massey engineering, technology and food technology yearbook 2008
Post on 23-Mar-2016
234 Views
Preview:
DESCRIPTION
TRANSCRIPT
BACHELOR OF ENGINEERING BACHELOR OF TECHNOLOGY
BACHELOR OF FOOD TECHNOLOGY
YEARBOOK 2008
Te Kunengaki Pürehuroa
www.massey.ac.nz0800 MASSEY
YE
AR
BO
OK
2008
www.me.ac.nz
Foreword
For over forty fi ve years, Massey University has demonstrated a tradition of excellence in Engineering and Technology. This began in 1960, with the university’s fi rst Technology degree, growing progressively in subsequent years. Now in 2008, the university offers a total of fourteen majors within the degrees of Bachelor of Engineering and Bachelor of Food Technology.
The inherent characteristic of each degree major is that of a multi-disciplinary package, which has been designed to prepare graduates to meet the demands of specifi c industries. Unlike traditional engineering degrees, the majority of Massey majors are not discipline-based. This approach came about in direct response to industry demands, which called for graduates with the appropriate technical and technical management skills to support New Zealand’s food and manufacturing industries.
The fi rst programme to be introduced was the Bachelor of Food Technology, which was the second programme of its kind worldwide. Massey’s fi rst ICT (Information & Communications Technology) offering was Computing Technology, which was fi rst offered in 1979. Massey was the fi rst university to fully recognise the importance of Product Development and has offered this subject as a degree major since 1988. In 1989 we offered a major in Information Engineering, one of the fi rst universities worldwide to offer this major. In 1999 Massey introduced New Zealand’s fi rst degree major in Mechatronics, a modern hybrid of precision mechanical engineering, electronics, automation and control.
Over the years, the scope of the programme has been extended to encompass a wide range of productive industries and the number of degree majors offered has continued to increase steadily. Massey University is equipped to undertake research and teaching in each of its fourteen different major offerings in engineering and food technology.
This book has been compiled to celebrate work completed by our 2008 graduating students, describing their fi nal year projects which represent the culmination of their time and academic learning at Massey University.
Prof Ian MaddoxProgramme Director (Engineering & Technology)
2
Index Year Book 2008
Bachelor of Technology (BTech) Page
Degree Major Major LeaderFood Technology Pg 8 Dr Marie WongFood Engineering Dr Owen McCarthy Students
Eva Beech 9 Alex Bettink 10
Natasha Birt 11 Hannah Brian 12 Craig Buddle 13 Kirstin Challies 14 Ting Chen 15
Peter Connole 16 Esther Cummings 17 Isaac Flynn 18 YiRan Ji 19
Yannan Jiao 20 Jacus Kruger 21 Nurul Kusumaningrum 22 Xi Li 23 Anthony Light 24 Hayley Moston 25 Jacqueline Murfi tt 26 Faeza Quazi 27 Anna Searle 28 Bronwyn Smith 29 Thomas Sowersby 30 Simon Thomas 31 Juan Wang 32
3333
Degree Major Major LeaderProduct Development Pg33 Prof Allan Anderson
StudentsOlivia Allan 34
Derisly Carson 35 Nikki Galpin 36 David Henderson 37 Brad Howarth 38 Tuan Ma 39 Stefanie Murray 40 Simon Neumegen 41 Sophie Tubbs 42 Jemma Wells 43 Aliena Wieland 44
Bachelor of Engineering (BE)Degree Major Major LeaderBiotechnology Prof Tony Paterson
Bioprocess Engineering Pg 48 Students Matthew Baunton 47 Eli Gray-Stuart 48 Shah Mohammed 49
Degree Major Major LeaderChemical and Prof Richard HaverkampNanotechnology Pg 50
StudentsMelissa Basil-Jones 51
Morgan Bridges 52 Konrad Shaffer 53
Page
4
Degree Major Major LeaderComputer and Dr Fakhrul AlamElectronic Engineering
Electronics & Computer Assoc Prof Donald BaileySystems Engineering
Software Engineering Pg 55 Dr Jens Dietrich
Students Max Andrew 56 Mark Bentley 57 Seshi Chemuduguta 58 Daniel De Guzman 59 Nathan Eichler 60 James Jones 61 Mohammad Kashem 62 Priti Lohani 63 Arthur Pandian 64 Benjamin Phillips 65 Michael Phung 66 Romar Roldan 67 Craig Webb 68
Degree Major Major LeaderEnvironmental Technology Dr Andy Shilton& Sustainable Energy Pg 69
Students Haydee Allan 70 James Mars 71 Bradley McEldowney 72 Jason Turley 73
Chi Yuen 74
Page
55
555
Degree Major Major LeaderElectronics & Communication Dr Mohammad RashidEngineering
Telecommunications and Prof Richard HarrisNetwork Engineering Pg 75 Students Sneh Chandwani 76 Matthew Lyon 77 Shanup Mody 78 Priyanka Reddy 79 Selva Selvaraj 80
Degree Major Major LeaderMechatronics Pg 81 Prof Gurvinder Virk Students Ranuka Abeysinghe 82 Sagar Acharya 83 Ayesha Afreen 84 Peter Ataallah 85 Kyle Boyce 86 Mark Bryant 87 Adam Bullen 88 Mark Cameron 89 Aidan Campbell 90 Clinton Darch 91 Matthew Finnie 92 Gregory Flynn 93 Morio Fukuoka 94 Oliver-James Grant 95 Andrew Hayton 96 Mikaere Henderson 97 Jeffrey Ho 98 Phillip Hogg 99 Eric Hsu 100 Thomas Hulbert 101 Pritesh Lohani 102
Page
6
Martin Ma 103 Bret Martin 104
Maryan Moharib 105 Umberto Murray 106 Daniel Naulder 107 Alexander Ogidi 108
Adam Patten 109 Andrew Pearson-Ward 110 Xiaoyu Su 111 Heki Tauli 112 Jamie Wark 113 Hongda Wu 114 Min Wu 115
Degree Major Major LeaderEngineering and Dr Johan PotgieterIndustrial Management Mr Ralph Ball
Manufacturing & Industrial StudentsTechnology Pg 116 Mohammed Aiyaaz 117
Hamish Arcus 118 Charles Davidson 119 Brett Grobler 120
Lin Pan 121
Degree Major Major LeaderIndustrial Automation Pg 122 Dr Huub Bakker
Students Michael Caulton 123 Steven Charles 124 Christopher Harris 125
Denise Wai 126 Di Wang 127 Joel White 128 Derek Wills 129 Rui Zhang 130
Page
Bachelor of Technology (B
Tech)
Food
Tec
hnol
ogy
(BFo
od T
ech)
FFoodd
TTTeeeecccccccccc
hhhhhhhhhnnnnnnnnnnooooooooooollllllllllll
ooooooogggggggyyyy
((((BBBBBFFFFFFFoooooo
oooodddd TTT
eeeecccchhh))) Food Technology (BFoodTech)
“New Zealand’s $25 billion dollar food industry contributes to over 50% of the country’s export income. This industry is internationally competitive and technologically advanced. Have you ever walked down a supermarket aisle and wondered who develops all the new and exciting food products appearing on the shelves? The Food Technology degree is aimed at producing graduates who are professionals in the areas of new food product development, food processing at industrial scale, food safety and quality management. Graduates also learn about and understand areas such as consumer research, nutrition, packaging and project management, as well
gaining practical insights and exposure to the food industry over the course of the degree.”
Dr MarieWongMajor Leader Auckland Campus
9
In today’s world obesity is the health issue which
will affect more people than any other and, in
addition to this, the number of people diagnosed with
type II diabetes is growing. These issues are causing
consumers all over the world to evaluate their diets
with many people trying to make positive changes.
Yoghurt is an important component of a healthy diet but there are concerns with
the sugar content of many of the products currently available on the market. In recent times there has been an infl ux of reduced sugar yoghurts on the market
though the majority of these yoghurts contain artifi cial sweeteners orremain unsweetened.
This project looked at a range of natural intense sweeteners and their potential usein a reduced sugar yoghurt formulation. The project was for the most part sensory
based with a trained sensory panel of Massey University students being used at thevarious stages of the project.
Finally a trained sensory panel from Fonterra assisted in optimising the reduced-sugar yoghurt formulation.
EvaBeech
Food Technology (BTech)
Previous EducationWairarapa College
Contactevabeech@gmail.com
Development of Low Sugar Yoghurt
10
The sponsor has found a unique opportunity in the pet milk market and
is looking to develop a product for launch,
potentially, into the asian market.
The project itself was relatively straight
forward.It was found that cats have more specifi c nutritional
requirements so the pet milk was tailored to suit them this means it can be
consumed by dogs as well.
The product had to suvive the UHT process while retaining its palatability
over a 6 month shelf life.
AlexBettink
akaAlexFood Technology (BTech)
Previous EducationTauranga Boys College
Contactalex.downinablazeofglory@gmail.com
Development of a nutritionally balanced pet milk
11
NatashaBirt
akaTashFood Technology (BTech)
Previous EducationSacred Heart New Plymouth
Contactnatasha.birt@hotmail.com
Fonterra has developed a new whey protein powder.
This whey protein is the fi rst of its kind and because of
its modifi ed behaviour may be suitable in applications
where traditional whey protein isn’t.
The purpose of this project was to investigate the
potential of this new whey protein in a baked product.
Potential markets for the product included sport supplementation, weight loss and people needing a meal on the go such as trampers. The product could be a muffi n, biscuit,
baked cereal bar, savory baked goods etc.
The fi rst stage of this project was to conduct a literature and information search to investigate market trends in high protein products, nutrition of
whey protein and whey protein in food systems.
Some initial experimentation was carried out to see how the whey protein affected parameters such as texture or taste in baked goods. Concept
development could then commence using techniques such as idea generation and screening. Focus groups and consumer surveys were
also used to identify the ideas with most potential. The best concept was formulated and tested for acceptability using consumers.
The fi nal outcome of this project was a tasty baked product, high in protein.
Whey Protein Baked Good
12
HannahBrian
Food Technology (BTech)
Previous EducationWaihi College
Contacthannahbrian@gmail.com
Cedenco is a fruit and vegetable processing
company located in both Hawkes Bay and Gisborne.
From January to June they process squash into frozen pieces and puree
for the export market with a particular focus on the
Japanese market. During the squash processing season approximately
5500MT of squash waste is generated and has to be
disposed of.
The project looked to try and recover the squash waste into value-added applications for Cedenco. A process review was carried out and the waste characterised into fi ve streams such as seeds, skin, and fl esh. A literature review was conducted to identify
twelve possible applications for the waste streams including biomass, health products and food products.
Six applications were selected for further investigation and the squash waste steams were subjected to a range of chemical, microbiological and physical tests to determine
the suitability of the squash waste for the identifi ed applications.
The business opportunity, including market, investment, and product costs, for two chosen applications was then investigated.
Squash Waste Recovery
13
Craig Buddle
Food Technology (BTech)
Previous EducationHeretaunga College
Contactc_buddle@hotmail.com
A porter is a delicious dark beer with fl avours
of chocolate, coffee and rich fruity notes which we all enjoy.
Traditionally the porter was brewed with
brown malts the beer was dark brown in
colour with a red hue. It was a bitter beer and
with its high amount of hops it revolutionised the beer industry. Now porters are made from Chocolate malts and are well balanced in terms of malt and bitterness.
The aim of my project was to create a porter and effectively age it in whisky barrels. By aging it in whisky barrels the beer was to mellow and take on some of the characteristics of whisky. The beer was to be a high
alcohol special reserve, limited edition brew.
One of the most challenging parts of this project was not producing the beer but obtaining the whisky barrels, as there are no longer any whisky
distilleries in New Zealand.
Another challenge was formulation as there was limited time and it takes more than four weeks to turn the malt to beer.
Development of a Whisky Porter
14
KirstinChallies
akaKeiksFood Technology (BTech)
Previous EducationWoodford House
Contactkirst_chall@hotmail.com
ZespriTM GOLD kiwifruit is a yellow fl eshed
cultivar that is popular with consumers due to
its sweet taste. Muchof the New Zealand-
grown ZespriTM GOLD is exported to Asian markets, principally
Japan. In order to maximise sales in these
markets it is important that optimal quality is provided. Firmness is
an important sensory characteristic that also gives an indication of ripeness. Firmness is not only infl uenced by fruit maturity, it is also infl uenced by the
temperature that the fruit is exposed to during storage, and the temperature of the fruit when it is measured. Firmness is measured throughout the supply
chain and as temperature can differ between these testing points, it is important to understand the effect of fruit temperature on fi rmness measurements. This
effect is known for Zespri(TM) GREEN (‘Hayward’) but not for Zespri(TM) GOLD (Hort16A). The aim of the project was to establish a model that could be applied
when testing the fi rmness to account for the effect of temperature. In order to establish the model, fi rmness data was collected at different temperatures for
fruit from multiple growers over an extended storage trial period.
Temperature-fi rmness models forZESPRI GOLDTM
15
TingChen
akaAlFood Technology (BTech)
Previous EducationRangitoto College
Contactal.ting.chen@gmail.com
A good foam head is an essential characteristic
of a quality beer. Due to cultural differences,
the customers in Europe prefer beer
with a layer of creamy foam on the top of the
beer. Beer without a head is considered to be a beer that is off. In
Australasia, consumers pay less attention to beer foam but still prefer beer that has a foam head. As a result, it is very important to make sure
that each batch of beer has consistent foam stability.
Hops give beer bitterness taste and also enhances beer foam stability. Iso-alpha acid compounds are extracted from the added hops. Many researchers believe that iso-alpha acids have a major contribution to
beer foam stability. Moreover, compounds that contribute positively to foam stability are lost during the batch and continuous fermentation
brewing process so it is critical to monitor the iso-alpha acid change from wort boiling to fi nal packaged beer.
My project is to monitor hop compounds utilised/lost during batch and continuous fermentation brewing processes.
Determine hop utilisation/loss duringbatch and continous brewing process
16
PeterConnole
Food Technology (BTech)
Previous EducationTauranga Boys College
Contact p.g.connole@massey.ac.nz
My project involves the development of
a Persimmon pulp product for fruit that is
not of export quality. The pulp is to have a
consistency similar to that of apple sauce,
and the challenge is to retain the unique orange
colour and fl avour ofthe persimmon. The project is sponsored by Natural Touch Limited, a major grower of
persimmons in New Zealand.
