neuroprotective effect of dizocilpine (mk-801) via anti ...€¦ · anti-apoptosis on...
Post on 05-Apr-2018
219 Views
Preview:
TRANSCRIPT
Copyright © 2010 by the Korean Society of Neonatology • Published by the Korean Society of Neonatolog. All rights reserved. 181
Neuroprotective Effect of Dizocilpine (MK-801) via Anti-apoptosis on Hypoxic-ischemic Brain Injury in Neonatal Rats
Min Ae Seo, M.D., Hyun Ju Lee, M.D., Eun Jin Choi, M.D., Jin Kyung Kim, M.D., Hai Lee Chung, M.D., and Woo Taek Kim, M.D.
Department of Pediatrics, School of Medicine, Catholic University of Daegu, Daegu, Korea
Original article
J Korean Soc Neonatol • 2010;17:181-92
doi: 10.5385/jksn.2010.17.2.181pISSN 1226-1513•eISSN 2093-7849
Purpose: Current studies have demonstrated the neuroprotective effects of dizocilpine (MK-801) in many animal models of brain injury, including hypoxic-ischemic (HI) encephlopathy, trauma and excitotoxicity, but limited data are available for those during the neonatal periods. Here we investigated whether dizocilpine can protect the developing rat brain from HI injury via anti-apoptosis.Methods: In an in vitro model, embryonic cortical neuronal cell culture of Sprague-Dawley (SD) rats at 18-day gestation was done. The cultured cells were divided into three groups: normoxia (N), hypoxia (H), and hypoxia treated with dizocilpine (HD). The N group was prepared in 5% CO2 incubators and the other groups were placed in 1% O2 incubators (94% N2, 5% CO2) for 16 hours. In an in vivo model, left carotid artery ligation was done in 7-day-old SD rat pups. The animals were divided into six groups; hypoxia (N), hypoxia (H), hypoxia with sham-operation (HS), hypoxia with operation (HO), HO treated with vehicle (HV), and HO treated with dizocilpine (HD). Hypoxia was made by exposure to a 2 hour period of hypoxic incubator (92% N2, 8% O2).Results: In the in vitvo and in vivo models, the expressions of Bcl-2 in the hypoxia groups were reduced compared to the normoxia group. whereas those in the dizocilpine-treated group were increased compared to the hypoxia group. However. the expressions of Bax and caspase-3 and the ratio of Bax/Bcl-2 were revealed reversely.Conclusion: Dizocilpine has neuroprotective property over perinatal HI brain injury via anti-apoptosis.
Key Words: Anti-apoptosis, Dizocilpine, Hypoxic-ischemic brain injury, Neuroprotection
Introduction
Neurons are highly vulnerable to exposure of hypoxia and
ischemia and related insults that other cell types are able to
withstand. The mechanisms for this are poorly understood
but studies on hypoxic-ischemic (HI) brain injury have
identified at least one important participant such as
overstimulation of excitatory amino acid receptors, including
glutamate and aspartate1).
Glutamate has been implicated in the neuronal death after
HI brain injury because the antagonists of glutamate
receptors have been found to be neuroprotective2). Gluta-
mate receptor activation is associated with the raised
intracellular Ca2+ and the enzymatic production of NO from
the amino acid L-arginine3). Glutamate has long been known
to kill neurons by an N-methyl-d-aspartate (NMDA)
receptor-mediated mechanism. Paradoxically, subtoxic
concentrations of NMDA protect neurons against glutamate-
mediated excitotoxicity. Because NMDA protects neurons in
physiologic concentrations of glucose and oxygen4).
Received: 15 September 2010, Revised: 14 October 2010, Accepted: 20 October 2010Correspondence to Woo Taek Kim, M.D.Department of Pediatrics, School of Medicine, Catholic University of Daegu, 3056-6 Daemyeung4-dong, Nam-gu, Daegu 705-718, KoreaTel: +82-53-650-4250, Fax: +82-53-622-4240, E-mail: wootykim@cu.ac.kr
182 MA Seo, et al. • Neuroprotective Effect of Dizocilpine on Hypoxic-ischemic Brain Injury
However, dizocilpine (MK-801), a non-competitive NMDA
receptor antagonist, prevents signal transmission by means
of the blockade of NMDA receptor ion channels. Dizocilpine
acts by binding to a site located within the NMDA associated
ion channel and thus prevents Ca2+ flux5).
NMDA receptors are key in the progression of excito-
toxicity. Thus NMDA receptor antagonists including
dizocilpine have been evaluated for use in treatment of
diseases associated with excitotoxicity, such as stroke, HI
brain injury, and neurodegenerative diseases such as
Huntington's, Alzheimer's, and amyotrophic lateral sclerosis.
Dizocilpine has shown effectiveness in protecting neurons
in cell culture and animal models of excitotoxic neuro-
degeneration6, 7). In addition, dizocilpine was assessed by
evaluating hippocampal behavioral and histologic outcomes
in an experimental rat model of neonatal hypoxia ischemia8).
Dizocilpine reduces neuronal damage and preserves
learning and memory in a rat model of traumatic brain injury.
The neuronal caspase-3 expression, neuronal nitric oxide
synthase (nNOS)-positive neurons and OX-42-positive
microglia were all increased in transient brain injury animals.
After dizocilpine treatment neuronal caspase-3 expression
and nNOS-positive neurons were all significantly decreased.
Dizocilpine could significantly inhibit the degeneration and
apoptosis of neurons in damaged brain areas9).
