arm ~
~ Canoe Cr. Estates ~~ Canoe Cr. Estates ~
JUST THE PLACEFOR YOU
$160,000MLS® 10049071
• 4 Bdrms., 2 baths with addition
• On quiet cul-de-sac• New furnace and hot
water tank• New stainless steel
kitchen appliances
SORRENTO HEIGHTS MOBILE HOME PARK
$70,000MLS® 10049798
• Marvelous panoramic lake view
• 3 bdrms, 2 bath, 1993 single wide
• Paved driveway, 10x47 wood deck
• No neighbors on either side• Quick possession
~ Sorrento ~~ Sorrento ~
NEW
PRICE
~ SE Salmon Arm ~~ SE Salmon Arm ~
BAYVIEWON 17th
$218,000MLS® 10051738
• Nice 2 bdrm., 2 bathrm townhouse
• Single car garage + outside parking
• Pleasant patio off dining room
• Fireplace, storage locker• Pets allowed with
restrictions
WELL CAREDFOR HOME
$290,000MLS® 110053390
• 3 Bdrms, 2 bathrms, Central air conditioning
• New High effi ciency furnace• Large 18’x20’ covered deck• 16’x21’ heated workshop/
garage• Carport, paved parking
~ SE Salmon Arm ~~ SE Salmon Arm ~
COZY 3 BEDROOM HOME IN TOWN
$178,000MLS® 10027037
• Close to all amenities• Mail and city transit
almost at your door step
• Electrical and plumbing updated
• Full walkout basement with new windows
~ Salmon Arm ~S l AS l A
REDUCED
Salmon Arm Realty.comSalmon ArArArAAr RRm Rm Rm Rm RReeaealty com
Always in Action
Email: dericcsan@homelifebc.comCell: 804-8333 • Toll Free 1-800-890-9166
• Bus: 250-832-7871 • Fax: 250-832-7573
4 Bedroom, 2 Bath (Brand • New 2 Piece Ensuite).Major Updates Include: Roof, • Windows, Siding,Gutters, Laminate Flooring, • Paint. Covered Rear Deck.Landscaped & Fenced Yard • makes Safe for Kids.Walk to Schools, Shopping, • Recreation & Amenities.
Fully Serviced Mostly Level 1 • Acre Lot in Notch Hill.Drilled Well, Septic System in! • Phone & Hydro at Lot.Private & Quiet. Building • Spot(s) Cleared among Tall Trees.Close to Amenities. Bonus: • Mobile Homes Permitted!!
.27 Acre Quality Building Lot in • Prestigious “Highlands”Overlooks Shuswap lake Estates • Golfcourse & Copper Island.Beach, Marina, Pub, Shopping, Golf • Club & Sorrento Nearby.Only 15 minutes to Salmon Arm. Inquire • on Free Golf Membership!Bring your Dreams, Builder, Golf Clubs • & Offer to Enjoy the Shuswap!
1/2 acre Unique Circular Lot and • Cabin at Queest Village.New Quality Docks & Boat Slip • Prepaid by Owner (Gotta See!).On Community Water System • (Septic in) Very Low Strata Fees.Room for your Water Toys in • Summer and Snow Toys in Winter.Access by Boat or Logging Road. • Priced to Sell!!
$59,000 $120,000 $129,500 $209,500MLS® 10045978 MLS® 10046728
MLS® 10041952MLS® 10040884
Welcome to #14 Evergreen MHP Welcome to #1435 Taylor Road Look at this Awesome Lakeview of Blind Bay! Shuswap Waterfront Park gives Lifetime Memories
Bob Cliffe (250) 804-3043Dee Crinion (250) 803-8600
Your Real Estate Consultants for Life.Team Shuswap
Each offi ce is independentlyowned and operated
ShuswapShuswap
®
Linda Cliffe, Unlicensed Assistant
®
MLS® N217103 $225,000
Bridge Lake…
Rare 2+ ac. waterfront property facing due west on Bridge Lk. 3/4 fenced with driveway in to bldg. site. Gravelly shoreline and crystal clear water. One of the South Cariboo’s most desired lakes! Lot is approved for a conventional septic system. Hydro and phone at roadside. Vendor may fi nance.
MLS® N217961 $175,000
Prime south-facing Bridge Lake view lot for sale, 2 acres with a drilled well in place and power at the lot line. Nice gentle slope to the land offers amazing views of the lake with the lake access a quick walk away. This area has so much to offer. Amenities are a 10 minute drive away.
OUT OF TOWN RECREATIONAL LOTS… Looking for a waterfront lot or lake access? Then check out these 2 properties in the South Cariboo on Bridge Lake off BC’s fi shing Hwy. #24. Lots of recreational trails for year round enjoyment.
Scan with your mobile device to see more listings
www.century21lakeside.com
South Shuswap Offi ce
10-1240 Trans Canada Hwy. Sorrento, BC10-1240 Trans Canada Hwy. Sorrento, BC
250-675-2317 • 1-877-272-3063250-675-2317 • 1-877-272-3063
28Years ofService
Lakeside Realty Ltd. The Local Experts! Connected to More™
MLS® 10050606
$424,000
688 Viel Road,Sorrento
Merry AndersonMANAGING BROKER
250-833-2799merryanderson@telus.netwww.merryanderson.com
Just steps from the lake and boat launch. 3 bdrm., 2 1/2 baths, open fl oor plan in the main living area, a huge sundeck with a lakeview. The whole upper fl oor is the master bedroom with ensuite. Includes a guest suite above the garage.
Bev Burk REALTOR®
250-833-6953bev@shuswap-homes.comwww.shuswap-homes.com
$409,900MLS® 10045626
2716 Golf Course Drive
BEST BUY - Custom built level entry home backing onto Shuswap Lake Estates golf course. Finished 2700 sq. ft. main fl oor w/full unfi nished basement. Breath taking foyer, formal dining rm, brigh offi ce space, master bedrm offers a luxurious 5 pc ensuite & 7 x 11 walk-in closet & the spare bedrm has it’s own full ensuite for guests. Clay tile roof, double car garage & security system.
Kevin Campbell REALTOR®
250-675-2317kevin@century21lakeside.com www.century21.ca/kevin.campbell
$44,900
Call Kevin Campbell for details on this THRIVING, PROFITABLE and REWARDING franchise business in the heart of Sorrento. Curves for ladies Call Kevin Campbell 250-675-2317 or visit www.century21.ca/kevin.campbell for more photos.