Possible processing methods to be investigated for the pulp include freezing, pasteurisation, UHT and canning. Initial trials indicated that
high temperature treatments cause whitening of the pulp possibly due to destruction of betacarotene. The presence of the enzyme PPO
causes browning if it is not destroyed during the heating process.
Further work has shown that canning and UHT will probably cause undesired colour and fl avour changes, so freezing and pasteurisation
are the main focus for processing. Many different treatments are being completed to attempt to fi nd an acceptable balance where
there is minimal whitening and no residual browning.
Development of a Persimmon PulpProduct
17
My project this year was developing a chocolate honey spread for Honey
NZ. The spread was aimed to be similar to
that of Nutella, except essentially replacing
the sugar content with honey. The inclusion
of hazelnuts was also optional. Previous
attempts to make this spread had been unsuccessful; with stability
issues being the main contributing factor.
My literature review concentrated on emulsion stability and interactions between ingredients.
I then focused on fi nding a desirable texture for the spread before fi nding the best combination
of fl avour. Sensory testing, shelf life trials and scale-up procedure are also an important part
of this project.
EstherCummings
Food Technology (BTech)
Previous EducationTauranga Girls’ College
Contactesthercummings@gmail.com
Development of Chocolate Honey Spread
18
Isaac Flynn
Food Technology (BTech)
Previous EducationTauranga Boys College
Contactisaacfl ynn@hotmail.com
My project involves developing a new smoothie drink for
Goodman Fielder‘s Meadowfresh
brand. The Smoothie has a milk
base with added fruit. The main
aspects of developing this product include market research, developing a suitable formulation, sensory (taste
testing, checking the product for bugs (micro- testing), and producing the
product on the pilot plant scale.
UHT Fruit Smoothie
19
YiRanJi
Food Technology (BTech)
Previous EducationMassey University Foundation Studies
Contactjiyuxin1985@yahoo.com.cn
There is strong demand fromfood service businesses for
so called cafe milks used forcoffees, teas, milkshakes
and smoothies. Therehave always been issues
around the steam frothingperformance of milks,
especially consistencyacross the year. Whey
proteins have been founduseful in enhancing foam
systems, but little has beendone on steam frothing. No
specifi c work has been donelooking at modifying wheyprotein physico-chemistry
to improve milk steamfrothing.
My project aims to uncover new information about whey protein physico-chemistry that can be used in the development of superior cafe milks.
A commercial espresso machine (available at Fonterra Palmerston North) is used for the steam frothing to ensure direct commercial applicability. The fi rst part of the project focused on the effect of different levels of whey protein addition on milk steam frothing properties. The second stage of the project focused on changing the physico-chemical
state of the whey proteins through pH adjustments and heat treatments. The frothing properties of milks were assessed using volume, texture, colour and gloss. The state of
the whey proteins were investigated using SDS PAGE, the protein and fat distribution on milk foam were investigated using confocal microscope.
The investigation of superior cafe milk
20
Fonterra Brands Tip Top Ltd are always bringing new,
exciting and innovative products to consumers.
They do this through a wide range of fl avours
and textures which give consumers an enjoyable
and unique eating experience everytime.
Sauce is a value-added inclusion that is commonly
added to ice cream. This could be added in the form of a smooth ripple variegated through ice cream, injected into the
product, added on as a top layer or dipped.
Tip Top is interested in understanding the effect of different stabilisers and processing involved in the topping making process.
This was done using a statistically designed experiment. The factors studied included the amount and type of gum or thickener
added, the amount of fat and the amount of calcium ions. Statistical analysis was conducted to determine which factors signifi cantly
affected the topping. This was measured by assessing product cost, viscosity, texture, and various sensory properties. The results showed a list of general trends for topping production. This allows
Tip Top to use the results to design toppings with specifi c attributes.
YannanJiao
akaKatherineFood Technology (BTech)
Previous EducationWanganui High School
Contactkatherinejj@hotmail.com
Investigation of processing parametersand formulation for ice cream applications
21
Goodman Fielder is a major New Zealand
producer of dairy products, including
milk and yoghurt, with many of these products
common on New Zealand supermarket shelves.
However, in industry the potential throughput is
often under-utilised due to wastage of product during the production
process. This leads to an unnecessary loss of potential revenue. Therefore
Goodman Fielder was seeking to optimise current production processes at it’s Longburn processing site. The purpose of
this project was to investigate the cultured foods production plant - identifying positions of signifi cant product losses within process lines and proposing corrective changes. The position
and volume of product losses were determined by collecting waste streams and analysing the content to allow the amount
of product in these streams to be calculated. Once this data has been obtained, corrective changes can be suggested,
which may include adjusting current procedures, valve timings or repairing equipment.
JacusKruger
akaJacusFood Technology (BTech)
Previous EducationParaparaumu College
Contactjacus01@gmail.com
Investigation of product losses and yieldimprovement of a cultured food production plant
22
The aim of my project was to optimise the production and
quality of extruded snacks made from pea (chickpea) and
cereal products (rice bran, corn fl our, beans, etc). The
idea is to design a high protein snack that can be consumed
commercially, similar to some snacks available in the market
such as Cheezels, Twisties, and Rashuns made by Bluebird.
Chickpea was chosen because it is relatively dense protein food source available with more than twice the protein density of
dairy and 5 times the protein density of beef. In developing countries where animal protein is not available or is unaffordable, pulses such as chickpea are a cheap primary source of nourishment
with high nutritional value.
The experiment was completed at Massey University using an extruder and the preparation of ingredients and physical testing was completed at Crop and Food. An experimental design was
made to help fi nd the ideal combination of legumes and cereals to give a nutritious expanded snack food that has a light crispy texture.
The products have turned out very well; after initial problems with the extruder, a well expanded product has been created. The product is similar to a “cheese ball”, the size of a grape. It has a crispy texture and a delicious taste (a mixture of corn and chickpea). Some of this product has
been fl avoured with Cajun, cheese, and bacon fl avour... and it tastes really good!
NurulKusumaningrum
akaNurul,Nural,LuluFood Technology (BTech)
Previous EducationAvonside Girls High School
Contactn.kusumaningrum@gmail.com
Optimisation of the production of highprotein snacks derived from legumesp g
23
My fourth year project is sponsored by Flavojen
Ltd. This company provides us with a very unique Bio- surfactant
which is called Rhamnolipids which
is innovatively used in bread. Rhamnolipids are Glycolipids Bio-surfactants that are produced naturally by bacteria, Pseudomonas aeruginosa, in
fermentation processes. Rhamnolipids are also known to havea range of important characteristics such as a natural food
ingredient, including emulsifi er, humectant, and antifungal agent.
The aim of this project was to evaluate the potential use ofrhamnolipids as an improver and/or softener in breadmaking.
Bread is highly perishable with a short period of acceptable qualityshelf life. The loss of freshness and quality is due to a number of
factors including staling, moisture loss and microbial spillage.In this project, the effects of incorporation of rhamnolipids were
determined by characterising the physical properties (volume,weight, moisture content, water activity, colour, textures, etc)of breads and analysing the microbial stability of breads. The
results were compared to the control bread without containing rhamnolipids.
XiLi
akaX-RayFood Technology (BTech)
Previous EducationInner Mongolia Agriculture College, CHINA
Contactleexi2008@hotmail.com
Effect of an addition of rhamnolipids onbread
24
As the demand for innovative solutions to a
“time poor society” moves ahead, an opportunity to
add a breakfast cereal into yoghurt, producing a
healthy and convenient on the go snack has been identifi ed. This product is
designed to meet the needs of mobile adults who take
breakfast on the run or who skip breakfast. This trend is particularly concerning since breakfast is often referred to as the most important meal of the day.
The project has some major challenges to overcome in order to succeed,especially since the texture of cereal within the smooth and creamy
yoghurt is expected to remain crunchy. In order to do this, the use andfeasibility of using innovative ingredients in the products formulation to help
prevent moisture migration from the yoghurt to the cereal will need to beinvestigated.
The project’s product development process will require extensive consumermarket research and testing, formulating; a full scaled up production trial
and fi nally shelf life testing. Three fl avour variants are also required forsuccessful completion of the project.
AnthonyLight
akaTonyFood Technology (BTech)
Previous EducationFDMC New Plymouth
Contactredlight4red@hotmail.com
Yoghurt & Cereal On the Go BreakfastSnack
25
The farmer-owned New Zealand Co-operative is the largest independent supplier of blackcurrant
products in the world. The role of the co-operative is to source fruit from growers in
New Zealand, process the fruit to an intermediate form
and sell these products to food companies.
This project investigates the sensory aspect of three varieties of individual quick
frozen blackcurrants, the Ben Ard, Ben Rua and Magnus varieties. The
aim of this project was to develop fl avour descriptors and characterise the sensory attributes for these three varieties of NZ Blackcurrants. This was done by training a sensory panel to develop and detect blackcurrant
descriptors. These results were correlated with pH, Brix and colour measurements, as well as volatile measurements gained from gas-
chromatography mass spectrometry work, to determine any signifi cant relationships.
The results gained will assist the New Zealand Blackcurrant Co-operative in offering more descriptive specifi cations to potential customers, and give
them a method of segregating inventory based on fl avour properties.
HayleyMoston
akaHayleyFood Technology (BTech)
Previous EducationNew Plymouth Girls High School
Contacthayleymoston@gmail.com
The sensory profi ling of New Zealandblackcurrants
26
The aim of this project was to reduce the ingredient
usage for pretreating vegetables prior to
dehydration. This was to be done while maintaining an
acceptable sensory quality. The work was carried out on behalf of Heinz
Wattie’s™, Christchurch. In previous seasons the level
of ingredients used has well exceeded the expected
amount and therefore the expected expenditure.
During the production of their dehydrated vegetables Heinz Wattie’s uses a number of ingredients to improve the fi nal product quality. Their carrots, green beans and peas contain sodium citrate and sodium carbonate to enhance the product’s colour retention and improve texture with faster rehydration times. For
certain products they also use sodium bicarbonate, sugar or sodium sulphite.
A number of trials were run whereby the level of ingredients was reduced and the fi nal vegetable quality was measured. Statistical analysis was
carried out to determine the impact on the product and maximum reduction that could be successfully used next season. In addition, the project involved
determining the cost saving per vegetable, the impact of spraying waste water on the pasture and the introduction of new measurement devices.
JacquelineMurfi tt
akaJacquiFood Technology (BTech)
Previous EducationHillmorton High School
Contactjacquelinemurfi tt@hotmail.com
Ingredient Reduction of DehydratedPeas, Beans and Carrots
27
The aims of this project were to reduce the bacterial
count in raw skim milk by passing it through a
microfi ltration membrane and to determine microbial
reduction over time.
The project involved assessing the capability of
two ceramic membranes with pore sizes of 1.4 Âμm and 0.8 Âμm to reduce the
microbial content in raw skim milk without altering the composition of skim milk which is to remain unheated. Experimental
runs were carried out at different combinations of temperature, transmembrane pressure and recycle fl ow rate.
Working in a sanitised environment and collecting samples using aseptic methods was a major concern in this project in order to reduce any
contamination. Microbial reduction was monitored over time by taking fi ltrate samples every fi ve minutes for one hour.
Microbial tests were carried out on all the samples collected during each run to identify presence of Esherichia coli, Staphylococcus aureus, Coliforms, Aerobic bacteria and Somatic cells. All the samples collected
from each run were also tested for any loss in protein and total solids.
FaezaQuazi
Food Technology (BTech)
Previous EducationMt. Roskill Grammar
Contactfaezaquazi@gmail.com
Microbiological reduction in raw skim milkusing membrane technologyg gy
28
This project based on dry-mix protein
beverages was sponsored by Crop
and Food Research. The purpose of this
project was to study the links between
sensory attributes and rheological properties,
with varying levels of hydrocolloids in the
protein beverages. The rheological properties of the beverage were
studied using small strain oscillation and rotational rheology.The sensory attributes were studied using two panels in order
to rank the thickness of the beverages.
Viscosity trials were conducted to ensure the beverages wereformulated within the same viscosity range as current dry-
mix protein beverages on the market. Different hydrocolloidsrequire different amounts to be used, in order to provide
the same viscosity. Beverages were formulated to have thesame levels of viscosity, regardless of the amount and type of
hydrocolloid used.
AnnaSearle
Food Technology (BTech)
Previous EducationVilla Maria College, Christchurch
Contactanna_searle136@hotmail.com
The links between sensory attributes and rheologicalproperties of dry-mix protein beveragesp ope t es o d y p ote be e ages
29
The collection and utilisation of consumer survey information is a
major part of the product development process. This
project aims to maximise the competitive advantage
associated with such consumer information by combining it with census data. This is achieved by combining the two data
sets using variables which appear in both survey
data and census data, for example; age, ethnicity
and income. As the census is a highly detailed record of New Zealand society this combining of data sets allows consumer
information which was not surveyed to be inferred. Such further information may include household composition, access to internet,
sources of income, level of education and any other informationcollected as a part of the census. The system can also be used to
calculate the desirability as a target area of each meshblock within New Zealand, where a meshblock is a group of approximately 70 houses. This
information can then be used by companies in selecting localities into which they wish to launch their product.
BronwynSmith
akaBronFood Engineering (BE)
Previous EducationNapier Girls’ High School
Contactb_smith@hotmail.com
Development of a Consumer Profi lingSystem
30
Local and international beer industries are looking to
break into the female market segment which is a huge, but
traditionally a non beer drinking demographic. A small organic
New Zealand Brewery has noticed that their current beers
do not cater for females and would like to develop a product
which women can enjoy.
Initial work carried out included research into the brewing process as well as a look at the current market trends. It was seen that women
consumers make up 30% of the American beer market, especially in the area of light beers. However, it was evident, both overseas and in New Zealand, that little is done
to advertise and target this potentially huge demographic.
The practical work was carried out on the new Massey microbrewery. Experimental brews have been based on the results of sensory work, which determined an
ideal beer profi le for women. The resulting beers were tested against the profi le and adjustments to the recipe made. Following the second experimental brew,
fi nal products were tested on the target consumers to determine the best recipe. Scale up issues were then resolved to enable the process to be carried out at the
commercial brewery.