The mechanisms of protective effect of NMDA receptor
stimulation on apoptosis of neurons at their early stage of
development are poorly understood. Anti-apoptotic effects
of NMDA is connected with inhibition of fragmentation of
DNA via caspase-3-independent mechanism10).
In addition, the efficacy of dizocilpine was evaluated in a
rat model of retinal ischemia11). NMDA receptors may have
an important role in ischemia-reperfusion insult as well as in
mediating ischemia-induced apoptosis of retinal neurons.
After intravitreal NMDA injection, ultrastructural features
consistent with classic apoptotic changes were noted in
degenerating cells in the retinal ganglion cell layer and the
inner nuclear layer. NMDA plus dizocilpine did not show
these changes12).
Dizocilpine can prevent excitatory neuronal death, but at
higher concentrations, it can also induce neuronal death in
the limbic system. This dizocilpine-induced selective
neurotoxicity has been proposed as an animal model for
dementia and psychosis. The results suggest that the
dizocilpine-induced neuronal death was apoptotic13).
whereas at high doses or after continuous administration it
induces neuronal degeneration or necrotic-like irreversible
neuronal death
In this study, we determined the protective abilities of
dizocilpine via mechanisms of anti-apoptosis on a HI brain
injury by using an rat model of a HI brain injury (in vivo) and
an embryonic cortical neuronal cell culture of rats (in vitro).
Dizocilpine effects were evaluated by using western blots
and real-time PCRs.
Materials and Methods
1. Materials
(+)-MK-801 hydrogen maleate (dizocilpine) was
purchased from Sigma (St. Louis, Saint Louis, MO, USA).
Primary antibodies included the following: Bcl-2 (1:1,000;
Santa Cruz Biotechnology, Santa Cruz, CA, USA), Bax
(1:1,000; Cell Signaling technology, Beverly, MA, USA),
caspase-3 (1:1,000; Cell Signaling technology), and β-Actin
(1:1,000, Santa Cruz Biotechnology). Secondary antibodies
used were goat anti-mouse or rabbit IgG-HRP (1:2,000,
Santa Cruz Biotech nology).
2. Embryonic cortical neuronal cell culture
The cortical neuronal cell culture of rat embryos were
prepared as previously described14). Sprague-Dawley (SD)
rats pregnant for 19 days were anesthetized with ether for 5
minutes at room temperature and the uterus was removed.
The fetal pups were washed in 100% ethanol and Hanks'
balanced salt solution (HBSS) (GibcoBRL, Grand Island, NY,
USA). The brains of the fetal pups were dissected at 37℃
HBSS containing 1 mM sodium pyruvate and 10 mM HEPES
(pH 7.4). The dissected brain cortical tissues were then
placed in 2 mL trypsin. Trypsinisation of cells was performed
J Korean Soc Neonatol 2010;17:181-92 • doi: 10.5385/jksn.2010.17.2.181 183
under gentle agitation for 1 minute at 37℃ water bath and
reaction was stopped by washing the tissues five times with
10 mL HBSS. The cells were moved in 1 mL HBSS, passed
6-7 times via pasteur pipette with tiny holes and dispersed.
The cell suspension was centrifuged at 1,000 rpm at 25℃ for
5 minutes and pellets were washed with HBSS (without
phenol red). Following final centrifugation cells were
resuspended in plating neurobasal medium (GibcoBRL) (100
mL neurobasal, 2 mL B27 supplement, 0.25 mL glutamax I
0.1 mL 25 mM glutamate, 0.1 mL 25 mM 2-mercaptoethanol)
and counted using a Neubauer hemicytometer.
After cell counting, the cells resuspended in plating
neurobasal medium (GibcoBRL) and plated at approximately
2×106 cells/mm2 in each dish. Cell were cultured in a CO2
chamber with 1/5 of the culture solution changed every three
days with feeding neurobasal medium (GibcoBRL) (100 mL
neurobasal, 2 mL B27 supplement, 0.25 mL glutamax I).
The cultured cells were divided into three groups: a
normoxia group (N), a hypoxia group (H), and a hypoxia
treated with dizocilpine (HD). The N group was prepared in
5% CO2 incubators and the other groups (before a hypoxia
injury) were placed in 1% O2 incubators (94% N2, 5% CO2) for
16 hours. The experiments were repeated four times (n=4) in
the western blots and six times (n=6) in the real time PCRs.
3. Animal model and drug administration
This study was performed in accordance with the ap-
proved animal use guidelines of the Catholic University of
Daegu. A modification of Levine preparation was used as a
model for perinatal hypoxic-ischemic brain injury as
previously described15). We chose 7-day-old SD rat pups
weighing between 12 and 16 g because HI brain injury in 7-
day-old rats can be considered similar to perinatal ashpyxia
in the full-term infants. The sexes were not differentiated
since there are no differences in terms of neonatal HI brain
injury between male and female rats16). The rat pups
underwent permanent unilateral carotid ligation. The
midline of the neck was incised at the longitudinal plane
under ether anesthesia. The left common carotid artery was
permanently ligated with 5-0 surgical silk. Total time of
surgery never exceeded 5 minutes. Animals were excluded
from the study if there was bleeding during ligation or
respiratory arrest resulting from anesthesia. Following a 1
hour period of recovery, the animals were exposed to a 2
hour period of hypoxia (92% N2, 8% O2) by placing them in
airtight containers partially submerged in a 37℃ water bath
to maintain a constant thermal environment. After this
hypoxic exposure, the pups were returned to their dams for
the indicated time. Pups were killed at 7 days after the
hypoxic insult. Left cerebral hemispheres from rat brains
were immediately removed, frozen in liquid nitrogen and
stored at -70℃ until use.