MLS® 9228251
1266 Trans Canada Hwy. Sorrento
REDUCED
Salmon Arm Observer & Shuswap Market News Wed. & Fri., October 31 & November 2, 2012 www.saobserver.net P5
$219,900Tappen Acreage
Beautiful view of the lake and Salmon Arm from this 9.87 acres only 15 minutes from town. Gently rolling land with pasture and trees for privacy, awaiting your dream home to add some country charm.
MLS® 10048890
Call Jeremy
$59,000Bring Your Plans!
McArthur Heights building lot with services at lot line. Minutes to recreational activities on Shuswap Lake Unbelievable price!MLS® 9198231
Call Tara
$135,000Golfers and Builders
Bring offer. Vendor motivated on this .3 acre lot on Shuswap Lake Estates golf course. Lot overlooks 12th green and fairway.
MLS® 10030116
Call Gary
$279,900Mortgage Helper - Bsmt. Suite
Why rent when you can own this 4 bdrm., 2 bath home featuring 2 bdrm., self-contained basement suite, level lot, separate laundry facilities on each fl oor.
Call Lisa
MLS® 10049174
$5,000,000Resort Development Potential
Stunning mountain and valley vistas greet you at this amazing potential development property in Donald, BC, a historic townsite in a recreational paradise located 25 km northwest of Golden. The property, with access to the TCH, is 521 acres of relatively fl at land. Two rivers, the Columbia River and Waitabit Creek run through the property and provide over four kilometers ofriverfront land.
Call Marv
MLS®K214657
$59,999Steal of a Deal!
Ready for quick possession. 2 bedroom plus den doublewide in Broadview MHP. Small pet is welcome here!
Call Tara
MLS® 10051285
$220,000Raven Subdivision
1061 47th Ave. NE. Walk to town on Lakeshore path, views of city, mountains and lake from this .44 acre lot.
Call Gary
MLS® 10037039
$69,900Affordable Living
Nice 2 Bdrm, 1 bath, all appliances included, Silver Creek Mountain Estates, vacant
MLS® 10049667
Call Steve
$429,900Freshly Painted Interior!
Spectacular lakeview level entry home, new fl ooring & paint, hardwood fl oors, 3 bdrms., 3 baths, 2 n/g fi replaces, u/g sprinklers, central a/c, huge shop under dble. garage.
Call Lisa
MLS® 10050833
Call Susanne
$117,900Silver Star Ski Condo!!
Ski season is just around the corner and this ski in/ski out Silver Creek Lodge condo is just what your family is looking for! Sleeps 6, full kitchen, fi replace and underground parking plus rooftop hot tubs and private ski lockers.
Call Marv
MLS®10048751
$359,900New Price!
Affordable waterfront on Little White Lake. Cozy 4 bdrm., 2 bath home with private setting and 700 sq. ft. deck, great for entertaining all your friends & family. Enjoy breathtaking view, peace and quiet. Plenty of room to build a garage or shop.
Call Susanne
MLS®10047233
250-832-9997
Helping youyou is what we do™
Toll Free: 1-877-604-9007www.royallepageaccess.caemail:rlpaccess@royallepage.ca241 Alexander Street NE, Salmon Arm
Immaculate level entry home in Blind Bay surrounded by privacy and lake and mountain views. 3 bedroom family home with in-law suite, double garage, lots of parking, mature landscaped lot with gardens and fruit trees.
MLS® 10054298
HomeSweet Home
$320,000Double Lot
Older residence situated on double lot, re-zoned to R-5 to accommodate higher density. 12 units.
MLS® 10039306
Call Steve
$269,900Panoramic Views
MLS® 10042472
Call Jeremy
Bring your plans in Upper Raven to this large, private .9 acre lot with spectacular lake and mountain views.
Call Jeremy
$259,900REDUCED!!!
First time buyer alert! 2 bdrm., 1 bath home. Flat 0.5 acre offers plenty of elbow room, right in town, fruit trees, 23x15 garage and 21x1`3 insulated shed with 220V – room for all the boy toys. Big enclosed balcony – perfect for entertainment.MLS®10047222
REDUCEDREDUCED
$319,900
REDUCEDREDUCED
$419,000Country Home on 2 Acres!
Lakeview family home with family room, offi ce/den, 2 baths, 2 bdrms., solarium, wrap around decking, attached garage and 24x24 shop. Hobby farm at its best!
MLS® 10054880
Call Lisa
$308,900In Bloom From Spring to Fall!
Lakeview home, spacious kitchen, 4 bdrms., fi nish basement to your taste. 14x6’8” foyer/landing w/access to covered patio and back yard. Pass thru caraport allows circle drive. Garden area with mature landscape.MLS® 10048005
Call ShirleyNEW PRICE!NEW PRICE!
P6 www.saobserver.net Wed. & Fri., October 31 & November 2, 2012 Salmon Arm Observer & Shuswap Market News
Jim Grievejimgrievesalesteam.com
Cell 250-833-6312 TOLL FREE 1-800-890-9166
jdgrieve@shaw.ca
Wonderful 2 bdrm/2 bathroom rancher in 55+ community at Village at 10th & 10th. Home is open and bright, with beautiful kitchen and includes all appliances. Effi cient geothermal heat, low strata fees and RV parking.
#16 - 1231 10th Street SW
NEWLISTING
MLS® 10055871
$427,000
HOME & SHOP
2871 30th Street NE
Wonderful 2100 sq. ft. home with in-law suite. Private .92 acre lot with heated shop and lots of parking. New furnace, heat pump and so much more.
MLS® 10053989
$389,000
MODERN DESIGN
391 10th Street SE
Stunning home features custom kitchen with high end appliances, 12’ ceilings, Tigerwood hardwood, Travertine tile, central A/C, built in vac and full steam shower.
MLS® 10055573
$364,900
GORGEOUS NEW HOME
420 24th Street NE
Open concept fl oor plan, 3 bdrms & offi ce, custom kitchen w/ stainless steel appliances, hardwood fl oors, gas fi replace and New Home Warranty!
MLS® 10044741
$315,000
BLIND BAY
3398 McBride Road
You can’t beat this price! Bright and roomy 3500 sq. ft. 3 bdrm home with lots of windows, vaulted ceilings and a lovely lake view.
MLS® 10047047
$289,000
LOG HOME
7740 Columbia Drive
Nestled in a private setting overlooking golf course & lake, 2900 sq. ft. log home with 2 bdrm. suite. Lots of updaates and nice deck for entertaining.