ThomasSowersby
akaTomFood Technology (BTech)
Previous EducationLindisfarne College
Contactt.sowersby@gmail.com
Development of an organic beer targetedat women
31
This project was sponsored by New Zealand King
Salmon. The company was looking for a range
of convenience products that could be sold from
supermarkets to the public or into the food service
sector. The project required the development of a
salmon portion with sauce or glaze which will be sold frozen. The product will be in a pouch that will enable
the consumer to cook it from frozen using three different cooking techniques. They are; microwave, boil in the bag, and
steaming. The salmon is a raw portion, skin on bone out that weighs 150 grams. A range of sauces will be available to offer
the consumer a selection to cater for differing tastes and likes.
Today’s consumer is looking for fast, convenient, healthy and delicious products. The health benefi ts of salmon have
been well publicised of late which contributes to the products reputation and premium perception. Careful selection of the
sauces and glazes to accompany the salmon will provide a premium product. This project is aiming to fi ll a gap in the
market place and provide a product that meets the wants and needs of the modern consumer.
SimonThomas
Food Technology (BTech)
Previous EducationPompallier College
Contactsmonthomas@hotmail.com
Heat and Eat - Salmon and Sauce
32
Vitamin C is an essential nutrient for human
beings which also has an antioxidant property.
The vitamin exists in two forms naturally: ascorbic
acid and dehydroascorbic acid. Ascorbic acid is the
main form and is more biologically active than degydroascorbic acid. Ascorbic acid is added into products at Frucor
Beverage Ltd to maintain the quality. It is, however, a good reducing agent which can be
oxidised easily into non-biologically active compounds. Oxidationof ascorbic acid happens during processing and storage and the
rate of degradation is mostly infl uenced by heat, light, oxygen,ingredients, packaging material and surface area. Five products
with up to four pack types were stored under three differenttemperatures for four months to investigate the infl uence of those
factors on ascorbic acid degradation. The rate of degradation wasdetermined and used to predict the shelf life of the products which
enables correct labeling. Ascorbic acid concentrations of rawmaterials and samples before and after pasteurisation were also
measured to investigate the effect of the thermal processing used.
JuanWang
akaCocoFood Technology (BTech)
Previous EducationKapiti College
Contactmywangjuan@hotmail.com
Ascorbic Acid Degradation
Product Developm
ent (BTech)
PPPPPPPrrrrrrrrrrroooddddddddddddduuuuuuuuuuuuuucccccccccccccctttttttttttttt DDDDDDDDDDDDDDeeeeeeeeeeeeeevvvvvvvvvvvvvveeeeeeeeeeeeeelllllllllllloooooooooooppppppppppppppmmmmmmmm
eeennnnnnnnnnnnnntttttttttttttt ((((((((((((((BBBBBBBBBBBBBBTTTTTTTTTTTTTTeeeeeeeeeeeeeecccccccccccccchhhhhhhhhhhhhh))))))))))))))Product Development (BTech)
“Product development at Massey University provides students with the opportunity to
combine the creative skills of design with the fundamentals of technology and engineering
in developing commercially valuable products. New Zealand has a long history of product development and innovation - the Britten motorcycle, the Hamilton Jet, the electric
fence, pineapple lumps, and list goes on. Our companies and our country rely on new products
to generate revenue and growth. One of the key issues confronting New Zealand is our lack of valuable natural resources. We must create added value in our products and much of this
added value will be founded on smart technology and engineering.”
Prof AllanAndersonMajor Leader Auckland and
Palmerston North Campus
34
My fi nal year project for Furnware Ltd of Hastings,
was to develop a “stand at “ table for school students
that is height adjustable to suit students of various
heights. Furnware’s aim is to produce furniture
that improves the learning environment. It was suggested that the development of such a
product would enhance Furnware’s existing product
range.
The project involved extensive research including movement in learning, muscuoloskeletal disorders in students, cooperative
learning and ergonomics. Concept generation and development along with prototyping and testing were used to establish the
fi nal physical product design. A manufacturing and marketing plan were developed and a feasibility analysis was carried out.
OliviaAllan
Product Development (BTech)
Previous EducationPalmerston North Girls High School
Contactoli_lollipop@hotmail.com
Project Active Option
35
In my 4th year of a product development degree, a
start-up company has asked me to develop a product that will help a consumer have a
better and faster shopping experience.
By developing a new software, I have designed a system to integrate a device
with a shop’s point of sale and a consumer’s home
computer. This system will have a wide range of
positive possibilities for consumers such as allowing an easy way of budgeting.
Working closely with my client’s and Massey University’s product development metrics, this working prototype will be used to help
demonstrate the future potential of the design and aid in the company going forward.
The project involved researching various technologies and software integration systems. User-interfaces were designed to demonstrate
the functional features and benefi ts of the system.
This is a commercial project just prior to release, details are withheld to conform with the client’s request.
DerislyCarson
akaAndrewProduct Development (BTech)
Previous EducationWaimea College (Nelson)
Contactderisly@hotmail.com
36
My fi nal project was based on the development of a
lower arm prosthetic. The product idea was initiated
by an amputee from Massey University, Palmerston
North, looking to improve his prosthetic hand.
The primary aim of this project was to produce an
innovative and effective lower arm prosthetic,
allowing more movement within the prosthetic and without body and arm restriction.
The changes made will improve day to day activities, includingsporting and leisure actions, delicate item use and precision itemuse. This will be done while ensuring the health of the user is not
sacrifi ced. The design is based around two important features,ease of use and low cost to the user. It will also address a number
of issues presented by a range of prosthetic users.
NikkiGalpin
Product Development (BTech)
Previous EducationPalmerston North Girls High School
Contactnikki.galpin@gmail.com
The Arminator
37
The aim of my 4th year project was to create
a protective system for a sensitive laboratory instrument which will
allow transportation and operation allowing for
consistent performance under New Zealand rural
environmental conditions.
My project investigated packaging techniques that would provide the sensitive
instrument with adequate protection against shock and vibration. There was also a focus on designing the protective system to be user friendly through handling
and real time operation.
The project was sponsored by the Rotorua-based company Scion which involved identifying needs, concept generation and development, prototype
development and testing,development of the manufacturing and marketing plan, through to the
overall feasibility analysis.
DavidHenderson
akaDaveProduct Development (BTech)
Previous EducationRathkeale College
Contactd-g-henderson@hotmail.com
Mobility for a Sensitive LaboratoryInstrument
38
BradHowarth
akaB-radProduct Development (BTech)
Previous EducationRangitoto College
Contactbrad.howarth@gmail.com
For my fi nal year projectI worked in cooperation
with a local company CleanFlow Systems Ltd on a sonar unit for inspecting
below the water level in stormwater and wastewater pipes.
CleanFlow Systems Ltd has previously
specialised in laser and camera technology for
the quantitative analysis of pipes. To complete the
picture they needed a means of examining underwater, sonar being the chosen method.
The method to inspect partially surcharged pipes is to mount the inspection equipment on a fl oat. Competing sonar units have used a
rotating transducer that performs a scan of the inside pipe wall; however, as it is mounted on a fl oat there is a degree of side-to-side movement that
causes the image produced from these units to be either stretched or compressed. The solution was to use an array of ten transducers.
This project involved the design and testing of the electronics, transducers and the sonar units housing. The client is very happy with
the project outcomes.
Sonar Profi ler
39
TuanMa
akaJohnProduct Development (BTech)
Previous EducationHung Vuong High School, Vietnam
Contactmatrong84@yahoo.com
A part of my 4th year project was to research,
design and develop an electromechanical
“cleaning device for yards”. This client-sponsored
project was more demanding than expected.
Competitor research showed that most products
are heavy, cumbersome and expensive. More
importantly, they cannot perform the tasks required
by the product. This project applied the iterative development process: analyse, design and evaluate to ensure the new productcan fulfi ll those market needs. Users can use the product but with
less time and energy required to get the job done. Even better, abuilt-in speed controller allows users to adjust the speed of theproduct to suit their needs, and can store it easily. Issues such
as safety, ergonomics and functionality in various contexts were considered.
This project is commercially sensitive, hence I am unable to release any details currently.
The real-world project provided exciting challenges, and insights into real business, technical and design skills.
40
StefanieMurray
Product Development (BTech)
Previous EducationMarlborough Girls College
Contactstefanie_murray86@hotmail.com
My project was sponsored by Jaques Project Management;
a local playground equipment design
company, who requested the re-design
of an existing product, the Jumbo Swing.
The Jumbo Swing is a multiple user swing,
which uses a double hinge system and a circular carriage to reduce damage on impact.
However, the original design does not meet New Zealand safety standards. Therefore a redesign was required to produce a swing that
complies with these standards. In addition to this, the aim was to improve the swings aesthetics, ease of maintenance and user friendliness for
maximum fun, inspiration and interaction between users. This involved market and consumer research, research into safety regulations, idea generation, concept development, prototyping, testing and a fi nancial
evaluation. Key deliverables of this project were a full scale working prototype, manufacturing and marketing plans, a feasibility analysis and
recommendations to the company.
The Jumbo Swing
41
SimonNeumegen
akaNEUMEProduct Development (BTech)
Previous EducationLytton High School (Gisborne)
Contactihateoranges@hotmail.com
The product I developed is an autonomously roving
swimming pool surface leaf and debris collecting
device.The product is for the residential pool
market and would keep the pool surface looking
pristine all the time by routinely collecting surface matter. This would remove the need to skim the pool’s surface before swimming. The product would also lessen the task of cleaning the pool because it
would collect most of the leaves before they sink to the bottom and require vacuuming up. The aim of this self-initiated project is to prove
the concept and do the preliminary testing in coming up with a product solution. The main aspects of the project are: what the product does
and how this helps the user; the manner in which it collects matter; and how the device roams the pool surface and is powered.
The project has involved collecting user input, concept generation and creating and testing prototypes. The outcomes for this project will
include: feasibility analysis; commercialisation and manufacturing plans; and recommendations of how the product should be
commercialised.
Project Make a Pool Skimming Device
42
SophieTubbs
akaSophieProduct Development (BTech)
Previous EducationChristchurch Girls High School
Contactsophie_tubbs@hotmail.com
The aim of my projectwas to produce a
product that could beused in commercial
kitchens to reduce the variability in cooking
steaks and improve theoverall quality.
The project involvedsurveying chefs and
commercial cooks as to their problems with
current cooking methods and requirements.
Conditions for cooking steak were researchedto determine the parameters required to achieve
consistency. A prototype process was developedand tested for application in commercial kitchens.
Steak Tenderiser
43
The aim of thisproject was to design,
manufacture, andfully commercialise autensil which aids the
consumption of fruit.More specifi cally, a
utensil which combinesthe cutting and
scooping functionsnecessary to consumefruit, such as kiwifruit,
fejoa, and tamarillo.
The product needed to be suitable for a wide range of ages and abilities to meet the needs of the consumer. Key attributes included being able
to easily slice through a fruit whilst still being safe for younger users; being able to remove a majority of the fruit in a single scoop; being
durable and dishwasher safe; eye-catching aesthetics which would entice consumers into purchasing both the product and related goods.
Completing the project required many facets of both product development and industry in general. Detailed planning of design,
manufacturing, and marketing stages were crucial to the success of the product.
JemmaWells
akaJemProduct Development (BTech)
Previous EducationTe Puke High School
Contactjemmawells@hotmail.com
Frootensil - Fruit Utensil
44
AlienaWieland
akaAlienaProduct Development (BTech)
Previous EducationLong Bay College
Contactaliena.wieland@gmail.com
Product development is defi ned as the transformation of
ideas into new and innovative products or marketable concepts, processes or
services.
For my fourth year project I was able to work with a client who was in the process of starting
up a new company and was in need of a product which would fulfi l the markets needs, while
at the same time making a profi t. The project focussed on
producing an electronic beauty product for the New Zealand
and international market. It was interesting to work with a product which was to be launched commercially as it opened my eyes
to a whole lot of challenges and possibilities in the industry.
The Bachelor degree has provided me with an opportunity to gain a base understanding of how to follow a project from the initial planning and design, through to the market launch.
Unlike many other Engineering degrees, which focus on the engineering side of projects, the Product Development major has not only given me the opportunity to expand my knowledge
of engineering practices, but also enabled me to analyse projects from a creative view point. Massey University’s Product Development degree has enabled me to gain a better
understanding of the Product Development industry, which will enable me to contribute to the growth of companies.
Through both the knowledge gained from my studies, and my own personality I think I can contribute signifi cantly to new product development.
Bachelor of Engineering (B
E)
Biotechnology (BE)
Bioprocess engineers are in demand worldwide, especially in modernbiotechnology industry. This rapidly growing industry uses natural andengineered biocatalysts - microorganisms, human and animal cells, plant cells and enzymes to produce biopharmaceuticals, foods, industrial chemicals, and biomaterials. These even extend to the replacement
of skin and heart valves. More traditional areas of employment include the biologically based industries, such as the dairy industry, where processes are engineered that turn milk into plastic, muscle and alcohol.Bioprocess engineers help prevent environmental degradation by designingand operating biological process for destroying wastes.
Prof TonyPatersonMajor Leader Palmerston North CampusB
iotechnology (BE)
47
MatthewBaunton
akaThe Missing ManBiotechnology (BTech)
Previous EducationWanganui High School
Contact bauntonm@gmail.com
Two different methods for measuring the low levels
of amorphous lactose in asample of lactose powder
sample were tested. Samples in the range of
1.0-0.1% w/w amorphous lactose were used to
test both a method using dynamic vapour sorption
(DVS) instrument and an alternative method
using a relative humidity probe. Both methods
measured the change in vapour pressure above the sample to determine how much water was released during the
crystallisation of the amorphous lactose. Neither method was able to measure low levels of amorphous lactose due to mechanical failures in the isolation of the systems. With correct isolation of the systems more encouraging results
should be achieved in the future.
Measurement of small quantities ofamorphous lactosep
48
EliGray-Stuart
Bioprocess Engineering (BE)
Previous EducationPalmerston North Boys High School
Contactgray_stuart@hotmail.com
Microalgae, like plants,nuts and seeds produce
oil which can be madeinto biodiesel. Algaehave been touted as
having the potential tofi ll the ever growing
void being created bydepleting fossil fuel
reserves. However, inorder for microalgae
to be an economicallyviable option, the lipidyield needs to be maximised. Nitrate and phosphate are essential nutrients for the growth of algal cultures. The
limitation of these nutrients has been shown to increase the lipid content of the algae. I grew the algae Chlorella
vulgaris and my project was concerned with quantifying the effect that nitrate and phosphate had on the growth and
lipid content of the algae.