The pups were divided into six groups. No surgical
procedure was not exposed to hypoxia (N) or was exposed
to hypoxia (H). Hypoxia with sham-operated pups
underwent the same surgical procedure without ligation
(HS). The pups were subjected to hypoxia with operation
(HO). Another pups received an intraperitoneal injection
with phosphate-buffered saline (PBS) at the same volume
with dizocilpine (HV) or with dizocilpine at a dose of 10 mg/
kg (HD). Dizocilpine was prepared in PBS and injected
intraperitoneally at a dose of 10 mg/kg 30 minutes before the
hypoxic exposure. The experiments were repeated four
times (n=4) in the western blots and six times (n=6) in the
real time PCRs.
4. Protein isolation and western blotting
Samples of brain tissue and cell were homogenized and
total protein was extracted using a protein lysis buffer
containing complete protease inhibitor cocktail tablets
(Roche Applied Science, Mannheim, Germany), 1 M Tris-HCl
(pH 8.0), 5 M NaCl, 10% Nonidet P-40 and 1 M 1,4-dithio-
DL-threitol (DTT). After incubation for 20 minutes on ice, the
samples were centrifuged at 12,000 rpm at 4℃ for 30
minutes and the supernatant was transferred to a new tube.
Proteins were quantified using Bio-Rad Bradford kit (Bio-
rad Laboratories, Hercules, CA, USA) and taking spectro-
photometric readings at 590 nm. Concentrations were
estimated against a standard curve generated using BSA.
Total protein (50 μg) was subjected to electrophoreses in
184 MA Seo, et al. • Neuroprotective Effect of Dizocilpine on Hypoxic-ischemic Brain Injury
12% SDS-polyacryl amide gel electrophoresis (SDS-PAGE)
after denaturing in 5×sodium dodecyl sulfate gel-loading
buffer (60 mM Tris-HCl [pH 6.8], 25% glycerol, 2% SDS, 14.4
mM 2-mercapto ethanol and 0.1% bromophenol blue) in
boiling water for 10 minutes. Proteins were then transferred
onto polyvinylidene difluoride (PVDF) membrane
(Millipore, Bedford, MA, USA) using a semi-dry transfer
apparatus at a constant voltage of 10 V for 30 minutes.
Membranes were blocked in TBS, 0.1% Tween-20
containing 5% nonfat powdered milk. Proteins were reacted
with primary antibodies for overnight at 4℃, and then
incubated with secondary antibodies for 1 hr at room
temperature. Signals were detected using an enhanc ed
chemiluminoescence (ECL) Plus Western Blotting Detection
System (Amersham Biosciences, Piscataway, NJ, USA) or
SUPEX (Neuronex, Pohang, Korea), and expose to film and
develop image. Then analyzed using Kodak X-Omat film or
an image analyzer LAS1000 (Fuji Photo Film, Tokyo, Japan).
Each sample was conducted four times.
5. Semiquantitation of the western blots
The intensity of the corresponding western blot band was
measured by using a densitometer (Multi Gauge Software;
Fuji Photofilm) and was calculated as the ratio of the signal
intensity in the ischemic hemisphere compared to the
contralateral hemisphere.
6. RNA extraction and real-time PCR
Total RNA was isolated using TRIzol reagent (Invitrogen
Corporation, Carlsbad, CA, USA). Incubate the homogenized
samples for 5 minutes at room temperature to permit the
complete dissociation of nucleoprotein complexes. Add 0.2
mL of chloroform per 1 mL of TRIzol reagent. After
centrifugation, the aqueous phase was transferred to a fresh
tube and the RNA from the aqueous phase was precipitated
by mixing with isopropyl alcohol. The precipitate was
washed twice in 100% ethanol. At the end of the procedure,
briefly the RNA pellet was dried and RNA was dissolved in
diethylpyrocarbonate (DEPC)-treated distilled water. From
each sample was taken for GeneQuant 1,300 spectro-
photometer (Gene QuantTM proRNA/DNA calculator, GE
Healthcare, Amersham, Buckinghamshire, UK) mea-
surement of RNA concentration. The RNA was then stored at
-70℃ before further processing. Total RNA was used in a
reverse transcriptase reaction. For real-time PCR (For
reverse transcription), total RNA (1 μg) was reverse
transcribed for 1 hour at 37℃ in a reaction mix ture
containing 20 U RNase inhibitor (Promega, Madison, WI,
USA), 1 mM dNTP (Promega, Madison, WI), 0.5 ng Oligo
(dT) 15 primer (Promega), 1x RT buffer and 200 U M-MLV
reverse transcriptase (Promega). The reaction mixture was
then incubated at 95℃ for 5 minutes to stop the reaction. The
cDNA was then stored at -20℃ before further processing.
Real-time PCR was performed in 48 well PCR plates (Mini
OpticonTM Real-Time PCR System, Bio-rad Laboratories).
Each reaction mixture contained 10 μL iQTM SYBR Green
Supermix (Bio-rad Laboratories), 1 μL template, and 2 pmol
each primer were added and adjusted with sterile water to al
final volume of 20 μL. The initial denaturation was per-
formed at 94℃ for 5 minutes, followed by 40 cycles at 94℃
for 30 seconds (denaturation), 53-59℃ (Table 1) for 30
seconds (annealing), and 72℃ for 30 seconds (extension),
and a final incubation at 72℃ for 7 minutes to ensure
complete strand extension. Real-time PCR data were
analysed with LightCycler software (Bio-rad Laboratories).