MLS® 10051503
$825,000
IN TOWN ACREAGE
3390 30th Street NE
30 acres in N Broadview with easy access, wonderful views and great soil. So much potential for this property.
MLS® 10039687
$459,000
STUNNING LAKEVIEW
2600 Grandview Place
Enjoy the view from this 2,800 sq. ft. custom built rancher w/ daylight bsmt. Spacious rooms and lots of view windows!
MLS® 10046604
$439,000
LOTS OF ROOM
2580 21st Street NE
2340 sq. ft. home with open fl oor plan, new kitchen, central AC, fabulous games room, oversized heated garage, spacious .5 acre and a lake view.
MLS® 10054760
$369,000
30 new townhomes, 3 fl oor plans to choose from. All homes feature custom kitchen, hardwood fl oors, stainless steel appliances. Built with energy effi cient/sound proof ICF construction and include 10 year warranty.
#203 - 1449 1 Avenue NE
AFFORDABLE QUALITY
MLS® 10055141 $209,500
$299,000
STEPS TO LAKE
Lot 2 Sunnybrae Canoe Point
This peaceful and private 20 acres has 2 year round creeks and would be a perfect spot for your dream home or family retreat.
MLS® 10048464
$239,000
FENCED YARD
640 7th Street SE
Really cute, cozy 1,000 sq. ft. home with lots of updates and big fenced back yard. Perfect for young family or fi rst time home buyers.
MLS® 10046512
FOR LEASE
#402 - 251 TCHwy
Great storefront space in upscale business complex. Easy access, wonderful visual exposure and lots of parking. Bring your ideas!
MLS® 10049602
FOR LEASE
551 Trans Canada Hwy
Fantastic opportunity for prime lease space on the highway. Building is seeing complete renovation. Great spot for retail or restaurant!
MLS® 10052354
Salmon Arm Observer & Shuswap Market News Wed. & Fri., October 31 & November 2, 2012 www.saobserver.net P7
RE/MAX ShuswapCell: (250) 804-6765Offi ce: (250) 832-7051
TTina Cosmanina CosmanWorking for you!Working for you!
Each of ce Independently owned and operated
tina@tinacosman.comwww.tinacosman.com
MLS® 10053807
$175,000
New roof, .23 acre lot. 3 bed starter or retirement home. Fenced & land-scaped. Newer deck & hot water tank. Garage/workshop. Close to beach, parks & schools. Quick possession!
PRICED BELOW ASSESSED VALUE!
MLS® 10039450
for this 4 bed/3 bath 1998 custom home close to downtown. Lrg eat-in kitchen, Brazilian redwood fl oors, gas FP, large deck, lake view, dble garage, workshop, lane access.
UNBEATABLE LOCATION
$397,000
MLS® 10045291
$639,900
Spectacular 2007 custom lake view home in McArthur Heights. In-fl oor heat, tons of storage, spacious layout. 1.64 acres. Backing onto crown land.
McARTHUR HEIGHTS
MLS® 10045307
$699,000
Share the waterfront at Shimmering Waters on Shuswap Lake. Timber frame 3 plus bed/3 bath home. Brazilian cherry fl oors, vaulted ceilings, large deck area and additional log cabin for extra guests.
SHIMMERING WATERS
MLS® 10048416$499,000
Instant Equity! Extraordinary lake & valley view. Custom 3 bed/3 bath home with open fl oor plan. Finished bsmt. Large deck. RV parking. Non-zoned. Private 2.2 acres.
BELOWAPPRAISED
VALUE
MLS® 10050502 $155,000
2 bedroom/2 bathroom. Garage, no stairs, appli-ances included. Quick possession possible. Close to town. Walking distance to most amenities. Call for more details.
CAREFREE ADULT LIVING IN SHUSWAP
LANE, SICAMOUS
LO
TS 24.22 acres MLS® 10043688 ..................................NEW PRICE: $449,000
17.77 acres MLS® 10043690 .................................. NEW PRICE: $265,0006.52 acres MLS® 10043689 .................................. NEW PRICE: $225,000
.29 acre lake view lot on Woodland Drive in Shuswap Lake Estates,Blind Bay. MLS® 10038942 ............................................................................ $75,0002 semi-waterfront lots listed in Eagle Bay, over 1 acre ea.MLS® 10045302, MLS® 10045303 ............................. $239,900 & $249,9001 acre lot in NE Salmon Arm. City water, backs onto pondMLS® 10050741 .......................................................................................... $187,000
MLS® 10052520
$659,900
ICF construction, geothermal heating system, heated bathroom fl oors, level entry with walkout bsmt, attached double garage, very private 5 acres with incredible view of Mt Ida. Located mere minutes to town.
QUALITY CUSTOM HOME
MLS® 10048535$324,900
Fabulous lake & mountain views. 3 bedroom + den. Walk to town & bird sanc-tuary. Extra large double garage, large sundeck. Great B & B potential.
PRIVATE .25 PRIVATE .25 ACRE LOTACRE LOT
MLS® 10053552 $71,000
CONVENIENTLYLOCATED!!
Between Enderby & Salmon Arm, this clean 2 bdrm. home will surprise you. Carport, covered deck, shed, large private yard backing onto creek.
MLS® 10049363 $78,900
SPACIOUS!2 bed/2 bath in Bastion MHP. Addition with huge partially covered deck. Lakeview & only steps to the water. Appliances included. Quick possession.
REDUCED
MLS® 10038588 $99,300
BEAMAZED!
Featuring island/breakfast bar. Built-ins throughout. 1100 sq.ft. Newer furnace, windows/doors, fl oors, drywall, fi replace, kitchen, deck. Tasteful decor. Deck with seating, shed, carport.
MLS® 10040859 $285,900
5 bed/2 bath home.Bsmt. mostly fi nished. NEW ROOF, newer appliances, master with ensuite & walk-in. Nicely landscaped & fenced yard, quiet area, close to beach.
GREAT FAMILY HOME
MLS® 10011087$449,900
in Salmon Arm. Over 1600 sq. ft. Rancher. Great year round home or vacation property. Enjoy the lake from your deck or cozy up by the fi replace and enjoy the view.
WATERFRONTHOME
MLS® 10052640 $166,698
PRIVATE .36 ACRE LOT
in Sicamous with a 4 bdrm., 2 bath home. Updated fl ooring and windows, shed/shop, plenty of parking. In-credible value.
MLS® 10052200$599,900
…from this 40 acre non-zoned property. 3 plus bdrm./2 bath, 2 guest cabins, workshop, barn & other outbuildings. Fenced, located 10 min. east of Sicamous. Very private setting. Perfect B&B. Set up for animals.