Assessment of production of biodieselprecursor oils by microalgaep y g
49
ShahMohammed
akaMukarramBiotechnology (BE)
Previous EducationAwatapu College
Contactraleigh_nz@yahoo.co.in
Antimicrobial peptides (AMPs) are short sequences of amino
acids, produced by all life forms, including animals, plants
and micro-organisms. These are one of the key components
of the innate immune system of the host thereby acting as
the fi rst line of defence against invading microorganisms.
These peptides work by either inhibiting the growth
of or killing microorganisms. The antimicrobial peptides
produced by plants and animals have broad-spectrum
activity, essential for protection against a wide range of microbial invasions. They have been demonstrated to be active against a wide range of pathogenic microorganisms, including
Gram-positive and Gram-negative bacteria, viruses, fungi and yeast. Whereas, the antimicrobial peptides produced by microbes have narrower range of activity, understandably, so the host is
not susceptible to its own peptides. Apart from the antimicrobial action of these peptides, they are also involved in wound repair, infl ammation and adaptive immune response of the host cells.
Most AMPs have a net cationic charge; however, some anionic and even neutral AMPs have also been discovered. These features are critical for their mode of action, which involves electrostatic
interaction between the phospholipid membrane and the peptides, and the amphipathic nature enables membrane permeabilisation. With the growing problem of microorganisms developing
resistance to traditional antibiotics, the broad spectrum activity of AMPs, make them a potential candidate to be used as antibiotics. Hence, the aim of this research was to purify and characterise
antimicrobial peptides from the ovinecrude extract.
Purifi cation and Characterisation ofAntimicrobial Peptides from Ovine Bloodp
Chem
ical
& N
anot
echn
olog
y(B
E)Chh
eemmic
al &&
NNann
otteec
hhhhhnnnoooll
oogggggyyyy(((
BBBBEE) Chemical & Nanotechnology (BE)
Chemical engineering is the basis for many productive industries in New Zealand and internationally. This traditional discipline is being transformed by developments in nanotechnology which enable new processes to be established and new products to be created. Nanotechnology enables greater energy utilisation for existing processes and the development of new energyconversion technologies. The BE(Hons) Chemical and Nanotechnology degree blends a traditional chemical engineering degree with the latest advances in nanotechnology to equip graduates to contribute to creating a more prosperous and environmentally sustainable society.
Prof Richard HaverkampMajor LeaderPalmerston North Campus
51
MelissaBasil-Jones
akaMelissaChemical & Nanotechnology (BE)
Previous EducationSacred Heart College, Lower Hutt
Contactbasil-jones.m@hotmail.com
My project focused on whether the clumping
of grease ice is due to attractive forces
between ice crystals. Grease ice is a type of ice slurry that forms in
Polar Regions under turbulent conditions and is an important process in polar ice
formation. The slurry is comprised of small disks of ice approximately 0.1-0.4 cm in diameter
and 1-100m in thickness. The experimental work involved producing grease ice in a cold room at -15°C by agitating a glass tank of salt water. Once the crystals were produced the wave generator was switched off
and the crystals left to settle. This process was repeated using solutions containing varying concentrations of ethanol, which acts as a surfactant. The affect of the ethanol on the crystal clumping behavior was observed.
The experimental results indicate that there is an attractive force between grease ice crystals. However fi eld trials are required to confi rm
that this process has a signifi cant effect on the natural process. This is because it is unknown how water currents effect this clumping as they
are diffi cult to model.
Attractive Forces in Grease Ice
52
MorganBridges
Chemical & Nanotechnology (BE)
Previous EducationAwatapu College, Palmerston North
Contactmorgan.j.bridges@gmail.com
The project looked at some of the factors that may infl uence
the stabilisation of Allophane in
order to propose methods that could
potentially improve the stabilisation properties
of Allophane clays to make them suitable for
subsoils in roading.
Stabilisation of Allophane
53
KonradShaffer
akaKsideChemical & Nanotechnology (BE)
Previous EducationWanganui High School
Contactkonradshaffer@gmail.com
My project was investigatingthe mechanisms of road
stone polishing using variousmicroscopy techniques. I
wanted to see whether roadpolishing, which causes
a reduction in skiddingresistance and thus safety,
could be attributed to the road stones porous structure
becoming fi lled withcontaminants rather than
just wearing smooth whichis most commonly attributed
to road polishing in literature.Different road stones wereanalysed straight from the
road using a light microscopeand a scanning electron microscope (SEM). The road stones were then ultrasonically
cleaned to remove surface contaminants, while leaving the surface texture unchanged, then microscopically analysed again. The results from both light microscope and SEM showed an increase in porous structure and removal of loose dirt particles for all the road stone samples
analysed except for new road stones. Also the SEM was found to be advantageous over the light microscope as 3-dimensional images could be acquired with much greater depth and
clarity. It was concluded that polishing of road stones can be attributed in part to the stones porous surface becoming fi lled with contaminants and thus leading to a smoothed over
polished surface. The contaminants were likely to arise from stones (supporting current road wear theories) but also from the surrounding environment to the roads. One recommendation
was to research an applicable surface cleaning technique be used on roads to rejuvenate surface texture and increase skidding resistance.
Skid Resistance of Paving Stones
Elec
tron
ics
& C
ompu
ter S
yste
ms
Engi
neer
ing
(BE)
Com
pute
r & E
lect
roni
c En
gine
erin
g (B
E)EEElll
eeeccctttrrr
ooonnniiic
s &&&
CCCooommm
pppuuuttteee
r SSyyss
tteem
sEnn
ggiinne
eriinn
g (B
E)CCCooo
mmmpppuuu
ttteeerrr &&&
Ele
ctro
nic
Engggiii
nnneeeeeerrr
iiinnng
(BE) Computer & Electronic Engineering (BE)
(Formerly Computer Systems Engineering)
“Much of our modern world uses computer software and electronic hardware. From the humble mobile phone to personal organisers, IPOD, MP3 players, TVs, radios, GPS units, DVD players and so on. The key technologies underpinning these everyday consumer items are studied in this major. A graduate would fi nd employment as an electronics design engineer or computer engineer. In electronic technology the world is bursting with opportunity and awaits the next generation of graduates.”
Dr FakhrulAlamMajor LeaderAlbany Campus
Electronics & Computer Systems Engineering (BE)(Formerly Computer Systems Engineering)
“Electronics and computer technologies enable much of what we take for granted, from communication to transportation, to security, to entertainment, to living (cooking, cleaning, heating). As the electronics becomes more complex, it is becoming more programmable and also more interconnected. This major bridges the gap between electronics and computing with a strong emphasis on both hardware and software design, particularly at the systems level. With the growth in ICT, there is strong demand for graduates who can design complex electronic and computer systems and apply them in newareas.”
Assoc Prof DonaldBaileyMajor LeaderPalmerston North Campus
Software Engineering (B
E)Softw
are Ennngggiiinnneeeeeerrriiinnnggg (((BBBEEE)))
Software Engineering (BE)
“Software Engineering is the discipline of designing, creating, and maintaining software by applying technologies and
practices from computer science, project management, engineering, application
domains and other fi elds.Graduates are employed as project
managers, business analysts, and software architects. There is a strong demand for
software engineers here in New Zealand and abroad. CNN Money has recently rated
software engineers “best job” based on salaries, expected growth in the industry, and
job prospects.”
Dr JensDietrichMajor Leader
Palmerston North Campus
565656
MaxAndrew
akaTamataElectronics & Computer Systems Engineering (BE)
Previous EducationMalapoa College (Vanuatu)
Contactowen_501@hotmail.com
This fourth year project is associated with the
Student Space Exploration and Technology Initiative
(SSETI) project for the European Student Earth Orbiter (ESEO)satellite. The Massey University
Student Initiative Ground station (MUSIG) is part of the SSETI project and its
goals are to automatically track and communicate with the ESEO onboard receiver and transmitter. The tracking system is divided into different subblocks: antenna orientation,
amplifi cation, frequency conversion, modulation and coding, and data processing and networking. My project objective was to implement the frequency conversion,
and modulation and coding subblocks. To be more precise, my focus is to down-convert the received signal from the ESEO satellite and demodulate it in accordance to the Consultative Committee for Space Data Systems (CCSDS). To implement that, I used a Universal Software Radio Peripheral (USRP) motherboard, containing a fi eld
programmable gate array (FPGA) with its relevant daughter board to down convert the incoming signal and then digitally process it (demodulate) using software. The USRP
works with the GNU software radio, which is an open source Software Defi ned Radio (SDR) platform. This software runs on a Linux platform (Ubuntu 7.10) making it easier to code, using python, the digital processing blocks. This approach has the advantage in
that the digital processing (demodulation) is now seen as a software problem other than hardware thus reduces the cost of hardware implementations.
SSETI PROJECT- Modulation and Coding
57575
MarkBentley
Computer Systems Engineering (BE)
Previous Education Northcote College
Contactmarkbentley72@hotmail.com
The virtual reality glove although not a new concept has
been redesigned using newer technologies to
provide a more fl uid and intuitive experience. This new ease of use
will hopefully move this and similar devices
into more mainstream usage.
The device itself can be broken down into three basic elements;the sensors, microcontroller and USB interface.The sensors
which take real world inputs like acceleration and position sendanalog inputs to the microcontroller. The micro then processes
the inputs and connects to a PC via USB. Constantly transmittinginformation from the glove the device can be used instead of astandard computer mouse and can also transmit 3D positional
information to client software such as games and designsoftware.
VR Glove
58585
SeshiChemuduguta
Software Engineering (BE)
Previous EducationMount Roskill Grammar
Contactseshi_@hotmail.com
This project is aboutstepping up desktop
applications user interface in terms of
intuitive use and visual appeal from the days of
windows 3.11.
The outcome is a proof of concept POS
system that is new and innovative and different from the others in the market with
a strong emphasis on the user interface and the way a user
interacts with the application.
Monique - next generation point of salesystemy
59595
The project is about developing reusable
software components to provide a mobile database
system. These components would be installed on a
USB fl ash drive and then plugged into and run on
any Windows PC, without any need to install drivers
or confi gure the host computer. A portable database engine has
been built. However, it is not currently SQL-compliant. To integrate the database system into an application, a programmer needs to make calls on a complex API that requires the programmer to
understand how the database engine has been implemented. My task is to make the implementation invisible to the programmer by developing drag-and-drop components
that provide a developer-friendly interface to the mobile database system.
The fi rst component provides an SQL-compliant interface which allows developers to access the database by setting simple properties and to manipulate data using the SQL
language.
The system uses a custom format database. If there is time, I will design a second component which enables the mobile database engine to access any database that can
be translated into a standard XML format.
Note: The screenshot provided is only the testing/debugging environment and not the actual programme.
DanielDe Guzman
akaDanielSoftware Engineering (BE)
Previous Education:Palmerston North Boys High School
Contact:d2g45@yahoo.co.nz
Mobile Database
60606
NathanEichler
akaCameronElectronics & Computer Systems Engineering (BE)
Previous EducationSt. Peters College, Palmerston North
ContactNathan.Eichler@gmail.com
Do you enjoy eating shellfi sh? Are you aware that some
shellfi sh accumulate harmful quantities of a dangerous
chemical called domoic acid? Domoic acid has been identifed as the cause of a human illness
known as “amnesic shellfi sh poisoning” (ASP). People
affected by ASP can suffer from a variety of unpleasant
symptoms including nausea, stomach pain, short-term
memory loss, brain damage, or even death as a result of eating shellfi sh with elevated
levels of domoic acid.
Although lab tests can accurately detect the presence and concentration of domoic acid in shellfi sh, this testing
is very costly and inconvenient for shellfi sh harvesters. I am collaborating with masters student Mohd Syaifudin
Abdul Rahman to design a portable sensor device for use in sample testing and preliminary screening in an “on-boat” environment. Our device will provide a relatively
cheap, convenient and robust way for harvesters to quickly determine whether their catch should be sent to a lab for
further analysis.
Portable microcontroller based sensingsystem for food quality assessmenty q y
61616
JamesJones
akaMikeSoftware Engineering (BE)
Previous EducationKatikati College
ContactJames.Jones.10@uni.massey.ac.nz
The project “RDF merging in Centrufl ow”
is an industry based project and involves
researching and creating software for the Wellington based company Centrufl ow
(see www.centrufl ow.com).
Centrufl ow is a software product that addresses the issue many businesses have of being unable to separate
useful information from large amounts of data, it does this by enabling the visualisation of data in the form of simple nodeedge graphs in real time. It
currently supports the visualisation of one database at a time.
The purpose of this project is to add multiple datasource functionality to the Centrufl ow data visualisation software, this will allow users to specify
multiple datasources and have the information from all of them available visually including any relationships between them. Centrufl ow software
will also be extended to support more datasources including RDF fi les, SPARQL sources and LDAP sources.
RDF merging in Centrufl ow
62626
MohammadKashem
akaShobhonComputer & Electronic Engineering (BE)
Previous EducationAvondale College
ContactEmail: shobhonkashem@hotmail.com
My project is developing awireless sensor network
mostly for home basedsystem or indoor. For this
I have decided to useXbee mouldes for wirelesscommunication which has
Zigbee protocol alreadyinstalled in them. For
purpose of sensor testing Ihave simply used an LM335temperature sensor, othersensors such as humidity,
sound pressure etc can beadded later if needed. For developing phase I have used the Digi’s developing boards to
test the modules and setup up network. Next I started designing the power supply and PCB to hold the Xbee modules. Design consideration included less power consumption
from each node and being portable.
In the design phase I have taken into consideration for different wireless topologies such as mesh and point to multipoint. I hope at end of the project I would be able to have a mesh topology setup. As far as data storing is concerned, the sensor data is collected
at the co-coordinator node and I wrote software to store data in the database and hopefully by the end I would be able to access this data using the internet.
The end result of this is periodic data acquisition to monitor the atmospheric temperature and keep a record of the trends in temperature rise/fall.