Relative expression levels of genes of interest were
calculated as the difference between the specific ratios
(NMDA receptor/Beta-actin) and were further adjusted on
the basis of their differences in CT values (number of cycles
to reach threshold). Each sample was conducted six times.
Table 1. Primer Pairs and Annealing Temperature for Real-time PCR
Name Primer sequence (5'-3') Annealing
Bcl-2
Bax
Caspase-3
β-Actin
F:TTGACGCTCTCCACACACATGR:GGTGGAGGAACTCTTCAGGGAF:TGCTGATGGCAACTTCAACTR:ATGATGGTTCTGATCAGCTCGF:AATTCAAGGGACGGGTCATGR:GCTTGTGCGCGTACAGTTTCF:TTGCTGATCCACATCTGCTGR:GACAGGATGCAGAAGGAGAT
57℃
55℃
56℃
53℃
J Korean Soc Neonatol 2010;17:181-92 • doi: 10.5385/jksn.2010.17.2.181 185
7. Statistics analysis
Data were analyzed using the SPSS version 12 statistical
analysis package. Examined data were assessed using the
t-test, GLM (general lineal model), and ANOVA. In each test,
the data were expressed as the mean±SD, and P<0.05 was
accepted as statistically significant.
Results
1. Morphologic changes in the embryonic cortical neu ro-nal cell culture of rat (in vitro)
The cortical neuronal cells were observed using light
microscopy under high magnification (×200). The cells in
the N group were well preserved (Fig. 1A), whereas the cells
in the H group showed cellular damages (Fig. 1B). The
cellular patterns of the HD (Fig. 1C) appeared similar to
those in the N group.
2. The expressions of Bcl-2, Bax and caspase-3 antibodies by western blots (Fig. 2A) in the embryonic cortical neuronal cell culture (in vitro)
The expression of Bcl-2 was reduced in the H group
compared to the N group, whereas it showed a greater
increase in the HD group compared to the H group (P<0.05)
(Fig. 2B). Conversely, the expressions of Bax and caspase-3
and the ratio of Bax/Bcl-2 were greater in the H group than
in the N group, whereas they were reduced in the HD group
compared to the H group (P<0.05) (Fig. 2C-E).
3. The expressions of Bcl-2, Bax and caspase-3 mRNAs by real-time PCRs in the embryonic cortical neuronal cell culture (in vitro)
The expression of Bcl-2 was reduced in the H group
compared to the N group, whereas it showed a greater
increase in the HD group compared to the H groups (P<0.05)
(Fig. 3A). Conversely, the expressions of Bax and caspase-3
and the ratio of Bax/Bcl-2 were greater in the H group than
in the N group, whereas they were reduced in the HD group
compared to the H group (P<0.05) (Fig. 3B-D).
4. Gross morphologic changes in the neonatal hypoxic-ischemic brain injury (in vivo)
Gross morphologic changes in the neonatal hypoxic-
ischemic brain injury (in vivo) showed that the percentage of
left hemisphere area compared to right hemisphere area are
107.3% in the normoxia (A; N), 101% in the hypoxia without
operation (B; H), 105% in the hypoxia with Sham operation
(C; HS), 86% in the hypoxia with operation (D; HO), 82.5% in
the D treated with vehicle (E; HV) and 98% in the D treated
with dizocilpine (F; HD) (Fig. 4).
5. The expressions of Bcl-2, Bax and caspase-3 antibodies by western blots in the neonatal hypoxic-ischemic brain injury (in vivo)
The expression of Bcl-2 was reduced in the HO and HV
groups compared to the N, H and HS groups, whereas it
showed a greater increase in the HD group compared to the
HO and HV groups (P<0.05) (Fig. 5A). Conversely, the
expressions of Bax and caspase-3 and the ratio of Bax/Bcl-
2 were greater in the HO and HV groups than in the N, H and
HS groups, whereas they were reduced in the HD group
Fig. 1. Morphologic changes in the embryonic cortical neuronal cell culture of rat (in vitro) were revealed. (A) normoxia; (B) hypoxia; (C) hypoxia treated with dizocilpine.
186 MA Seo, et al. • Neuroprotective Effect of Dizocilpine on Hypoxic-ischemic Brain Injury
Fig. 2. Western blots (A) of Bcl-2 (B: N, 100±2.0; H, 92.4±1.8; HD, 101.8±2.0), Bax (C: N, 100±2.5; H, 116.3±2.9; HD, 107.3±2.7) and caspase-3 (D: N, 100±3.1; H, 116.4±3.5; HD, 92.0±2.8) in the embryonic cortical neuronal cell culture (in vitro) and the ratio of Bax/Bcl-2 expression (E) were revealed (n=4). The dizocilpine was administered at a dose of 10 μg/mL. N, normoxia; H, hypoxia; HD, hypoxia treated with dizocilpine; *P<0.05, statistically significant vs. H.
Fig. 3. Real time PCRs of Bcl-2 (A: N, 100±6.1; H, 43.5±2.6; HD, 75.3±4.5), Bax (B: N, 100±6.4; H, 148.5±8.9; HD, 35.4±2.1) and caspase-3 (C: N, 100±5.2; H, 131.9 ±6.6; HD, 91.4±4.5) mRNAs in the embryonic cortical neuronal cell culture (in vitro) and the ratio of Bax/Bcl-2 expression (D) were revealed (n=6). The dizocilpine was administered at a dose of 10 μg/mL. N, normoxia; H, hypoxia; HD, hypoxia treated with dizocilpine; *P<0.05, statistically significant vs. H.