SPECTACULARVIEWS
MLS® 10053824
$104,000
in Broadview Villas. Updated 1400 sq. ft. 4 bedroom. Large private yard, attached workshop and storage, big covered and enclosed deck.
BESTLOCATION
MLS® 10053820
$392,500
GREAT PRICE! Level entry 4 plus bed/3 bath home with in-law suite. Vaulted ceiling, hardwood, new roof, other updates.
GREAT HOME, GREAT LOCATION
MLS® 10054117 $535,000
Area of fi ne homes. Custom level entry 3 plus bed/3 bath. Open concept/spa-cious design, hardwood, tile, granite, heated bathrm. fl oor, 2 fi replaces, covered decks, 3055 plus sq. ft., lakeview, and much more.
LIVE INTHE RIDGE
MLS® 10055936
$69,900
Featuring over 1400 sq. ft. Includes updated electrical, new fl ooring, paint, deck/patio area, workshop. Located in a quiet cul-de-sac with private fenced yard and plenty of parking. Quick possession. Appliances included.
SPACIOUS!
MLS® 10054819 $46,700
GREATBUY!
Evergreen MHP. 2 bdrm., 1050 sq. ft. with recent electrical cert. Bright & spacious; carport, covered deck, private yard. Excel-lent location at back en-trance to park. Walk to new Askew’s & rec centre.
MLS® 10049363
NEWPRICE
MLS® 10054966 $124,900
BRIGHT & OPEN 2005
Between Enderby & Salmon Arm, this clean 2 bdrm. home will surprise you. Carport, covered deck, shed, large private yard backing onto creek.
NEWLISTING
NEWPRICE!!
NEWPRICE
MLS® 10055498
$389,900
Backs onto forested area with views of the pond and trails. Quality fi nishes throughout featuring 9 ft. ceilings, crown moulding, fi replace, A/C, Corian counters, central vac., security system and much more.
TOWNHOME IN PARK RIDGENEWLISTING
P8 www.saobserver.net Wed. & Fri., October 31 & November 2, 2012 Salmon Arm Observer & Shuswap Market News
$189,900Lisa MLS® 10048956
• Best deal in Salmon Arm!• Heritage style home features 3 bdrms., full
bsmt., private setting, original oak fl oors• Open design, lane access, storage shed/shop
690 Okanagan Ave. SE, Salmon Arm
$389,900Barb MLS® 10053831
• Wonderful lakeviews• Beautifully landscaped yard• Balcony off master bedroom & private yard• 4 bedrooms, 3 bathrooms
4860 14th Street NE, Salmon Arm
$619,000Barb MLS® 10040433
• Amazing Lake views• Bright open fl oorplan• 3 bedrooms, 3 bathrooms• 2 double heated garages
2250 4 Avenue, SE, Salmon Arm
$299,000Lisa MLS® 10047894
• Behind the Honda dealership on 2nd Ave.• Lake, City and Mountain views• Easy access, fl at site• Park nearby. Private setting
661 2nd Avenue NE, Salmon Arm
$685,900Cori MLS® 10043600
• Prime Shuswap waterfront• 0.52 acre• 3 bed, 2 bath• Detached shop
3212 Eagle Bay Rd., Eagle Bay
$348,000Cori MLS® 10044252
• Private setting at the end of cul-de-sac• 3 bdrm and 3 full baths• Close to beach and shopping• New hardwood fl ooring
2771 Glenview Road
$419,900Kent MLS® 10049224
• Over 3200 square feet of luxury!• Self contained suite downstairs!• Just 60 steps to the water of Shuswap Lake!• Call Kent Redekop @ 250-318-8120 to view!
1379 Gillespie Road, Sorrento
$309,900Kent MLS® 10055027
• Handyman special on 1 acre!• Awesome 30’ x 50’ detached shop!• Just 10 minutes from Salmon Arm!• Best acreage buy in the area!
669 Tappen Cemetary Road, Tappen
$199,900Kent MLS® 10049714
• Best acreage buy in the North Shuswap area!
• 2.07 acres with a home, shop and barn!
• Just minutes from Adams Lake Mill!
• Privacy plus, spic & span home & property!
8489 Holding Road, Adams Lake
$230,000BIGRob MLS® 10055821
• Yes the price is correct! Hot deal!
• 4 Bdrm., 2 Bath Bungalow on Large Lot
• Alley Access, Walk to all schools
• Quiet cul-de-sac, Walk to new Askew’s
3181 - 8th Ave. NE, Salmon Arm
$231,000BIGRob MLS® 10045048
• Pre-Build offering 0% Financing (O.A.C.)
• Price incl. a 5% discount; no strata fees for 1 yr.!
• Earn 5% interest on trust account holding deposit
• Many plans and options to choose from!
#316; 131 Harbourfront Dr. NE, Salmon Arm
$399,000BIGRob MLS® 10048618
• “Hot” new price! Large 1/3 acre lot
• Well maintained with upgrades
• Full bsmt. suite w/separate entry & carport
• Huge heated shop w/washroom; fruit trees
1820 Lakeshore Rd. NE, Salmon Arm
SALMON ARM250 832-6060364 Ross St. NE
SICAMOUS250 836-2121
301 Main St.
Barb LeRouxCori MaynesKent Redekop Lisa ButlerRob McKibbon Don & Linda PeakerKeith Chancellor Cary LentzProperty Management
RESIDENTIAL STRATA MANAGEMENT
PROPERTY MANAGEMENT COMMERCIAL
Salmon Arm Observer & Shuswap Market News Wed. & Fri., October 31 & November 2, 2012 www.saobserver.net P9
B AY F I E L DMORTGAGE
#201 – 121 Hudson Ave. NE, Salmon Arm, BC
www.shuswapmortgage.com
Vic HamiltonSR. BROKER, A.M.P.
250.803.0101vic@sunwave.net
Sharon WalkerBROKER
250.803.0101swalker@sunwave.net
Ray MillsBROKER
250.517.7608rmills@sunwave.net
Lowest Rates in Canada!