Wireless Sensor Network
63636
PritiLohani
akaPriiComputer Systems Engineering (BE)
Previous EducationMount Albert Grammar School
Contactpritidotcom@hotmail.com
A microprocessorincorporates most or
all of the functions of acentral processing unit
on a single integratedcircuit. The Microchip is a
semiconductor device atthe heart of the computer.It’s a piece of silicon with
many tiny transistorsembedded in it. It is
increasingly found insidealmost everything from wristwatches to computers. My project is about designing an 8-bit microprocessor chip. I have chosen this project because of my interest in
the design of integrated digital systems. Since the availability of the microprocessor and memory chip now makes it feasible to design rather sophisticated digital
systems with quite inexpensive hardware and occupies a small volume, it is likely that anybody who is involved or interested with the design of digital systems will need to know the inner workings of single chip microprocessors. By undertaking
this project, I have developed vast knowledge on digital circuits and logic design. I have learned to design a chip with a reduced instruction set. I am also trying to
develop special I/O instructions, so that it can control external devices. My chip is designed in such a way that it can be used as a CPU in computers and can also be
used in handheld devices as a micro-controller if we make use of low power circuit design techniques. Another reason that I undertook this project is that I can also
extend this project to a Masters or Doctoral work by carrying out layout design and fabrication at a later date.
Design an 8 bit microprocessor chip
64646
ArthurPandian
Computer & Electronic Engineering (BE)
Previous EducationMt Roskill Grammar School
Contactc.e.o@vodafone.co.nz
Developments of humanoid robots arebeing conducted all
over the world. Artifi cial intelligence is an
area of science that fascinates the minds of
people. When peoplesee animatronics, an
inner process inside us attempts to interpret the device as human
which is why robots have the ability to captivate
the minds of peoplewho observe them. In this project the aim is to conceptualise, design as well
as construct a robotic/animatronic head that can be controlled using voice commands. The main goal of the head design is to ensure that the head can
interact with end users in an adequate and entertaining manner. The project will implement a lot of visual basic programming and will utilise a lot of servo control
as well as speech recognition technologies. The head will be able to react to certain commands that are said by the user. As an example if the user told to
turn left then the head will acknowledge that it has received the command and then turn left.
Voice controlled head
65656
BenjaminPhillips
akaBenComputer Systems Engineering (BE)
Previous EducationKing’s College
Contactb.phillips777@gmail.com
Initially designed for military use, UAVs
have become widely used in environmental science research and
civil surveillance. I was to develop a system
whereby a fi xed wing aircraft could be piloted
by a microcontroller which travelled to
preprogrammed coordinates input by the user whilst maintaining
a predetermined height. This was done by employing the use of a barometer and GPS module to monitor the aircraft’s height and
lateral location respectively. Manual operation of the vehicle can be resumed at any point using
the transmitter.
Autonomous Unmanned Aerial Vehicle
66666
MichaelPhung
Electronics & Computer Systems Engineering (BE)
Previous EducationAwatapu College
Contactmike.phung@gmail.com
Objective:Create a system that allows users to measure key health
characteristics with the ability to use the data to analyse
trends within the data collected from the user and between
users.Overview:
There are many applications where fast and simple health
measurement in a lightweight, portable device with a fl exible
software package is useful such as in the following scenarios: • Child growth monitor
Monitor and trend child growth and health to compare their progress with relevant age measures
• Hospital OutpatientsHospital patients who require their basic physical condition to be monitored (especially elderly
patients and children)• Sports and fi tness users
Automated system to classify users into appropriate competition categories
As the above needs for each of the above scenarios are different, the system must be modular andeasily confi gurable and customisable to each need.
Method:The system is based on a 8051 microcontroller that captures data given by load sensors in a
platform and height captured by ultrasonic sensors. It is then able to transmit the captured data to a conventional computer where the data can be analysed through categorisation and trending.
The system also has fl exibility to add magnetic swipe cards for user identifi cation and other medical moniting system (e.g.: resting heartrate monitor)
Medical Monitoring and Logging System
67676
RomarRoldan
akaRomarSoftware Engineering (BE)
Previous EducationMindoro State College of Agricult & Tech
Contactrjbroldan@gmail.com
The Learning Support tool is a small part of an existing
prototype for second-language learning called
IMMEDIATE.
IMMEDIATE is a system that is delivered in an online-
learning environment. The Learning Support tool will
be responsible in providing the users personalised
support for getting more information about a
particular key concept. Key concepts could be
words, grammatical rules or cultural references.
Providing information about a key concept is more than
presenting the defi nition, it should be designed for optimised learning and provide guidance. It should be easily usable to the users, within the learning framework, and presented
much like in a person-to-person environment. The Learning Support aims provide functionalities that would usually require intelligent features. The
framework and design of the Learning Support will be usable in other domains/environment.
Natural language interfaces to supportimmediate learningg
68686
CraigWebb
Electronics & Computer Systems Engineering (BE)
Previous EducationAwatapu College
Contactsupremedictator4life@gmail.com
I worked on a monitoring system for the elderly
to determine if they are in need of help. Not as
invasive as cameras and with calibration more
reliable than a button the consumer has to press.
Monitoring electrical appliances in the home is the existing network
where I added a fl ow sensor to the network
to allow for more monitoring and better data to determine if the user is in need of help.
With more work on the software it will allow for acalibration period to make the system more custom
to the user and their weekly patterns.
Home Monitoring System using WirelessSensors
Environmental Technology &
Sustainable Energy (BE)
Environmental Technology &
Sustainable Energyy ((BBBEE)
Environmental Technology and Sustainable Energy (BE)
The Environmental Technology and Sustainable Energy major brings together
the engineering study of two of the world’s most precious resources - water
and energy. Traditional Environmental Engineers have focused on water
resources but more and more they must also be expert in energy resources. Clever
and innovative water management and treatment processes are crucial to the
maintenance of water resources and the environment around us.
Sustainable energy has been embraced throughout the world yet, relative
to traditional energy sources, is an industry in its infancy. Come and save
the world (and make very good money doing it) by implementing clever
environmental technologies and through the development of sustainable energy
generation options.
Prof.AndyShiltonMajor Leader
Palmerston North Campus
70
Haydee Allan
Environmental Engineering (BE)
Previous EducationWairarapa College
Contacthaydeeallan@gmail.com
Hydrogen provides an alternative to fossil fuels
in the transportation sector, but in order for
it to be introduced a number of issues need
to be addressed. These include the development of clean, carbon neutral,
methods of production. The electro- oxidation of glycerol enables this to be achieved, provided
electricity used is carbon neutral, with the additional benefi t of disposing of a waste product from the biodiesel industry. Past research has found that glycerol
can by oxidised with metal catalysts. This project compares the effi ciency of nanoparticles catalysts of Pt-Ru, Au-Ru and selected Pt-Au-Ru alloys towards
the oxidation of glycerol in a hydrogen cell. The catalysts were formed on a carbon support with a Nafi on proton exchange membrane. A Pt cathode was
used for the reduction of protons to hydrogen.
The effi ciency was tested using linear sweep voltametry. The Pt0Ru50 catalyst was the most effi cient over the experimental range (0.2V to 1V). The effi ciency of
the cell generally decreased with reductions in the platinum content.
In comparison to hydrogen production by water electrolysis, production by glycerol oxidation is very favourable in terms of the energy costs.
Catalysts for the ElectrochemicalProduction of Hydrogen from Glycerol
7171
JamesMars
akaCamEnvironmental Technology and Sustainable Energy (BE)
Previous EducationChrists College
Contactjcameronmars@hotmail.com
Phosphorus is a limiting nutrient in many ecosystems
and if in excess an increase in primary productivity resulting in excessive plant growth and
decay can result. The resulting high Biological Oxygen Demand
severally reduces oxygen levels in waterways resulting
in poor water quality with detrimental effects on fi sh
and other animal populations. Phosphorus can be found in
excess in many wastewaters and it is important that the
phosphorus concentration be reduced prior to any effl uent being released into a waterway.
There are many methods for the treatment and disposal of wastewater; however, of importance to this project is Waste Stabilisation Pond treatment. Algae are an important constituent of these
ponds performing a number of functions one of which is phosphorus removal.
In the event of excess phosphorus availability, algae take upmore phosphorus than what is required for respiration and growth and store it as polyphosphate granules within cellular compartments, as a result an algal cell may contain 8 -16 times more phosphorus than the
minimum required quota.
A mixed culture of algae dominated by the genus Scenedesmus was used in the research experiment; Scenedesmus is commonly found in New Zealand Waste Stabilisation Ponds in
summer. Solutions containing the mixed algal culture in a phosphorus enriched medium were placed under constant light intensities and under fl uctuating light intensities and monitored. The
data was examined to determine which light intensity or fl uctuating light intensity provided the highest and most effi cient uptake of phosphorus out of solution.
The effect of light intensity on phosphorus uptake and polyphosphat synthesis by microalgaep yp p y y g
72
BradleyMcEldowney
akaBRADEnvironmental Technology and Sustainable Energy (BE)
Previous EducationFeilding Agricultural College
Contactbrad.kaz@xtra.co.nz
My 4th year project involved the implications of an embedded system,
including a comparison of an embedded system and
a common grid connection system. The project
came about, due to an existing subdivision which
was looking at using an embedded system.
An embedded system is thought to have many
various implications so this project had an aim to resolve and clarify the situation. The conclusion was to help people
considering an embedded system, by clarifying areas which were thought to be of a problem.
The problems were solved by researching into the existing documentation and completing a cost analysis. The cost analysis showed that an embedded system is viable but has complications
due to the amount of systems that are currently in operation.
This project was highly benefi cial to myself as I am heading into the renewable energy industry in Australia where embedded
systems are regularly used and familiar to the electrical industry.
Distributed Generation Implications for aSmall Rural Communityy
7373
JasonTurley
akaTURLSEnvironmental Technology and Sustainable Energy (BE)
Previous EducationAwatapu College
Contactjaseturley@gmail.com
The premise behind myfourth year project was the
development of concentratingbut non-focusing, nontracking,solar concentrator. The design
specifi cations outlined by mysupervisor, Andy Duncun,
detailed some limitations suchas the site at which they would
be situated and the allowabledimensions. The units were to
be positioned on the facia ofa house (under constructionat that time in a renewable/
sustainable development). Theycould be constructed to follow the sun’s aspect seasonally, but not on a daily or hourly basis. They
had to be sturdy to handle potentially harsh environmental conditions and also made of suitable materials to last a suitable period of time. It was proposed that the heat generated from the units would be utilised for space heating in the house. The cost per unit and heat generating capacity
would determine the viability of the design in general.
Experimental testing of the design will continue to maximise the variables set into the design of the units. Mainly the shape of the half round refl ector used to radiate direct beam radiance back onto
the absorber. Additionally using single or double glazing of the units to minimise heat losses will be investigated.
Basic heat transfer theory studied over the previous years is being utilised along with sustainable technologies that have been reviewed. Further work on the project will include modelling in order
to approximate potential heat gains from varying numbers of units at different aspects to the sununder varying environmental conditions.
Concentrating, non-focusing, non-trackingsolar concentrator
74
ChiYuen
akaKenEnvironmental Technology and Sustainable Energy (BE)
Previous EducationCanning College, Perth, West. Australia
Contactckwkh0rd@hotmail.com
Waste stabilisation ponds (WSP) are used
throughout the world to treat wastewater
before discharge to the environment. WSP is a very
popular treatment option because it is easy to build,
simple to maintain and cost effective. However the presence of algae in
WSP effl uent may result in high suspended solids and unfi ltered BOD (biological
oxygen demand) which would cause problems in the receiving stream such as eutrophication.
In my project I have examined 5 ways/mechanisms to remove algae, which are sand fi ltration (shown in the picture), chemical coagulation,
effect of light and pH on algae settlement, and mechanical mixing.
I have obtained good results with sand fi ltration and chemical coagulation, and these have been used in existing WSP. But with
escalating energy cost it is expected that the future trend will focus on biological removal. I have found out that pH, light and the speed
of mixing all have an effect on algae settlement. These results could mean future research for effective, low cost algae removal methods.
Techniques for Algae Removal fromWaste Stabilisation Pond Effl uent
Electronics & Com
munication Engineering (B
E)Telecom
munications and N
etwork Engineering (B
E)EEEEEEEEEElllllllllleeeeeeeeeecccccccccctttttttttrrrrrrrroooonniiccsss &&
CCoommmmmmmmmmmmmmmmm
uuuuuuuunnnnnnnnnniiiiicccccccccaaaaattiioonnn EEnnggggggggggiiiiiiinnnnnnneeeeeeeeeeeeeeeeeerrrrrrrrrriiiiiiiiiinnnnnnnnnngggggggggg (((((((((BBBBBBBBBEEEEE))))
TTTTTeeeeelllllleeeeccccooooommmmmmmmmm
uuuuuunnnnnnniiiiiiiiiiccccaaaaaaattttttttttiiiiiiiiiooooooonnnnnnnsssssss aaaaaaaaannnnnnnddddddd NNNNNNNNeeeeettttwwwwwww
oooooorrrrrrrrkkkkkkkk EEEEEEEEEEnnnnnnnnnnggggggggggiiiiiiiiiinnnnnnnnnneeeeeeeeeeeeeeeeeerrrrrrriiiiiinnnnnggggggg (((((((BBBBBBBBEEEEEEEEE)))))))))
Electronics & Communication Engineering (BE)
(Formerly Information Engineering / Information & Communication Engineering)
The Electronics & Communication Engineering major emphasises the convergence of electronics, communication and
control technologies for analysis, design and development of electronic products and communication systems. The major is
focused on the integrated study of micro electronics technology, communication infrastructure, computer hardware and software systems, and the principles underlying modern communication
technology. Multimedia signal processing, embedded intelligent systems, computer networking and wireless mobile
communication systems are specially emphasised in the major. Intensive laboratory works, design projects based on systems
approach within the major effectively educate the graduates with knowledge and skills suitable for the highly demanding
electronics and communication industry.
Dr RashidMohammad
Major LeaderAuckland Campus
Telecommunications and Network Engineering (BE)
(Formerly Information & Telecommunication Engineering)
“Good communications are vital for businesses around the world. The emergence of the Internet as a major communication
network enabling the delivery of goods, services and entertainment has completely changed the world of modern
communications. Mobile phones and emerging wireless technologies are part of everyday life both for business and personal activities as they now allow music, video, data and
speech services to be delivered at any time and at any location. This radical shift in communication technologies and dependence on the
Internet is exciting and challenging and it has generated a huge demand for graduates skilled in wireless and Internet technologies.”