J Korean Soc Neonatol 2010;17:181-92 • doi: 10.5385/jksn.2010.17.2.181 187
Fig. 4. Gross morphologic changes in the neonatal hypoxic-ischemic brain injury (in vivo) were revealed. (A) normoxia; (B) hypoxia without operation; (C) hypoxia with Sham operation; (D) hypoxia with operation; (E) D treated with vehicle; (F) D treated with dizocilpine. Percentage of left hemisphere area compared to right hemisphere area are 107% (A), 101% (B), 105% (C), 86.0% (D), 82.5% (E) and 98.0% (F).
Fig. 5. Western blots of Bcl-2 (A: N, 100±5.6; H, 105.4±7.5; HS, 119.5±5.9; HO, 54.3±2.7; HV, 70.0±3.5; HD, 118.2±5.9,), Bax (B: N, 100±5.0; H, 97.4±4.8; HS, 1,190±6.0; HO, 314.9±15.7; HV, 300.8±15.0; HD, 106.2±5.3) and caspase-3 (C: N, 100±5.2; H, 91.9±4.6; HS, 102.8±5.1; HO, 172.5±8.6; HV, 221.1±11.1; HD, 99.8±5.0) in the neonatal hypoxic-ischemic brain injury (in vivo) and the ratio of Bax/Bcl-2 expression (D) were revealed (n=4). The dizocilpine was administered at a dose of 10 mg/kg. N, normoxia; H, hypoxia without operation; HS, hypoxia with Sham operation; HO, hypoxia with operation; HV, HO treated with vehicle; HD, HO treated with dizocilpine; *P<0.05, statistically significant vs. HO.
188 MA Seo, et al. • Neuroprotective Effect of Dizocilpine on Hypoxic-ischemic Brain Injury
compared to the HO and HV groups (P<0.05) (Fig. 5B-D).
6. The expressions of Bcl-2, Bax and caspase-3 mRNAs by real-time PCRs in the neonatal hypoxic-ischemic brain injury (in vivo)
The expression of Bcl-2 was reduced in the HO and HV
groups compared to the N, H and HS groups, whereas it
showed a greater increase in the HD group compared to the
HO and HV groups (P<0.05) (Fig. 6A). Conversely, the
expressions of Bax and caspase-3 and the ratio of Bax/Bcl-
2 were greater in the HO and HV groups than in the N, H and
HS groups, whereas they were reduced in the HD group
compared to the HO and HV groups (P<0.05) (Fig. 6B-D).
Discussion
Hypoxic–ischemic encephalopathy (HIE) during the
perinatal period, a single most important cause of acute
mortality and chronic disability in newborns, usually occurs
as a result of intrauterine hypoxia or asphyxia during birth17).
It gives rise to neurological disability and even neonatal
death. The incidence of asphyxia at birth is around 0.2-0.4%
in full-term newborn infants and approaches 60% in
preterm infants18). Between 20 and 50% of asphyxiated
babies who exhibit HIE, die during the newborn period19).
Of the survivors, up to 25% have permanent neuropsy-
chological handicaps in the form of cerebral palsy, with or
without associated mental retardation, learning disabilities or
epilepsy20). These can include attention deficit disorders and
minimal brain disorder syndromes, and may form the basis
for psychiatric and neurodegenerative diseases later in life21).
Neuronal injury may be caused by overstimulation of
excitatory amino acid receptors, including glutamate and
aspartate. This excitotoxicity is predominantly mediated by
calcium influx through ionic channels of activated glutamate
receptors. Hypoxia and ischemia result in overaccumulation
of the excitatory amino acid, glutamate. Glutamate, the
principal neurotransmitter of the brain, is responsible for
many physiologic functions, including cognition, memory,
movement, and sensation. Pathophysiologically, excessive
glutamate activates NMDA, α-amino-3-hydroxy-5-methyl-
Fig. 6. Real time PCRs of Bcl-2 (A: N, 100±4.5; H, 85.3±3.4; HS, 99.3±3.9; HO, 72.2±2.8; HV, 79.6±3.1; HD, 108.7±4.3), Bax (B: N, 100±4.1; H, 109.8±4.3; HS, 102.1±4.0; HO, 184.7±7.3; HV, 127.9±5.1; HD, 95.9±3.8) and caspase-3 (C: N, 100±2.4; H, 116.1±2.3; HS, 118.1±2.5; HO, 224.2±4.4; HV, 169.9±3.4; HD, 121.8±2.4) mRNAs in the neonatal hypoxic-ischemic brain injury (in vivo) and the ratio of Bax/Bcl-2 expression (D) were revealed (n=6). The dizocilpine was administered at a dose of 10 mg/kg. N, normoxia; H, hypoxia without operation; HS, hypoxia with Sham operation; HO, hypoxia with operation; HV, HO treated with vehicle; HD, HO treated with dizocilpine; *P<0.05, statistically significant vs. HO.
J Korean Soc Neonatol 2010;17:181-92 • doi: 10.5385/jksn.2010.17.2.181 189
4-isoxazolepropionate, and kainate glutamate receptors.
Glutamate along with coagonist glycine stimulates NMDA
receptors to increase intracellular calcium, which triggers a
cascade of intracellular reactions, activating phospholipases,
proteases, protein kinases, phosphatases, and nitric oxide
synthase (NOS). The NOS causes increased NO production,
which may damage DNA by base deamination to result in
DNA strand breaks. Damaged DNA activates poly (adeno-
sine 5'-diphosphoribose) polymerase to add deoxyadeno-
sinetriphosphate to the ends of nicked DNA, resulting in
depletion of energy sources from the cell. These pro cesses
ultimately lead to cell death, which can be necrotic or
apoptotic in nature22).