5 year closed
5 year variable
5 year quick close 3.29%
2.60%3.34%
1.866.252.4526
2.80%Variable
victorjh@telus.net sharonjw@telus.net rpmills@telus.net
2.69%3 year closed
3.09%5 year closed**lower rates may be available in certain situations
TARA GALLANT
www.shuswaphome.compppp
Cell 250 804.3162
Thinking about buying or selling? Talk to Tara
2140 - 1st Avenue SE
• 2007 custom built home w/lakeview• Oversized wired garage & RV parking
MLS® 10052064
$$439,000439,000
#7 - 780 10th Street SW
• 55+ townhouse across from shopping mall• Small pet is welcome and lots of parking
MLS® 10055446
$$249,900249,900
#7 - 900 10th Avenue SE
• 1325 sq. ft., central air, covered deck• Carport and 20x20 wired workshop
MLS® 10055760
$$259,000259,000
NewPrice
#39 - 1885 Tappen Notch Hill Rd.
• Rural setting, 55+ park• Wired garage/shop & screened-in deck
$$159,900159,900
MLS® 10052058
7476 Hudson Rd. SE
• Don't pass this buy! Easy access.• Home & shop on 0.41 acres
MLS® 10055768
$$259,000259,000
d
NewPrice
d. SENew
Listing
1341 Foothill Rd. SW
• 3 level split home with 20x16 workshop• 0.28 acres with valley view
MLS® 10044028
$$274,900274,900
nue SE
NewListing
The Name Friends Recommend…
REALTOR®/Co-ownerREALTOR®/Co-ownerjayagassiz.com
250.833.8284
Full details at...
Scan QR Code to shop homes
from your mobile phone!
Upscale Design!$379,900
MLS® 10
055061
New!
Ravencroft End Unit! $319,900
MLS® 10
053212
Newer Level Entry!$378,900
MLS® 10
052268
Sherwood Forest!$318,900
MLS® 10
055661
New!
Now...
SALES EXCELLENCE!Recently recognized with a Platinum Club
award from Rick Dubord, president of Homelife BC
Legal Suite, 0.82 Acre!$369,900
MLS® 10
051368
10051
36
ANOTHERANOTHER
SOLD!SOLD!
7+ Acre Hobby Farm!$489,900
MLS® 10
052469
Walk to White Lake!$469,900
MLS® 10
052329
Really Suite Home!$415,900
MLS® 10
055817
New!
A Country Charmer!$359,900
MLS® 10
054379
Completely Renovated!$339,900
MLS® 10
054428
P10 www.saobserver.net Wed. & Fri., October 31 & November 2, 2012 Salmon Arm Observer & Shuswap Market News
®®
Linda ClarkeRE/MAX Shuswap Realty Ltd. ~ 250-833-6711
www.lindaclarke.ca ~ lclarke@sunwave.netEach offi ce independently owned and operated • 1-888-676-2435
®
®
MLS® 9218674
THE BURLINGTON• Immaculate, move-in ready 1681 sq. ft. condo in
55+ pet friendly building with no rentals• Bright spacious rooms with high ceilings and lots
of large windows for natural light• Large living room with electric fi replace, 2
bedrooms plus den, beautiful kitchen with pantry, lots of cupboards & raised bar seating, formal dining, 2 baths, in-suite laundry room with extra storage and 2 covered decks, one deck has direct access onto outside lawn
• Secure entry, underground heated parking and storage locker
• Beautiful scenic lake, mountain & city views• Seconds to all amenities
$297,500MLS® 10055830
CAREFREE LIVING CAN BE YOURS AT...
#102, 1391 - 10th Ave., NE
NewListing
$248,000MLS® 10051199
450 5th Avenue SEBegin Home "Ownership" or Retirement here! Solid well cared for rancher with full basement. Private backyard wih deck. 2 bdrms up & 1 down, lge country kitchen, electric f/p in L/R, single garage and RV parking. A pleasure to show.
MLS® 9218674MLS® 9218674$289,000MLS® 10043103
#2 111 Harbourfront Dr. NWLakeview townhome in popular Heron View. Top fl oor unit with large windows to enjoy all the views. 1400+ sq. ft., 2 bedrooms, spacious kitchen with tons of cupboards, 2 baths, formal dining, 2 decks, double garage, living rm. w/gas f/p. 55+.
MLS® 9218674MLS® 9218674$549,000MLS® 10054174
5901 70 Avenue, NE, CanoePride of ownership shows in this beautifully reno-vated lakeview home. You must view the inside to appreciate all that this home has to offer. Dream mst. bdrm, 2nd kitchen in bsmt, lakeview. 1.67 acres, detached dbl garage & room to roam.
$399,900MLS® 10047068
#28, 1120 - 12th St., NEPopular Lakeview Terrace. Enjoy the lake, city & mountain views. Immaculate rancher with fully fi n-ished walkout basement. 2840 sq ft, 3 bdrms, den, 2 gas f/p, huge kitchen, formal dining, 3 baths, family rm, infl oor heat, skylight, deck & single garage.
$469,000MLS® 10035068
670 25th Street SEImmaculate! Meticulous! Suite Income! This move-in ready home offers it all. 3200 sq. ft. rancher with gorgeous legal suite. Hardwood, tile, granite, crown moulding, beautiful landscaping – it's all included. Don't wait, view today!!
$59,900MLS® 10055366
#21-469 Main Street, SicamousLovely 2005 manufactured home, in 55+ MHP in Sicamous. 2 bedrooms, 1 bath, covered deck, and garden shed. All you have to do is move in and enjoy. Small fenced yard. Walking distance to shopping, restaurants, post offi ce and bank.
$129,900MLS® 10023683
1280 7th Avenue SEPRIME 0.18 ACRE BUILDING LOT Located at the end of a cul-de-sac in the quality development of Laurel Estates. Lot is gently sloping and suitable for a level entry rancher with a level driveway
$139,000MLS® 10023448
4331 Trans Canada Highway1.2 acres of highway exposure. Property fronts the Trans Canada Highway. Complete with septic perk test done, license on creek for water, power & gas available. Build the home of your dreams or excellent investment.
$139,900MLS® 10008266
Lot 2 Highlands Dr., Blind BayLakeview lot in prestigious Highlands. Views of Shuswap Lake and Shuswap Lake Estates golf course. Come and build your dream home or re-tirement paradise in this upscale neighbourhood. Close to golf course, schools, marina, shopping & more.