Prof RichardHarris
Major LeaderPalmerston North Campus
76
SnehChandwani
akaSnehElectronics & Communication Engineering (BE)
Previous EducationMount Roskill Grammer School
Contactsneh_chandwani@hotmail.com
It is a network of sensors forming clusters distributed
geographically with pre-assigned functionalities to
sense a physical parameter such as temperature, humidity,
pressure, vibration, etc.
These sensors interconnected wirelessly, communicate with
one another periodically in order to manage, distribute and route the gathered information
to the end system.
Wireless Sensor Networks fi nd their application in various
fi elds such as medical monitoring, habitat monitoring, machine monitoring, etc.
The aim of the project is to design a Wireless Sensor Network for an outdoor environment such as an orchard or a fi eld, which in real time, can accurately sense
the environmental temperature periodically and send it to the end system. Cluster topology and design, power management and routing were the major concerns
involved.
As a proof of concept, a prototype network was built using the LM335 temperature sensors connected to Xbee Series2 modules functioning as routers and
coordinators. At the receiving end, a software program was developed to read the information sent to the end system and pass it to the database in a comprehensible
format.
The database keeps a record of the gathered information hence displaying a trend in temperature variations which can be accessed by the end user at all times.
Wireless Sensor Networks
77
MatthewLyon
akaMattElectronics & Communication Engineering (BE)
Previous EducationJohn Paul College / Rosemount HighSchool, USA
Contactmatt.l@clear.net.nz
Software-defi ned radio attempts to bring
computer processing as close to the radio front-end as possible so that
modulation, demodulation and signal processing
become software problems rather than hardware problems.
GNURadio is an open-source software package designed to work with the Universal Software Radio
Peripheral (USRP), a generic hardware platform that digitises incoming signals for further processing by a computer.
Radios are created by connecting together several signal processing blocks to form a signal fl ow graph. Code for the fl ow graphs is written in Python and code
for the blocks is written in C++ for better performance.
My project involves writing the necessary code to implement the USRP as a software-defi ned radio for satellite communications. The most diffi cult part is
writing the signal processing block, and learning and completing the necessary steps to incorporate it into the GNURadio package and allow it to interact with
Python.
It is ultimately intended that the radio will be incorporated into a ground station at Albany or Wellington, or that it will serve as a test-bed for future research and
development.
Software Defi ned Radio for SatelliteGround Station
78
ShanupMody
akaShanupElectronics & Communication Engineering (BE)
Previous EducationSathaye College of Science (Mumbai)
Contactshanup_mody@hotmail.com
At present, phone lines are used for voice conversation,
accessing the internet world, monitoring alarms
(e.g. burglar, fi re, medical), sending text messages etc.
Apart from these existing functionalities wireless
technologies have equipped us engineers to try and
utilise the phone line to its fullest capacity. Wouldn’t it be convenient and cost effective if companies don’t have to send their staff to read the power meter
or water meter and can access the data sitting at a remote location usinga phone line? It sounds so opportune that a farmer can check the moisture
content in the soil by just using a phone line without walking through acres ofland and collecting data from different parts of a farm. These applications arejust to name a few but the list could be overwhelming. This project is all about
integration of Personal Area Network using PSTN. It involves designing of amodule or modifi cation of the existing state of art technology which allows us
to send data collected by a wireless sensor to a remote database over a PSTN (telephone lines). Basically it is a module with a TCP/IP stack on it which will allow us to build a small server. Once this module behaves like a server then
what ever data is stored on this would be accessible using an IP address which is been allocated. Once we can access the data using the ip address we can
also access it using a phoneline (Dialup or any other internet connection).
Integration of Personal Area Networkusing PSTNg
79
PriyankaReddy
akaPriyankaElectronics & Communication Engineering (BE)
Previous EducationLa Chatelaine, India
Contactpriyankareddy@hotmail.com
The main objective of this project is being
able to measure packet characteristics of real time
multimedia applications over wired/wireless networks.
This is done by developing simulation models using
OPNET.
A central enterprise network is developed using
hubs, switches, wired and wireless routers, access points and base stations.
After the development of this LAN, Applications such as Voice, Data & Video were included on each fl oor to view the
performance of the network.
After which various QoS parameters like throughput, delay, load and jitter are measured in both wireless and wired networks. To optimise the resources used in each scenario
changes are made to the physical structures and dimensions. By using performance monitoring changes can be made to networks and applications so that they perform
to their bestin real time situations. Multimedia application servers and other network servers will be used with real time streaming software under Windows XP and Linux.
Finally some recommendations would be discussed as to how the performance can be improved by analysing graphs, data and troubleshooting.
Study of Network Performance Related to QoSand Security Enhancements Using OPNET
80
My Final Year Project (FYP) is the “Design and
Implementation of a Low Noise Amplifi er (LNA)”
as part of the Massey University (Wellington) Ground Station for the
SSETI initiative. The LNA will be the front end of
the receiver circuitry ina system and its purpose
will be to reduce the noiseof all subsequent stages
in the received signal while boosting its power at the same time. The LNA I will be using is
a wide-band type that requires fi ltering of the unwanted frequencies.The fi ltering aspect will be the main focus of my project.
My fi lter is a band-pass type with a center frequency of 2.205 GHz. Adecision was made to use microstrip fi lters instead of regular lumped
fi lters as microstrips are capable of operating in high frequenciesmore effi ciently than the latter type. Microstrip fi lters are a two portnetwork based on transmission lines which can be fabricated using
PCB technology. The entire fi lter exists as a pattern of a metalisationon the substrate. The fi nal step will be to integrate the fi lter and LNAtogether to achieve the goal of amplifying the required frequencies
and attenuating the rest so that retrieval of the signal is possible in thelater stages of the system.
SelvaSelvaraj
akaBassTelecommunication & Network Engineering (BE)
Previous EducationNewlands College
Contactselva500@yahoo.co.uk
Design and Implementation of a LowNoise Amplifi erp
Mechatronics (B
E)MMMMMMMMMMMM
eeeeeeeeeecccccccccccccchhhhhhhhhhhhhhaaaaaaattttttttttttttrrrrrrrrrrrrrroooooooooooonnnnnnnnnnniiiiiiiiiiiiiiccccccccccccccssssssssssssss ((((((((((((((BBBBBBBBBBBBBBEEEEEEEEEEEEEE))))))))))))))
Mechatronics (BE)
“Society is getting more dependent on technology and the technologies are converging
in order that they can be integrated into useful products. This development is rapidly increasing
the need for mechatronics engineers who are knowledgeable in the different areas and who can work effectively to develop the new
solutions that are needed. In fact, most technical solutions from consumer products to industrial
systems are nowadays all heavily dependent on multidisciplinary components. The Mechatronics major
covers the main technical areas that are needed in our rapidly changing world for designing and developing
the engineering solutions needed. The main areas include mechanical engineering, electrical and electronic systems, robotics, machine vision, computer technology, industrial automation and intelligent control. This major
provides graduates with a solid technical foundation in these different areas together with a broad and
practically arranged step by step hands-on approach to designing and building real engineered systems.
Graduates from this major would fi nd themselves having a very wide range of jobs to choose from.”
Prof GurvinderVirkMajor Leader
Wellington Campus
82
RanukaAbeysinghe
akaRanukaMechatronics (BE)
Previous Education Mount Albert Grammar School
Contactranuka.a@gmail.com
The water fuelled system converts water
into the gases which will ultimately power
an automobile engine through the process of
electrolysis of water. The only by-product of the hydrogen and oxygencombustion, expelled
from the exhaust system, is water. Meaning
cleaner emissions from the system.
Using water as a fuel is very “environmentally friendly” compared to your traditional system. A
water pump and tank will store and supply the water for the generator. Precise electronic signals from the
electronic module initiate and sustain the creating of the hydrogen and oxygen within the generator. An In-dash gauge and indicator assembly allows you to
accurately monitor all aspects of the water fuelled system.
The system is not particularly diffi cult and additionally, is fairly cheap.
Drive with Water!
83
SagarAcharya
akaSagarMechatronics (BE)
Previous Education Wilson College
Contactacharyasagar@hotmail.com
The Overall Scope of the Project was to develop a
Control and Monitoring system for the 34-250 Industrial
Process Rig.
The task involves getting a thorough understanding of the
basis behind any industrial process that involves control
and monitoring system, in addition to, how the process can be implemented with the use of PLCs(Programmable Logic
Controllers).
The 34-250 is a bench mounted process rig which contains three independent process(namely) P1, P2 & P3, which involves initially fi lling a header tank with water and then cycling the water level between a set upper and lower limit, whilst simultaneously creating a demand from the header
tank via solenoid valves into the sump tank.
The overall fl ow of water in the system is controlled by the pumps and relay operated solenoid valves which in-turn control the in fl ow and out fl ow from the header tank.
The fl ow is monitored by fl ow switches at various points in the process and the indicator lamps show the operation of solenoid valves and the alarm conditions. A bank of relays controls the
operation of the active elements.
This control and monitoring is achieved using Siemens PLC S7-200. Inputs to the PLC are given by the system and the programmed PLC decides on which action is to be taken to get the desired
output.
Thus, the complete system also provides a platform, to detect faults or identify faulty components that come across during the operation of the process.
Industrial Process Trainer
84
Cell phones areconstantly busy
sending and receivinginformation. It works by exchanging information over a pathway called a
control channel. Through this the cell phone system identifi es a particular cell
phone. The main aim of the project is to design an
SMS system that is easy to use for the elderly.
The SMS system will be attached to a kitchen appliance such as a fridge. The user can text and receive
calls. The main use is when one of the food item runs out. For example when the user’s bread supply runs out they can use the SMS system to text the food
outlet directly. The food outlets, that also have a similar system, then process the request and delivers the food item directly to the elderly. The EZ-10 GPRS system
will be controlled by PIC18F4520 that will also be interfaced with a keypad and LCD. The LCD will have pre programmed numbers and templates that allows the
user to send short messages instantly. We are also planning on having small graphics like a milk bottle that can be attached with the message. The LCD will have a magnet based layer at the bottom so it can be attached to the fridge or any other appliance. The LCD will only have basic function buttons to not
make it very complicated.
AyeshaAfreen
akaAyeshaMechatronics (BE)
Previous EducationLynfi eld College
Contactayesha_afreen@hotmail.com
Home Based SMS System
85
The idea is much like that of the Segway.
We have the problem of balancing a robot
sitting on wheels. The wheels move forward
and backward to maintain the robot’s
equilibrium. The system is controlled by a microcontroller to process the input
signals from the sensors and to output the respective signal to the motors to drive the robot in the correct direction. The sensors used were both
gyroscope and accelerometer, the gyroscope was used to measure the angular incline of the robot and the accelerometer signal was
coupled together with the gyroscope to produce a overall angular error signal. This signal was processed by the digital microcontroller. A PID
(proportional integral derivative) loop is executed to control the robot and the robot outputs a PWM (pulse width modulation) signal which is used
to drive the motors speed and a respective direction bit is set to state whether the robot is leaning backwards or forwards.
PeterAtaallah
akaPeteMechatronics (BE)
Previous EducationPakuranga College
Contactpeterpeter122@hotmail.com
Self balancing robot
86
KyleBoyce
akaBoyceMechatronics (BE)
Previous EducationOrewa College
Contactwhippedkyle@gmail.com
The fi eld marking robotwas controlled by a
basic Oopic-R and had only performed the
painting of a square and straight lines.
The improvements to this design include the implementation of a printed circuit
board that integrates wireless, GPS, and a
microcontroller, as well as all the original components (compass, switch, LCD, control of the Hbridges and paint actuator). Programming must be
done on both a microcontroller (using C-18) and a PC (using C#). This programming will allow the PC to retrieve the current coordinates of the robot through the wireless, and then the user can draw what they would
like to be printed on the fi eld using the graphical user interface. The C# programme must convert the drawn picture/text into GPS coordinates for the robot to paint, and then transmit them over the wireless, the robot will then display these coordinates on an LCD screen along with the compass
bearing. These coordinates and the bearing can then be used in a future project to get the robot to paint at those coordinates.
Communication and Control of FieldMarking Robotg
87
MarkBryant
akaMarkMechatronics (BE)
Previous EducationRangitoto College
Contact:ramibeltagi@gmail.com
The SPIDER Project is a continuation of a
previous project which was unfi nished by a
previous student. The mechanical design is
completed with the electronics required for the control of the robot needing to be
built and designed for my project. This will include motor controllers, battery, microcontroller
programming and a remote control system for a robot so it will be completely wireless. The SPIDER at this stage is only a prototype for
future faster and more usable versions to be based on. So the purpose of the robot at this stage is to be able to traverse rough terrain and supply a platform for future projects to be worked from. This could include a more sophisticated mechanical system utilising faster mechanical movement
processes and a longer life power source. Future applications could include military use, search and rescue, security and other hazardous
tasks.
SPIDER
88
The goal of this project is to investigate and identify suitable technologies for the identifi cation of pigs. By investigating current practices in the industry
and talking to pig farmers the current standard of the industry and needs
of the industry can be ascertained.
A key requirement of the technique identifi ed
for development is the permanency of the identifi cation. When considering the current identifi cations practices, there is no solution that satisfi es the
requirements of permanency, legibility and reliability in one solution. This is the problem that I have set out to solve.
By applying a tattoo to a piglet two problems have been solved, the tattoo is permanent and it will provide reliable identifi cation for the lifetime of the pig. The
goal then is to ensure that the tattoo itself is highly legible and will remain so as the pig grows.
AdamBullen
akaRandom, DodgyMechatronics (BE)
Contactadam.bullen@gmail.com
Identifi cation of pigs/piglets
89
MarkCameron
akaMarkMechatronics (BE)
Previous EducationParaparaumu College
Contactmark.i.cameron@gmail.com
This project is a calibration system for a
Fruit Sorting Machine. The machine uses colour
and infrared cameras, along with a set of
scales to sort the fruit into various categories as defi ned by the user.
A calibration system is needed in this setup
because the lights used are temperature
dependent. The aging of the polarising fi lters and dirt that covers the lights during sorting are also factors
that contribute to the changing light levels. The calibration system shows a patch of uniform colour to the camera at regular intervals so that any changes
in colour can be detected. The gains of the camera can then be changed to compensate for the variations. This will always give an image for the grading of the fruit, which has the same appearance irrespective of temperature, dirt or fi lter age. The patch has a rotating cover to avoid false readings which are
caused by dirt and dust from the various fruits accumulating on the patch. Sources of build-up on the patch include kiwifruit hair, potato dirt and the wax
coating from oranges. The patch and its associated components are linked back to, and controlled by, a computer system. This programme signals to the
cameras when the patch is visible so it can be used to calibrate the system.