The precise events which initiate the cascade leading to
cell death after HI are still incompletely understood, but are
undoubtedly multifactorial. It is likely partly related to
excessive entry of calcium into cells both during and after
HI23), loss of trophic support from growth factors24), induction
of free radicals during hypoxia and early reperfusion25) and/
or a secondary inflammatory, reaction26), which may act
through activation of cell surface death receptors27), or syn-
thesis of down-stream mediators of cell death such as nitric
oxide synthase and reactive oxygen species28, 29).
The neonatal rat HI model and the cortical cell culture
model of rat embryos have been well characterized and
used extensively to search for neuroprotective agents30). The
most accepted and widely used animal model of perinatal
asphyxia is a modification of the Levine preparation31), which
includes combination of ischemia, obtained by unilateral
occlusion of carotid artery, followed by exposure to hypoxia
in 7-day-old rats. Neurodevelopmental stage of 7-day-old
rats corresponds to that of newborn infants32). This animal
model represents a useful tool for studying potential
neuroprotective strategies capable of preventing or limiting
the perinatal hypoxic.ischemic injury in humans. Our studies
showed that as brain was exposed to hypoxia, the volume of
affected brain was reduced compared to ones of con-
tralateral unaffected brain. However, the affected brain
treated with dizocilpine was restored to the similar volume
of normal brain. In addition, the cortical neuronal cell culture
of rat embryos were prepared from SD rats pregnant for 19
days. The hypoxia were prepared in 1% O2 incubators for 16
hours. Our studies showed that the cortical neuronal cells
cultured in the normal oxygen environment appeared
normal, whereas those exposed in the hypoxic oxygen
environment showed cellular damages. The cellular patterns
of the dizocilpine-treated groups were preserved and
appeared similar to those in the normoxia group.
Cell death may be conveniently classified into two broad
categories : necrosis and apoptosis33). In necrosis, the cells
show early plasma membrane changes, clumping of
chromatin, swelling of intracellular organelles, membrane
breakdown, and leakage of enzymes and proteins causing
extensive inflammatory reactions34). In addition, necrotic
cells appear in patches. In contrast, apoptotic cells are
characteristically scattered throughout the tissue and initially
show condensation of chromatin at the nuclear periphery
and reduction of nuclear size and cell volume35).
The Bcl-2 protein blocks a distal step in an evolutionarily
conserved pathway for programmed cell death and
apoptosis. Bcl-2 is the founding member of the Bcl-2 family
of apoptosis regulator proteins. These proteins govern
mitochondrial outer membrane permeabilization (MOMP)
and can be either pro-apoptotic (Bax, BAD, Bak, and Bok
among others)36) or anti-apoptotic (including Bcl-2 proper,
Bcl-xL, and Bcl-w, among an assortment of others). Some
Bcl-2 family proteins can induce (pro-apoptotic members)
or inhibit (anti-apoptotic members) the release of cyto-
chrome c into the cytosol which, once there, activates
caspase-9 and caspase-3, leading to apoptosis. The majority
of Bax is found in the cytosol, but upon initiation of apoptotic
signaling, Bax undergoes a conformation shift, and inserts
into organelle membranes, primarily the outer mitochondria
membrane37).
The family of caspases are two types of apoptotic
caspases: initiator (apical) caspases and effector (execu-
tioner) caspases. Initiator caspases (e.g. caspase-8, -9)
cleave inactive pro-forms of effector caspases, thereby
activating them. Effector caspases (e.g.caspase-3, -6, -7) in
turn cleave other protein substrates within the cell, to trigger
190 MA Seo, et al. • Neuroprotective Effect of Dizocilpine on Hypoxic-ischemic Brain Injury
the apoptotic process. The initiation of this cascade reaction
is regulated by caspase inhibitors38). Caspases are crucial
mediators of programmed cell death (apoptosis). Among
them, caspase-3 is a frequently activated death protease,
catalyzing the specific cleavage of many key cellular
proteins. However, the specific requirements of this (or any
other) caspase in apoptosis have remained largely unknown
until now. Pathways to caspase-3 activation have been
identified that are either dependent on or independent of
mitochondrial cytochrome c release and caspase-9 func-
tion. Caspase-3 is essential for normal brain development
and is important or essential in other apoptotic scenarios in a
remarkable tissue-, cell type- or death stimulus-specific
manner39).
Stimulation of NMDA receptors induces apoptosis in rat
brain. NMDA-induced cell death was completely inhibited
by the NMDA receptor antagonist dizocilpine40). This result
suggest that apoptotic mechanisms are involved in
excitotoxin-induced cell death.
We used the expressions of Bcl-2 antibodies and mRNAs,
as anit-apoptosis, and the expressions of Bax and caspase-
3, as pro-apoptosis, using western blots and real-time PCR
to detect apoptotic properties in perinatal HI brain injury. In
the present study, the expression of Bcl-2 was reduced in the
hypoxia group when compared to the normoxia group,
whereas it was increased in the dizocilpine-treated group
compared to the hypoxia group. In contrast, the expressions
of Bax and caspase-3 and the ratio of Bax/Bcl-2 were
showed reversely.
In conclusion, our experiments demonstrate that
dizocilpine is able to prevent the degeneration of neonatal
cerebral neuronal cells caused by a hypoxic insult. In
addition, dizocilpine neuroprotective effects on HI brain
injury in neonatal rats may be via anti-apoptosis. The present
study may be useful for the further development of clinical
therapies for perinatal HI encephalopathy induced by
cerebral hypoxia.