ProudSponsors of
Each offi ce is independently owned & operated®
SHUSWAP1111 Lakeshore Drive, Salmon Arm, BC
“I’m Just a Call Away”“I’m Just a Call Away”
Tracey Thompson...bringing your dreams home
Cell: 250-833-6611E-mail: tracey@traceythompson.ca
WWW.TRACEYTHOMPSON.CACell: 250-253-3000 • Cell: 250-253-3000 • tammyc@remax.nettammyc@remax.net
WWW.TAMMYC.CA
Scan and see all my listings:
Picture perfect home on 8+ acres within minutes of town. The full package. Beautifully reno’ed home offers hardwood, gourmet kitchen, granite, open fl oor plan, 3 bdrms. on main fl oor, decks, fenced, cross fenced, outbuildings incl. 2200 sq. ft. shop.
MLS® 10053185$$679,000679,000
What Neighbours? This Treasure is All Yours!What Neighbours? This Treasure is All Yours!Beautiful well-appointed immaculate 2 bdrm. rancher on Arbutus Road in Chase. Views of golf course and short walk to waterfront. One of only a handful with 2 car garage. Large spacious rooms, private patio area. Perfect retirement home.
MLS® 10053793$$255,000255,000
Golf Course, View AND Beach Access!Golf Course, View AND Beach Access!
This lakeview Townhouse features 3 bdrms., 3 baths, modern and updated throughout. All appliances within 3 years, incl. air conditioner. Only unit in the complex with glass sliding doors to the backyard.
MLS® 10044083$$259,900259,900
Thi l k i T h
Beautiful 3 Bedroom, 3 Bath TownhomeBeautiful 3 Bedroom, 3 Bath Townhome2 bdrm. & 1 1/2 bath townhouse features bright open fl oor plan, 2 parking stalls, private patio off living room. Close to Piccadilly Mall. Updates include fresh paint and most fl ooring. Large bedrooms have oversize closets. Priced to sell.
MLS®10044152$$199,000199,000
Low Price Means Happy Buyers!!Low Price Means Happy Buyers!!
Immaculate level entry 4 bdrm., 3 bath home w/fully fi nished basement w/walk-out access to back yard. Basement is fully suited w/2 bdrms., great for extra company or the in-laws! Features incl. open fl oorplan, bay windows, skylights & more.
MLS®10050871$$389,000389,000
Such a Suite Deal!Such a Suite Deal!
MLS® 10043444$$599,000599,000
This spectacular SEMI-WATERFRONT acreage has it all! Main residence offers 1700 sq.ft. of living space, the secondary dwelling offers 750 sq.ft. for guests. Property includes an RV pad, a dock and even a HOUSEBOAT! Amazing lake views on all two acres for the perfect getaway located minutes off of the T.C. Hwy. in the South Shuswap! All this on 2.09 ACRES!! Let the FUN begin!!
Thi l SEMI WATERFRONT
Home, Cottage, Views, Beach Access & a Houseboat!Home, Cottage, Views, Beach Access & a Houseboat!
5.12 Acre Investment Property In the OCP for Commercial/ Highway Service/Tourist Where #1 Trans Canada and Highway 97B meet NEWER Large Septic System Currently has 33 pad MHP with only 7 units left
MLS® 10043236 $ $1,295,0001,295,000
5 12 A I t t
Highway Frontage Investment PropertyHighway Frontage Investment Property11,810 sg ft two story offi ce building on 1 acre,paved parking lot,in Sicamous BC.Tenants w/Leases in place include the Dentist,Doctor,Optometrist &Computer Software Company.High exposure to Trans Canada Hwy& steps from Mara& Shuswap Lake.
MLS® 10046635 $ $949,000949,000
Professional Offi ce BuildingProfessional Offi ce Building
Buy Yourself a Business! Three RED SHALE Mining Permit allows for extraction of this Red Shale Rock. Multiple use for this amazing rock include landscaping, pathways, roadways, ball diamonds.... endless possibilities!
MLS® 10046830$$339,000339,000
Buy Yourself a Job!Buy Yourself a Job!
INVESTMENT PROPERTY-OWN ALL 4 STRATA SPOTS!! This 21000 sq foot building on a very busy road and great location in Salmon Arm. Anchor tenants in place, and still a spot for you to move your business to this high traffi c location..
MLS® 10052248tion..$$2,200,0002,200,000
Investment Building in Prime LocationInvestment Building in Prime Location
Great business Opportunity includes the Land an very busy business. High exposure, close to Trans Canada and 97B.
MLS® 10047957$$799,000799,000
Turn Key OperationTurn Key Operation
.77 of and acre Commercial land in the heart of town in a high traffi c area close to highway 1. Ready for you to move your business here, start a business, build your own building. Lot beside also for sale – .50 of an acre. Call Tammy 250-253-3000.
MLS® 10052395$$495,000495,000
Can’t Find Your Building? Build One!Can’t Find Your Building? Build One!
217 Finlayson Street, Sicamous .......................... MLS® # 10046637 ................................$1,300.001371B 10 Avenue, SW Salmon Arm..................... MLS® # 10052252 ........................$10.00/Sq. Ft.1371D 10 Avenue, SW Salmon Arm .................... MLS® # 10052254 ........................$10.00/Sq. Ft.
PROPERTIES FOR LEASEPROPERTIES FOR LEASE
Salmon Arm Observer & Shuswap Market News Wed. & Fri., October 31 & November 2, 2012 www.saobserver.net P11
Serving the Shuswap since 1982 • Each offi ce independently owned & operated
Shuswap®TeamLindaR.com
Dorismills.com 250-833-2155
bringing buyers and sel lers together1-888-676-2435
Linda RohlfsLinda RohlfsPersonal Real Estate CorporationPersonal Real Estate Corporation
Associate Broker/Associate Broker/REALTORREALTOR®®
p
Doris MillsDoris MillsAssociate BrokerAssociate Broker
REALTORREALTOR®®
2030 10th Avenue SE
$233,000 MLS® #10054146
• Location, Location, Location• 0.23 acre lot with renovated home close to Hillcrest
School, rec center, Askew’s uptown & Little Mtn.• Perfect starter home or investment property• Large detached shop with concrete fl oor and overhead
door
Call Linda or Doris
NEW
PRICE
2319 Lakeview Drive
$369,000 MLS® #10043511
• Beautifully maintained lakeview home with a large, bright kitchen, living room with gas fi replace and 4 spacious bedrooms
• The walkout basement is fully fi nished and has a 2nd gas fi replace
• Double garage plus a 18x20 detached shop
Call Linda or Doris
4211 Lakeshore Road NE
$399,000 MLS® #10055395
• 4.28 acres with unsurpassed lake view• Land only. Beautiful building sites to guaran-
tee privacy and lakeview in area of upscale homes by Raven Subdivision
• Zoned R-1 on city water. Septic required. Rare offering.