Invision Calibration System
90
A spring and damping (shock absorber)
testing system for small scale applications,
where knowledge of a shock absorber’s
performance characteristics is
essential for achieving an optimised damping
system in many applications. An example application - competition grade radio control
cars, where fi nely tuned and balanced damped suspension systems are crucial for a winning set-up. A mechanical testing rig, linked to a
LabView application, will determine the fundamental characteristics of a damper, including spring rates, damping constants and impulse response
characteristics.
Characteristic results will provide users with useful information as to whether the shock absorber meets requirements, how well separate
absorbers characteristics match (where required), or whether the springs or damping oil need to be replaced to meet requirements.
AidanCampbell
akaAidanMechatronics (BE)
Previous EducationWhakatane High School
Contacta.d.d.the.athlete@gmail.com
Small Scale Shock Absorber TestingSystemy
91
For my fourth year projectI wanted to do something
incredible. It had to involvefuel, moving parts, lots of
noise and FIRE. What betterway to design and construct
a jet engine using a big asturbo charger to drive thesystem that will spin to an
excess of 120000 RPM.
Now you are probablywondering why am I allowedto build something so cool??
The project involves a simple user interface to start the jet engine so the system can self sustain. When in the self sustain mode, live run time data can be read off the PLC system.
The live data will be temperatures, pressures and rpm readings off the jet engine.
My jet engine works by burning fuels, whether it is in gas or liquid form such as propane, kerosene, diesel or even vegetable oils! The fuel is initially sparked to ignite and combined with pressurised air. This fuel/air mixture is burned in the combustion
chamber where the resulting expanding gases are then used to do useful work, this is too spin the turbine exhaust wheel to force in more air.
ClintonDarch
akaClintMechatronics (BE)
Previous EducationSt. Pauls
Contactclinton_darch@hotmail.com
Gas turbine PLC Testbed
92
MatthewFinnie
akaFoetusMechatronics (BE)
Previous EducationParaparaumu College
Contact cespenar001@gmail.com
This project involves controlling a 6-DOF
robotic arm through a wireless master-slave
system, whereby the robotic slave mimics the masters motion.
The control rig is lightweight and
unobtrusive, utilising fl exible bend sensors
and tilt sensors to map the angular position of the user’s arm into electrical
signals, which are then transmitted wirelessly to the robotic arm.
The system is also PC-based, allowing potential use through the internet, and incorporates an element of
physical force feedback so the user knows how much force is actually being applied by the robotic arm.
Unobtrusive Wireless Control of an Anthropo-morphic Robotic Arm with Haptic Feedback
93
This project is to take a Fisher and Paykel
Smart Drive, brushless DC motor, and use it to replace mass weights
from an exercise machine. A full three phase brushless DC motor controller has been built using high
current transistors and motor driver chips. A
PIC18f4550 is being used as the processor for this project and will contain the precise
control code needed to produce the desired weight model ofresistance and wind back. A Hall Effect sensor is attached to the
motor to provide position and direction feedback to the processor.The microcontroller is interfaced with a liquid crystal display anda sixteen button keypad, this allows the user to input the desired
mode and weight(s) and receive easy to see feedback.
With this project further progression can be made in areas such asramped weight increase for specifi c sport training or personalised
resistance profi les to aid in injury rehabilitation. Individualisedweight profi les can be designed and implemented giving greater
control over weight training than what is currently available.
GregoryFlynnakaGregMechatronics (BE)
Previous EducationSt John’s College, Hamilton
Contactgregjfl ynn@gmail.com
Motor Generated Weights
94
MorioFukuoka
akaNemoMechatronics (BE)
Previous EducationWhangarei Boys High
Contactdrmario_2001@hotmail.com
For my project I haveset out to design
and manufacture amechanical device to measure the internal
diameter of a tube. Theproject was proposed
by Methanex NZ and is to be used on a 110mm
diameter reformer tube standing 14 meters
vertically. The current design that I am working
on is a cylindrical shaped system suspended from a cable that is to be fed into the tube
from the top opening in a mechanically controlled manner. The device will feed back live information to a laptop user interface, displaying a Diameter vs. Vertical Displacement plot and all the other necessary data. At this time I am aiming to acquire two to three different measurements of diameter at every 25mm step.
The mechanical design is to use symmetrically extending arms to reach out of the device and make contact with the internal wall of the tube. The longitudinal displacement of the shafts is converted from the angular displacement of a disc which is to be accessed
with an absolute rotary encoder.
Mechatronics System for Reformer TubeMeasurement
95
Oliver-JamesGrant
akaOllyMechatronics (BE)
Contactolly.jg@gmail.com
With today’s rapidly developing technologies and
the resultant affordability of both compact and powerful processing units computer
vision has asserted itself as a primary solution for
numerous control and automation applications.
However, while a valuable tool, machine vision offers many challenges when applied to mobile robotics, especially when transitioning between
disparate environments.
The objective of this project was therefore to explore the development of a robust and modular embedded system that could utilise machine vision to perform localisation,
reactance and path planning for the control of autonomous systems, in the presence of both static and dynamic obstacles, across a variety of environments.
In order to achieve real-time reactance, the core function of the vision system was designed as a monocular HSV based colour segmentation application for rapid appearance-based obstacle detection. More complex tasks, such as depth perception for the localisation of
both dynamic targets and the goal pose, were performed through the use of stereo vision.
Deliverables of the project extended to the design and programming of a vision system, construction of an autonomous platform, including PCB design for low level controls, and the
implementation of an algorithm to achieve intelligent path planning for real-time reactance and control.
Intelligent Navigation of AutonomousSystems
96
AndrewHayton
akaAndyMechatronics (BE)
Previous EducationAwatapu College
Contactaahayton@hotmail.com
The intricate and complex bio -mechanics of thehuman hand provides
humans with the ability to grasp objects in various ways and interact with
our natural environment. The simple act of writingyour name or tying your
shoes may seem like atedious task to most, but
to a person who has lost a hand, even the simplest of tasks become impossible.
While there have been many attempts to recreate the human hand, there are few that provide an adequate substitute for a price that the average person can afford. Therefore, the aim of my project was to develop a prosthetic hand that is both practical and affordable. With the help of SEAT Senior Lecturer Dr Liqiong
Tang, a design for a prototype prosthetic hand was developed with consultation from key benefi ciary and right hand amputee Bryden Zaloum. The prototype
was required to be compatible with control systems already available in today’s market, allowing a proven prototype to be quickly developed into a product
ready for the market place. The project utilised several modern technologies such as Computer Aided Design, Computer Aided Manufacturing and Rapid
Prototyping to quickly and accurately develop a prototype.
Mechanical Amputee Hand
97
MikaereHenderson
akaMikaereMechatronics (BE)
Previous EducationForest View High School
Contactmikaerehenderson@gmail.com
Autonomous fl yingvehicles are being
used more and morewidely in a range of
applications. Thisproject aims to develop
a fl ying prototypewhich is to be used as
a platform to mountdifferent sensors. Bydoing this the vehicle
will be able to perform arange of activities depending on the equipment and sensors it is mounted
with. The project will result in a prototype which is capable of fl ight and holding position in mid air. The focus of the project will be on development
of control software and aerodynamics of a small autonomous craft. Through this project more will be known about both areas and further
developments can be made in the future.
Autonomous Flying Vehicle
98
JeffreyHo
Mechatronics (BE)
Previous EducationKings College Auckland
Contactjeffho125@hotmail.com
Each layer of cylinders is inserted in a
corresponding framewhich will be driven by
an associated DC motor. The frame is specifi cally
designed so that it enables the cylinders to
spin around their axes while performing the
rotation around thefi xed ring.
The inner frame is to be rotated counter clock
wise, the middle frame clock wise and the outer frame counter clock wise as well. Various patterns of angular speeds are to be tested to ascertain the appropriate combination that
produces a decrease in temperature in the central area of the structure.
The design is based on the utilisation of the Fibonacci sequence and of the Golden Ratio. The stand has magnetised fi xed rings and moving parts of
cylinders, where the moving parts are driven by DC motors. The magnetic imprint of the magnetised bodies has a longitudinal as well as a transversal pattern. The angular velocities of the frames containing the cylinders enable the apparition of
low temperature in the center of the structure. Low temperatures have already been obtained using the giant magnetocaloric effect. However, this system has
drawbacks that the present application overcomes.
Rotational Magnetic fi elds and CryogenicEnvironments
99
PhillipHogg
akaPhillMechatronics (BE)
Previous EducationWestlake Boys High School
Contactphilfrog@gmail.com
The application of this Pick and Place robot is
to automate the placing of surface mount
electronic components onto prototype circuit boards. The scope of
my project is to design the electronic controls,
featuring a USB interface to the PC, 4 Stepper Motor drivers, 3 solenoid drivers and
all standardised to interpret G-Code via the USB.
The software is written in C# and communicates to the electronic controller (written in C-18). The software allows the user to calibrate
the machine and calculate the trajectories of the robot. A dry-run simulation is included to allow the user to make superfi cial changes
to the operation of each job.
The robot runs two operations. Firstly, the robot places solder paste on the pads and then places the components. The circuit board then
is placed in an oven to cure the solder and result in a completed circuit board.
Delta Pick and Place Robot (ElectronicControls and Software) Environments)
100
EricHsu
Mechatronics (BE)
Previous EducationWhangarei Boys High School
Contacte.hsu@windowslive.com
This project involvesthe development of
the Hulme supercar inconjunction with HulmeSupercars Limited. Theobjective of this projectis to design, or improve
existing designs, ofcomponents on the car.
By having most partsaccurately drawn on
Solidworks, we are ableto analyse problems we
may face and rectify thembefore the part is produced. Another advantage with using Solidworks is that
it gives a very accurate model and produces G-codes for Computer Numerical Controlled Machining.
Every little weight saving counts towards the performance of the Hulme supercar, I have decided to take the existing uprights (hub carriers) and improve
them in strength, and also lighten them. Stress simulation is done on Cosmos Works and they are modifi ed accordingly.
The mold for the vehicle’s tub (cabin) has been machined using the University’s CNC machine, along with some bulkheads that were drawn up using Solidworks;
the team was able to put the prototype fi berglass Can-Am body and the chassis together for the fi rst time.
Hulme Supercar
101
ThomasHulbert
akaTomMechatronics (BE)
Previous EducationOrewa College
Contacttommo6929@hotmail.com
The Hulme Supercarconcept is a mid-engine
designed road car, with ahigh performance power
train and chassis, wrappedin a carbon fi bre body
that gives the feeling ofdriving a Formula One Car.Currently the car is still inthe build process where
I was involved in CADwork involving suspension
components, chassis, body panels and other small parts
using Solid Works.
One part of the project was to draw a solid works representation of mechanical parts that had been built by engineers working on the Supercar. Through out the year I have helped to draw the chassis using laser measuring devices and digitisers to get correct
positions of suspension points and chassis dimensions.
Towards the end of the year I was involved in the design of adjustable suspension that will alter the ride height of the supercar depending on the speed and application it is
being used for at the time. This involved both mechanical design and electronic design.
This project has allowed me to work with a group of three Massey University students, work with Engineers and Fabricators at Prestige Automotive Services all while working
under the large banner of Jock Freemantle of Hulme Supercars Limited.
Hulme Supercar
102
Multipliers are critical components of many
computational systems such as real time signal
processing, fl oating point applications and
computers. Multipliers are also used as a programming
element in systems, neural networks, as well as
mixers and modulators in communication systems.
A 16 bit CMOS multiplier is a binary digital multiplier suitable for multiplying a 16 bit multiplicand with a 16 bit multiplier thus obtaining a 32 bit multiplication result. The digital multiplier comprises of a plurality of AND gates in which each digit of the multiplicand is multiplied by each digit of the multiplier. The outputs of the AND gates represent partial
products which are then arranged corresponding to each bit of the multiplier. The digital multiplier further comprises a plurality of Full Adders for receiving in all partial products,
except the least signifi cant digit of the multiplier, and any carry signal propagated from an adjacent full adder. The design is implemented in CMOS (Complementary Metal Oxide
Semiconductor) technology as CMOS is the state of the art technology for low voltage and low power circuit design.
Complete Chip layout is performed using Tanner L-Edit (a software tool for physical mask layout design).
Overall, this design project provides an in-depth understanding of CMOS multipliers and its architecture right down to the MOSFET transistor level. It also provides hands on
training on Computer aided-VLSI design tools that are available to facilitate the design of full-custom integrated circuits.
PriteshLohani
akaPriMechatronics (BE) Previous EducationMount Albert Grammar School
Contactpriteshlohani@gmail.com
Design of a 16 bit CMOS Multiplier Chip
103
MartinMa
akaMartinMechatronics (BE)
Previous EducationLong Bay College
Contactlast_post@hotmail.com
My project is to utilise themain concepts behind
a parallel robot andcreate a delta robot that
is capable of picking andplacing electronic SMT
parts, furthermore it willbe able to dispense solder
paste required for SMTsoldering.
Delta robot has threeactuated arms. Each arm
is formed in the shapeof a parallelogram and
all connected to a singleend effector. The effect
this has is to keep the endeffector parallel to the
frame it is connected to.
The delta robot will implement three different types of systems for this application. First there will the obvious mechanical component, which dictates
the accuracy of the machine and the way that it moves. Secondly, there is the pneumatic component; this part will serve only as a system of the end effector, for picking up parts and dispensing solder paste. Thirdly, there is an electronic
component, which governs the other two systems; both pneumatics and mechanics are controlled through the electronics and software interface. My
project focus is on the fi rst two systems, pneumatics and mechanics.
Delta Pick and Place Robot (Mechanicaland Pneumatics)
104
BretMartin
akaRatsMechatronics (BE)
Previous EducationQueen Elizabeth College
Contactrat@paradise.net.nz
My mission is to build the ultimate digital HiFi stereo
speakers (a single pair, but more can be added to the
system later).
This project involves Designing and building the speaker
system that will achieve the following requirements.
• Receiving digital audio signals from your computer to independant speakers.
• The signal is then split to the three channels and digitally processed to obtain the required crossover frequencies and phase.