한글요약
목적: 비경쟁적 NMDA 길항제인 dizocilpine (MK-801)는 저
산소성 허혈성 뇌병증, 외상성 뇌손상, 흥분독성과 같은 신경 질
환의 동물 모델에서 보호 효과가 있다고 발표되고 있지만 주산
기 가사로 인한 저산소성 허혈성 뇌병증의 치료제로서 그 기전
이 명확하게 밝혀지지 않았다. 저자들은 dizocilpine을 이용하
여 주산기 저산소성 허혈성 뇌병증의 치료제로서 항 세포사멸
사을 통한 기전을 알아보고자 하였다.
방법: 생체외 실험으로 재태기간 19일된 태아 흰쥐의 대뇌피
질 세포를 배양하여 3군(정상산소군, 저산소군, 뇌손상 전
dizocilpine 투여군)으로 나누었다. 정상산소군은 5% CO2 배양
기(95% air, 5% CO2)에 두었고, 저산소군과 뇌손상 전 dizo-
cilpine 투여군(10 μg/mL)은 1% O2 배양기(94% N2, 5% CO2)
에서 16시간 동안 뇌세포손상을 유도하였다. 생체내 실험으로
저산소성 허혈성 뇌병증의 동물 모델에서는 생후 7일된 신생백
서의 좌측 총 경동맥을 결찰한 후 6개 군(정상산소군, 수술 없이
저산소군, sham 수술 후 저산소군, 수술 후 저산소군, vehicle 투
여후 저산소군, dizocilpine 투여 후 저산소군)으로 나누었고,
저산소 손상은 특별히 제작한 통속에서 2시간 동안 8% O2에 노
출시켰다. Dizocilpine은 뇌손상 전후 30분에 체중 kg당 10 mg
를 투여하였고, 저산소 손상 후 7일째 조직을 실험하였다. 생체
외·내 실험 모두 세포사멸사와 관련된 Bcl-2, Bax, caspase-3
항체와 primer를 이용하여 western blots과 실시간 중합효소연
쇄반응을 실시하였다.
결과: 세포사멸사와 관련된 생체외·내 실험에서 Bcl-2의 발
현은 저산소군에서 정상산소군보다 감소하였으나 dizocilpine
투여군에서 저산소군보다 증가하였다. 그러나 Bax와 caspase-
3 발현 및 Bax/Bcl-2의 비는 반대로 표현되었다.
결론: 본 연구에서 dizocilpine은 항 세포사멸사를 통하여 주
산기 저산소성 허혈성 뇌손상에서 신경보호 역할을 하는 것을
알 수 있었다.
References
1) Amir G, Ramamoorthy C, Riemer RK, Reddy VM, Hanley FL. Neonatal brain protection and deep hypothermic circulatory arrest: pathophysiology of ischemic neuronal injury and protective strategies. Ann Thorac Surg 2005;80:1955-64.
2) Choi DW. Cerebral hypoxia: some new approaches and unanswered
J Korean Soc Neonatol 2010;17:181-92 • doi: 10.5385/jksn.2010.17.2.181 191
questions. J Neurosci 1990;10:2493-501.
3) Garthwaite J, Boulton CL. Nitric oxide signaling in the central nervous system. Annu Rev Physiol 1995;57:683-706.
4) Marini AM, Rabin SJ, Lipsky RH, Mocchetti I. Activity-dependent release of brain-derived neurotrophic factor underlies the neuro-protective effect of N-methyl-D-aspartate. J Biol Chem 1998;273: 29394-9.
5) Mukhin AG, Ivanova SA, Knoblach SM, Faden AI. New in vitro model of traumatic neuronal injury: evaluation of secondary injury and glutamate receptor-mediated neurotoxicity. J Neurotrauma 1997;14:651-63.
6) Ayala GX, Tapia R. Late N-methyl-D-aspartate receptor blockade rescues hippocampal neurons from excitotoxic stress and death after 4-aminopyridine-induced epilepsy. Eur J Neurosci 2005;22:3067-76.
7) Kocaeli H, Korfali E, Oztürk H, Kahveci N, Yilmazlar S. MK-801 improves neurological and histological outcomes after spinal cord ischemia induced by transient aortic cross-clipping in rats. Surg Neurol 2005;64 Suppl 2:S22-6; discussion S27.
8) Ford LM, Sanberg PR, Norman AB, Fogelson MH. MK-801 prevents hippocampal neurodegeneration in neonatal hypoxic-ischemic rats. Arch Neurol 1989;46:1090-6.
9) Han RZ, Hu JJ, Weng YC, Li DF, Huang Y. NMDA receptor antagonist MK-801 reduces neuronal damage and preserves learning and memory in a rat model of traumatic brain injury. Neurosci Bull 2009;25:367-75.
10) Jantas D, Lason W. Different mechanisms of NMDA-mediated protection against neuronal apoptosis: a stimuli-dependent effect. Neurochem Res 2009;34:2040-54.
11) Lam TT, Siew E, Chu R, Tso MO. Ameliorative effect of MK-801 on retinal ischemia. J Ocul Pharmacol Ther 1997;13:129-37.
12) Lam TT, Abler AS, Kwong JM, Tso MO. N-methyl-D-aspartate (NMDA)--induced apoptosis in rat retina. Invest Ophthalmol Vis Sci 1999;40:2391-7.