Call Linda or Doris
NEW
LIST
ING
281 Grandview Bench Road
$259,000 MLS® #10050449
• One acre valley view with substantially renovated 3 bedrooms, 2 baths
• Cozy wood stove in the walkout basement• The 20x23 ft. insulated shop wired 220 (on own
meter), + 2 bay covered parking ideal for your toys• 2 horse paddocks, lots of water
Call Linda or Doris
#1 4232 Eldon Frontage Road
$499,000 MLS® #10052053
• 2.3 landscaped acres on service road across from Ford Rd. on Trans Canada Hwy in Tappen
• Previously run as a 9 pad mobile home park• Presently non-zoned open for your ideas. Seller
states well at 12 GPM• Close to lake, golf and recreation
Call Linda or Doris
#30 1510 Trans Canada Hwy.
$179,900 MLS® #10035726
• Spectacular lakeview from this well maintained double wide
• 2 bed plus den at Deer Ridge Estates• Spacious kitchen, bay window separate dining
area• Large covered deck to take in the sunsets
Call Linda or Doris
540 2nd Street SE
$179,900 MLS® #10055600
• 2 bedroom clean rancher within walking distance to most amenities
• Updated over the years, roof, furnace and walk-way
• Private yard. Security system. Storage shed. Newer fridge. Carport.
• Listed below assessment. Great value.Call Linda or Doris
NEW
LIST
ING
1050 60th Street SW
$750,000 MLS® #10047711
• 18.42 private acres with amazing lake and city views• Renovated home with geothermal heat, new
kitchen, fl ooring, paint, wiring, plumbing, and ensuite with walk-in closet
• Huge 39x27 garage with 200 AMP service and oversized garage doors
Call Linda or Doris
651 5th Avenue SW
$499,900 MLS® #10050022
• Business opportunity: Auto Repair Business with a 25 year established clientele base
• Business consists of tires, alignments, oil changes, breaks, tune ups, steering & exhaust
• Equipment and signage included. Stock extra. Great location
Call Linda or Doris
#93 - 1361 30th Street SE
$98,900 MLS® #10046866
• Showroom ready 2 bedroom, 1 bath, mobile with addition in South Broadview MHP
• Vaulted ceilings, island in kitchen, ensuite plus w/i closet off large master bedroom
• Windows & siding upgraded. Chain linked private yard, wired shop plus storage shed
Call Linda or Doris
700 Christison Road SW
$699,900 MLS® #10047221
• 1.07 private acres. Contemporary, bright, open design featuring soaring 14 ft. ceilings in LR allowing the outside in.
• Views of the valley & Mt. Ida. Natural gas fi replace. 20’ x 32’ heated studio/shop
• Separate 2 car garage. Creek on property.
Call Linda or Doris
381 7th Avenue SE
$299,900 MLS® #10051331
• Many upgrades in this 3 bedroom, 2 1/2 bath rancher on walkout fi nished in-law suite
• Easy care laminate fl oors. Wood burning fi replace. Roof, h/w tank, and most windows replaced
• Incl. the new appliances. Washer/dryer upstairs. Hot tub room
Call Linda or Doris
#51 - 2801 10th Avenue NE
$13/sq. ft. MLS® #10046080
• Leasing 1500 sq. ft. w. bath facing the TCH• Neighbours include Esso Service Station, Home
Restaurant, Holiday Inn, Uptown Askews & Shaw Centre
• Lots of parking & high traffi c exposure• Storefront level entry, plus overhead door from lane
Call Linda or Doris
#118 870 10th Street SW
$229,000 MLS® #10051724
• 3 bedroom 2 1/2 bath townhouse directly across from Piccadilly Mall at Parkhaven
• Gas fi replace in family room off kitchen. Easy care laminate fl oors
• Includes appliances. 1 car garage. Private patio. Walk to park
• Listed at assessed value
Call Linda or Doris
2506 Golf Course Drive
$424,900 MLS® #10048297
• Executive rancher on the 11th fairway• Dramatic living room letting the outside in, 10 ft.
high ceilings• Family room off spacious kitchen. 2 gas fi replaces,
c/air, u/g sprinklers, b/i vac plus much more• Private beautiful landscaped grounds
Call Linda or Doris
5352 Sunnybrae-Canoe Pt. Rd.
$999,000 MLS® #10049009
• Lakeshore at its best, 1.41 acres of privacy with year round house
• 106 ft. of pebbly beach bordering crystal clear water• Lovely deck to enjoy the summers, cozy wood
burning fi replace to warm the cool eve• Covered boat storage
Call Linda or Doris
NEW
PRICE
NEW
PRICE
P12 www.saobserver.net Wed. & Fri., October 31 & November 2, 2012 Salmon Arm Observer & Shuswap Market News
3981 Richardson Road
MLS® 10047652 $229,750
Well maintained rancher on 0.34 ac. lot w/partial lakeview. Neat & tidy 3 bed, 2 bath home w/gas f/pl., lg. laundry/hobby room, attached garage, gardens & mature fruit trees. Short walk to beach on no-thru road & 15 min. drive to Salmon Arm.
4840 13 Street NE
MLS® 10053715 $329,900
Great Raven location with a fantastic lake view make this home a must see. Very comfortable home with hardwood fl ooring, oak kitchen, gas fi replace, 4 beds & 3 baths. Front & rear decks to enjoy the surroundings. Double garage & RV Parking.
382 Sumac Road
MLS® 10050642 $359,900
Lakeview rancher on .24 acre lot. Open main fl oor, wood f/pl, hardwood fl oors, vaulted ceilings w/skylights, kitchen island, gas cook top and pantry. Full, walkout basement w/lots of storage. Great retirement home, neatly landscaped and double garage.
3051 18 Avenue NE
MLS® 10055133 $ 364,900
Like new! Features include granite counters in kitchen, ensuite & main bath, h/wood & tile fl oors, hi effi ciency furnace w/central air, on demand hot water, huge mstr. bed & full ensuite. Bsmt. w/lrg. rec room, guest bed & bath. Add’l RV & boat parking.
12 - 469 Main Street
MLS® 10042542 $59,900
Newer, move-in ready 2 bed, 1 bath modular in downtown Sicamous. Updated in 2011 w/new fl oors, appliances, hot water tank, light fi xtures, deck & more. Located on a treed yard in quiet 55+ park. Possible owner fi nancing at competitive rates.