13) Zhang X, Boulton AA, Zuo DM, Yu PH. MK-801 induces apoptotic neuronal death in the rat retrosplenial cortex: prevention by cycloheximide and R(-)-2-hexyl-N-methylpropargylamine. J Neurosci Res 1996;46:82-9.
14) Brewer GJ. Isolation and culture of adult rat hippocampal neurons. J Neurosci Methods 1997;71:143-55.
15) Vannucci RC, Vannucci SJ. A model of perinatal hypoxic-ischemic brain damage. Ann N Y Acad Sci 1997;835:234-49.
16) Feng Y, Fratkins JD, LeBlanc MH. Treatment with tamoxifen reduces hypoxic-ischemic brain injury in neonatal rats. Eur J Pharmacol 2004;484:65-74.
17) Greenwood K, Cox P, Mehmet H, Penrice J, Amess PN, Cady EB, et al. Magnesium sulfate treatment after transient hypoxia-ischemia in the newborn piglet does not protect against cerebral damage. Pediatr Res 2000;48:346-50.
18) Vannucci RC, Connor JR, Mauger DT, Palmer C, Smith MB, Towfighi J, et al. Rat model of perinatal hypoxic-ischemic brain damage. J Neurosci Res 1999;55:158-63.
19) MacDonald HM, Mulligan JC, Allen AC, Taylor PM. Neonatal asphyxia. I. Relationship of obstetric and neonatal complications to neonatal mortality in 38,405 consecutive deliveries. J Pediatr 1980;96:898-902.
20) Delivoria-Papadopoulos M, Mishra OP. Mechanisms of cerebral injury in perinatal asphyxia and strategies for prevention. J Pediatr 1998;132:S30-4.
21) Weitzdoerfer R, Pollak A, Lubec B. Perinatal asphyxia in the rat has lifelong effects on morphology, cognitive functions, and behavior. Semin Perinatol 2004;28:249-56.
22) Chan PH. Mitochondrial dysfunction and oxidative stress as determinants of cell death/survival in stroke. Ann N Y Acad Sci 2005;1042:203-9.
23) Zipfel GJ, Babcock DJ, Lee JM, Choi DW. Neuronal apoptosis after CNS injury: the roles of glutamate and calcium. J Neurotrauma 2000;17:857-69.
24) Clawson TF, Vannucci SJ, Wang GM, Seaman LB, Yang XL, Lee WH. Hypoxia-ischemia-induced apoptotic cell death correlates with IGF-I mRNA decrease in neonatal rat brain. Biol Signals Recept 1999;8:281-93.
25) Bågenholm R, Nilsson UA, Götborg CW, Kjellmer I. Free radicals are formed in the brain of fetal sheep during reperfusion after cerebral ischemia. Pediatr Res 1998;43:271-5.
26) Giulian D, Vaca K. Inflammatory glia mediate delayed neuronal damage after ischemia in the central nervous system. Stroke 1993;24(12 Suppl):I84-90.
27) Graham EM, Sheldon RA, Flock DL, Ferriero DM, Martin LJ, O'Riordan DP, et al. Neonatal mice lacking functional Fas death receptors are resistant to hypoxic-ischemic brain injury. Neurobiol Dis 2004;17:89-98.
28) Allan SM, Rothwell NJ. Inflammation in central nervous system injury. Philos Trans R Soc Lond B Biol Sci 2003;358:1669-77.
29) Huang SS, Tsai MC, Chih CL, Hung LM, Tsai SK. Resveratrol reduction of infarct size in Long-Evans rats subjected to focal cerebral ischemia. Life Sci 2001;69:1057-65.
30) Ashwal S, Pearce WJ. Animal models of neonatal stroke. Curr Opin Pediatr 2001;13:506-16.
31) Vannucci RC. Hypoxic-ischemic encephalopathy. Am J Perinatol 2000;17:113-20.
32) Towfighi J, Mauger D, Vannucci RC, Vannucci SJ. Influence of age on the cerebral lesions in an immature rat model of cerebral hypoxia-ischemia: a light microscopic study. Brain Res Dev Brain Res 1997; 100:149-60.
33) Wyllie AH. Apoptosis and the regulation of cell numbers in normal and neoplastic tissues: an overview. Cancer Metastasis Rev 1992; 11:95-103.
34) Gerschenson LE, Rotello RJ. Apoptosis: a different type of cell death. FASEB J 1992;6:2450-5.
35) Johnson EM Jr, Deckwerth TL. Molecular mechanisms of develop-mental neuronal death. Annu Rev Neurosci 1993;16:31-46.
36) Dong JW, Zhu HF, Zhu WZ, Ding HL, Ma TM, Zhou ZN. Intermittent hypoxia attenuates ischemia/reperfusion induced
192 MA Seo, et al. • Neuroprotective Effect of Dizocilpine on Hypoxic-ischemic Brain Injury
apoptosis in cardiac myocytes via regulating Bcl-2/Bax expression. Cell Res 2003;13:385-91.
37) Wolter KG, Hsu YT, Smith CL, Nechushtan A, Xi XG, Youle RJ. Movement of Bax from the cytosol to mitochondria during apoptosis. J Cell Biol 1997;139:1281-92.
38) Thornberry NA, Lazebnik Y. Caspases: enemies within. Science 1998;281:1312-6.
39) Porter AG, Janicke RU. Emerging roles of caspase-3 in apoptosis. Cell Death Differ 1999;6:99-104.
40) Qin ZH, Wang Y, Chase TN. Stimulation of N-methyl-D-aspartate receptors induces apoptosis in rat brain. Brain Res 1996;725:166-76.
top related