4208 Chase Falkland Rd.
MLS® 10054648 $189,900
21 acres w/a 1400 sq. ft. home (1-2 beds/1 bath), 24’ x 36’ shop & detached carport/shed. Unique & charming home set on 1/2 acre fl at area by road w/remainder up hillside & bench. Nice setting, peaceful outdoor space all in a quiet rural area.
32 - 9032 Swanson Road
MLS® 10048520 $99,000
Fully serviced 31’ x 33’ RV lot in a gated, waterfront community on the sandy shores of Mara Lake. Shared laundry, avail. boat storage & moorage, boat launch, playground, 700’ of common sandy beach. RV currently on site could be purchased separately or bring your own.
351 Hudson Street NW
MLS® 10045561 $109,000
Wonderful Harbourfront location only steps from Nature Park. Quick convenient walk to Marine Park, City wharf, movies, restaurants & downtown. Flat lot with CD7 zoning that allows for a legal suite. Come have a look!
38 - 1510 TC Highway,
MLS® 10051288 $189,000
Lake views & privacy from this 3 bed 2 bath home. Lots of parking, dbl garage, irrigated gardens & lrg deck w/sunken hot tub. 2005 home has A/C,gas f/pl, skylights,master bed w/walk-in closet & ensuite. Open concept w/loads of natural light.
215 - 250 5 Street SE
MLS® 10055459 $239,900
2 bed, 2 bath apartment in 55+ McIntosh Grove. 1200+ sq. ft. of living space. Lrg. kitchen w/nook, gas f/p, In-Suite laundry & spacious deck. Building has elevator, secure & heated u/g parking & is located within walking distance to most amenities.
105 - 500 Old Spallumcheen Rd.
MLS® 10052526 $299,900
Stunning views from this 2 bed, 2 bath townhome w/vaulted ceilings. A/C, gas f/p, soaker tub, stone counters, high-end windows & doors, built-in vac & 2 patios. Minutes to hiking, golf, lake access, restaurants and many other recreational possibilities.
890 26 Street SE
MLS® 10052731 $319,000
Family home on a quiet cul-de-sac within walking distance to schools. Private backyard with large covered patio, 3 beds & 2 baths on main fl oor w/in-law suite below. Master bed w/2 piece ensuite, open living, dining, kitchen area, attached garage and new roof.
3785 Malakwa Road
MLS® 10047857 $319,900
5.5 riverfront acres with TCHwy exposure & lots of options. Renovate current 18 unit motel & take advantage of the proximity to snowmobiling, skiing and Shuswap & Mara lakes. Potential for hobby farm w/ enough room for all your friends and family.
2541 50 Street NW
MLS® 10047666 $620,000
25 acres w/fencing & x-fencing, corrals, city water & add’l well, creeks and beautiful pastures. 26x36 shop w/gas heat and 200 amp service, 32x40 hay barn, 70x40 barn w/stalls. Charming 4 bed, 3 bath home w/beautiful yard and gardens.
4691 50 Street NE
MLS® 10046733 $999,000
Executive 6537 sq. ft. home on 20 ac. Master w/6 pc. bath, den & hot tub. Kitchen w/gas range, double oven, S/S appl. Formal dining, A/C, central vac & 3 gas fi replaces. Basement w/rec room, bar & billiard room. Triple garage, 3 bay carport, 30x40 barn, 3 bed guest house.
2 - 2924 Eagle Bay Rd
MLS® 10033737 $159,000
5-unit townhome across the street from Shuswap Lake. Large 1 bdrm., 2 bath unit has approx. 1076 sq. ft. w/open kitchen/living/dining area, patio and master bedroom w/ensuite. Secure parking & storage, beautiful grounds and short walk to the beach.
460 5 Street SE
MLS® 10054023 $254,900
Charming 3 bedroom & den character home within walking distance to downtown & amenities. Private 100’ x 140’ lot is an ideal holding/development property. Designated high density in the Community Plan. Newer roof, furnace & water tank.
80 4 Street SE
MLS® 10043079 $269,900
Updated 5 bed 2 bath home w/ in-law suite in a central location. 3 beds on main fl oor w/ 2 bed bsmnt suite. New furnace w/ A/C, new windows on main fl oor & recent fl ooring, lighting & paint. Flat, fenced yard, large deck, plenty of parking.
781 21 Street NE
MLS® 10044327 $299,000
Legal side-by-side duplex. Level entry with attached carports. 2 bed & laundry on the main fl oor w/full, partially fi nished basements & large family room. Space to add another bedroom & another kitchen with plumbing in place. Great income potential!
3080 16 Avenue NE
MLS® 10054161 $445,000
Under construction: lvl entry w/ 2 beds & den. Open kitchen/liv/dining area. Large master with full ensuite. H/wood, tile, gas f/place & dbl garage. Quiet street close to schools & new grocery store. Home situated to allow rear access for shop, RV parking, etc.
980 35 Street SE
MLS® 10039529 $469,000
2 story w/full part fi nished bsmt home (total 3390 sq.ft.). Open concept w/hardwood & tile, large beds w/walk-in closets, mstr w/5 pce ensuite. Central air, b/i vac. Over-sized 2 level semi-detached garage, lower level has sep access & overhead door.
1221 25 Avenue SW
MLS® 10054148 $499,000
New lvl entry w/lake view. 2 beds & den/3rd bedroom w/open kitch/living/dining area. Full, unfi nished bsmt + bonus media/workshop room. Master bed w/walk-in closet, 5 pce ensuite w/soaker tub & heated tile fl oor. Coffered ceilings & custom kitchen.
73 - 6421 Eagle Bay Road
MLS® 10043034 $499,000
Gorgeous home w/stunning lakeviews. Finely fi nished 3 bed 3 bath home w/loft style master, 2 storey wall of windows, kitchen island, stainless steel appliances, granite counters, 2 large deck areas.
2669 Mount Rose Place
MLS® 10047538 $659,000
Beautiful 3 bed, 3 bath Victorian style home. Custom built w/granite counters, custom cabinetry, wrap around deck, gas fi replace and 3 car garage. Located on a beautifully landscaped 0.83 acres with u/g sprinklers and a stunning lake view.
1649 Blind Bay Road
MLS® 10047999 $989,000
Custom built 4 bed/4 bath home on 2.92 acres w/100ft. lakeshore. Double garage, full unfi nished bsmt, hardwood fl oors, 3 gas fi replaces & large deck to enjoy the magnifi cent views. Boat launch & across the road is 20’x26’ shop w/fully serviced RV parking.
NEWNEWPRICEPRICE
NEWNEWPRICEPRICE
top related