• Each signal is then amplifi ed independantly to drive each speaker driver.
The outcome will be a speakers system that:
• Has built in amplifi ers for each driver.
• Digital signal processing to eliminate ineffi cient passive crossovers.
• Cabinet and enclosure designs that help to eliminate unwanted standing waves and resonance.
• Most importantly the speakers must not only sound good but look aesthetic and pleasing in any environment.
• If time permits digital audio data will be transfered over a wireless link, therefore no visible speaker cables hence preventing any induced noise.
Effi cient & Aesthetic Digital SpeakerSystemy
105
MaryanMoharib
akaMaryanMechatronics (BE)
Previous EducationThe American International School of Muscat
Contactmaryan@moharib.com
This project involves anLCD screen that is placedon a home appliance, for
example a fridge, by magnet.This device acts as a mobile
phone; it can send andreceive texts and calls. Thismakes it more convenient toget in touch with people thatare not fond of carrying their
mobile phones around thehouse. For example, a housewife who spends most of her day in the kitchen is unlikely to check her mobile phone often; when an SMS or call is received, the LCD screen will
fl ash, and is easily accessible.
As of now, GSM services only offer SMS to be sent and received between mobile phones and internet. The idea is to open up this service to landlines as well, making it easier for people at home to keep in touch with friends and family. The service can be
charged to the landline phone bill, making the payment process hassle-free for the user.
The EZ-10 GPRS module will be given commands by the PIC18f4520, and an LCD screen and 3x4 matrix keypad will be interfaced to the PIC. The keypad will be used to type in the
desired SMS and contact number.
The LCD will have pre-programmed text messages and numbers to allow the user to send basic SMS with minimal effort. The preset texts are basic, for example buy milk or
buy bread. There will also be other buttons associated with the LCD screen, for example an up and down arrow to browse between contacts.
Home SMS System
106
The remote controlledSAE go cart will be
controlled with amechatronics system,
that is a combination of mechanical, electronical
and computer aided systems.
The idea is that with theuse of a switch it can bemanually controlled and
then once the switch is fl icked can be remotely controlled.
The go cart has fi ve systems that need to be controlled; they are steering, accelerator, brake, clutch and gear shifts. The steering will mainly be controlled by a set of pneumatic actuators with the aid of some electronic and mechanical
techniques to control it fi nal movements. The gearshifts also will be controlled by pneumatics, with a single actuator and springs in a mechanical driven
case. The accelerator will be controlled with a servo motor helped with some mechanical techniques. The brake will be controlled with a linear servo drive
motor which provides more than enough force to push the pedal. The clutch system will use a combination of a cam, arm and DC motor.
Finally all these systems will be integrated together by a micro chip with some computer software programmed into it to ensure there are fail safety
precautions in place in case of failure.
UmbertoMurrayakaJuan Pablo MonteyezMechatronics (BE)
Previous EducationSt Pauls Collegiate
Contactumberto_murray@hotmail.com
Remote controlled SAE Go Cart
107
DanielNaulder
akaDanielMechatronics (BE)
Previous EducationTaupo-Nui-A-Tia College
Contactwhitetiger62@hotmail.com
For my fourth year project I am creating an
automatic pet feeder. These are used by pet
owners to provide regular feeding for their pets
often at times when the owner is away from the home. The customer is
able to set the times when the pet is fed and also the amount of food the pet is
fed.
I am focusing on a feeder for cats but
the principles I am employing could be branched out and used with different animals. The areas I am concerned with for this project are; precise and reliable
measurement of the dry cat food, accurate and simple control for the customer and fi nally sensors to make sure that the right pet is being fed.
My goal in focusing on these three areas is to provide peace of mind and an overall pleasant experience to the customer. I want them to feel confi dent that their pet is being provided with the correct amount of food at the correct time. I
also want them to feel confi dent that it is their pet that is being fed and not some other animal.
Automatic Pet Feeder
108
AlexanderOgidi
akaAlexMechatronics (BE)
Previous EducationCommand Sec. Sch, Kaduna (CSSKD), Nigeria
Contacttublackrystalz@hotmail.com
My project is aimed at designing and implementing a web enabled vision system
on a working soccer robot. It involves an onboard
camera that takes videos or still pictures of the
robot’s surroundings, then transmitting the results
wirelessly to a dedicated web page over the internet.
To apply the above, I have designed and fabricated
a microcontroller PCB based on SiLabs C8051F020 MCU- which controls the robot and communicates with an
onboard Lantronix® MatchPort B/G. The SiLabs controller is there simply, to decode and packetise signals sent by the MatchPort device; and then decides what actions the robot should take. The MatchPort, on the other hand, hosts the control webpage
and handles all the wireless communications between the robot and the operator. The webpage serves as a platform from which the robot can be controlled.
At the end of the project, I expect to have a proper working robot that can be controlled from any computer or mobile device, e.g. a phone, with internet access. In a nut shell,
the operator is able to see what the robot sees, and can also communicate with it from a remote location. This system could be useful for accessing places considered too
dangerous for humans; as part of a home security system; and also, a practical way to keep an eye on young ones or pets whilst being away from the house.
Remote Vision and Web Controlled Mobile Robot
109
AdamPatten
akaPotterMechatronics (BE)
Previous EducationOrewa College
Contactboy.potter@gmail.com
The Rolling SecurityPlatform is intended as
an all terrain remotesurveillance aide.The fundamental
requirements are that auser wishing to explore
or patrol a given area,can be sat at a computer
and navigate said areausing the platform. Theplatform is designed tobe relatively sturdy and
durable, able to withstand short falls and shocks, provide a means for the user to see what it is seeing and to be able to communicate fi ndings back to base.
The Rolling Security Platform is named so due to its design. To drive itself it makes use of no wheels or tracks, instead the main gearbox and motor assembly
is attached to a solid shaft within a sphere, acting as a pendulum which alters the sphere’s center of gravity. When the motor is driven it causes the pendulum
to swing in the direction driven, altering the sphere’s center of gravity and, as the mass of the pendulum is designed to exceed the momentum of the ball as a
whole, moving the platform forwards.
The platform will be controlled and communicate using the ZigBee 802.15.4 wireless format. This is a medium range, low power standard, optimal for this
project as conservation of battery life is the key.
Rolling Security Platform
110
AndrewPearson-Ward
akaAPMechatronics (BE)
Previous EducationGlendowie College
Contactside_fx@hotmail.com
For my fi nal year project I worked on the Hulme
Super Car. I was part of a larger team. This
team was comprised of Engineers and Designers
from a variety of engineering disciplines.
I was asked to do an accurate SolidWorks
model of the chassis from which the team could
do structural software simulated testing. The modeled chassis was then used to add a variety of
components for design intent and ergonomic considerations.
The project is being used as a means to showcase Kiwi ingenuity, and the eventual goal is to develop a variety of products related to high performance
applications, these would include other transportation design applications. I have had the opportunity to work with a variety of scanning and reverse
engineering applications.
The data produced from the chassis design and analysis is being used to compare the fabricated chassis and body geometries with each other and how
this all relates to the eventual suspension and driveline setup.
Hulme super car
111
My project is to develop a computer based control
for the Shrimp Rover Navigational Robot known as Wireless
Computer Control System (WCCS). The WCCS
allows the user to control the robot’s direction
remotely via a PC.
WCCS is divided into two modules; the fi rst one is the transmitter module
which is attached to the computer system; “the brain” of this module is a PIC18 microcontroller, a Zigbee
transmitter terminal and a Graphic User Interface Software. This software takes input control from the user; they can use their mouse or the computer’s keyboard to assign the direction of travelling. For every user input, the micro-
controller will generate a Pulse Width Modulation signal (which is used to control the direction of the robot) and send it to the receiver module by using
Zigbee Transmitter.
The receiver module is designed to receive the PWM signal from the transmitter module and feed this signal into the motor controller circuit. The module is
based on the PIC18 micro-controller and the Zigbee Receiver.
XiaoyuSu
akaSimonMechatronics (BE)
Previous EducationLynfi eld College, New Zealand
Contactstihardline@msn.com
Wireless Computer Control System forShrimp Rover Navigational Robotp g
112
HekiTauli
akaHexMechatronics (BE)
Previous EducationPalmerston North Boys High
Contacthekitauli28@yahoo.co.nz
My project is to design an integrated multi-sensor surveillance
system, including an aerial visual capture
system, and a network of fi xed cameras.
The main objective of the project work is
to emulate and test algorithms for the
integrated environment using an image processing environment.
Algorithms will be designed and programmed to detect moving objects, and then track the object and communicate with
a central database to store visual features. These features are processed to generate alarms and to provide control
information to the mobile capturing device. The proposed system can be used to public places for mitigation of vandalism
and crime.
Integrated multi-sensor surveillancesystemy
113
For my fourth year project I decided to do something
a little different. The aim of my project is to implement a
fl ying gyro stabilised platform for aerial surveillance. Which
is basically a four bladed helicopter.
The Quadrotor Helicopter is dynamically controlled from through four dc motors. The
complex control algorithm is based upon a PID
implementation for each of the six degrees of freedom, X Y Z Roll Pitch and Yaw. The input to the algorithm comes from an array of sensors including, differential GPS, digital compass, three axis accelerometer, three gyros and, ultrasonic range fi nding. These sensors are passed through a combining
fi lter to provide a measurement for the Quadrotor’s position and orientation.
In order to control the Quadrotor the user loads an application on to their computer, which can dynamically measure the crafts position and data log its precise GPS coordinates. This
is displayed via a mapping programme overlaid onto satellite imagery. The Quadrotor can be remotely controlled indoors via the keyboard or outdoors in autonomous mode
using GPS.
The end goal of the project is to achieve fully independent fl ight. The Quadrotor will leave a very powerful test bed for a multitude of sensors as well as providing a target application
for future development.
JamieWark
akaWarkieMechatronics (BE)
Previous EducationRosehill College
Contactjnwark@gmail.com
Quadrotor Helicopter
114
Traffi c noise has become one of the most common
complaints and health hazards among those
developed countries. People are looking for best way to
reduce traffi c noise as well as establishing new traffi c
standard. The aim of the Hoon Noise Indicator (HNI) was to develop a relatively
low-cost independent device that could be used to
monitor and capture noise source level in the public.
By using a microphone, sounds can be collected and converted into electrical signal that are detected and amplifi ed. A PIC18F4520 microcontroller is then used to
carry out computations and calibrate the signal into different level which refers to as loudness of sound. LEDs are used to present the noise level
to the outside world by giving warning signal. Embedded into the HNI is a cmucam3 opensource camera which will capture and store the
image of the noise source when the default level is triggered. The most advantage of HNI device is a portable and totally isolated unit. It also
can be easily adapted for any other application systems like security or robot that require sound detection. HNI can also be further developed by
integrating wireless communication and image processing like motion analysis, target tracking etc.
HongdaWu
akaJoeMechatronics (BE)
Previous EducationCollege in Singapore
Contactjone886@hotmail.com
Hoon Noise Indicator
115
MinWu
Mechatronics (BE)
Previous EducationMt Albert Grammar School
Contactnbiscuitz@hotmail.com
The aim of the projectis to control a radio
control car remotelyusing a game wheel
and pedal set. Byinterfacing the game
controller set as inputto a microcontroller,
the output of the microcontroller is connected
to a transmitter thatwill be communicating
with a receiver on the car. The car itself will have another
microcontroller to decode the signal received to ultimately controlling some servos which acts as the driving wheel, acceleration of the car. Then a wireless
camera will be pull on to the car for distant driving simulation.
Virtual Driver
Engi
neer
ing
& In
dust
rial
Man
agem
ent
EEEEnnnnggggggiiiiiii
nnnneeeeeeeeeeeeerrrrrr
iiiiiinnnnnggggggg
&&&&&& IInnnnnn
ddddduuuussssstttt
rrrriiiiaaaallll
MMMMaaaannnn
aaaaggggeeeemmmm
eeeennnnttttt Engineering & Industrial Management
The Engineering & Industrial Management major is aimed at educating students to become “opportunity identifi ers” and “problem solvers”. Successful students graduate with good understanding of mathematics, engineering (in a number of disciplines) and management. The management part is weighted towards the thinking processes behind many of the currenttrends, such as “Lean organisations” and “Total Quality Management”.
These skills are much sought after by a wide range of organisations which results in graduates being in such mid-career positions as Logistics Director for a major international aid organisation and senior Metalurgist for a steel plant. Many graduates start their careers off as project engineers or fi rst line supervisors in the traditional New Zealand industries but there is a trend forservice industries to seek their skills as general problem solvers, the graduates having the advantage of a solid technical foundation to their thinking skills.
Mr RalphBallMajor LeaderPalmerston North Campus
117
MohammedAiyaaz
akaRayEngineering and Industrial Management (BE)
Previous EducationMarist Brothers High School - Fiji
Contactmaiyaaz@xtra.co.nz
Fisher & Paykel Healthcaremanufactures respiratory
humidifi ers which are designedto humidify and deliver gasesthat a patient receives during
mechanical ventilation,noninvasive ventilation, oxygen
therapy and laparoscopicsurgery. The respiratory
humidifi cation system is madeup of a heaterbase, a water
chamber, heated tubing andpatient interfaces. The patient
interfaces are a light fl exibleconnection between the heated
delivery tubing and the patient. One of these patient interfaces is designed to attach directly to a tracheostomy tube and others have a nasal cannula connection that lets a patient access the
gases through their nose.
Currently the manufacture of the product is a manual batch assembly process as depicted in the photograph. The resulting production rate is suffi cient for existing sales levels, however, there are concerns that it will not be adequate to meet higher future demands. This project investigates the
possibility of redesigning the process into a lean assembly fl ow-line with fl exibility to meet varying demand scenarios.
By dividing the assembly into work elements and implementing a direct time work study, it is possible to obtain process times for these work elements and a precedent diagram will identify
the scheduling constraints for these tasks. Applying a suitable workstation allocation algorithm, such as the ranked positional weight rule, will enable the design of a balanced assembly line with
equally loaded workstations. The number of stations or manning level will be dependent on the production rate i.e. the higher the rate, the higher the manning level, thus, providing the fl exibility.
Respiratory Humidifi er InterfacesAssembly Process Improvementsy p
118
HamishArcus
Engineering and Industrial Management (BE)
Previous EducationWaiopehu College
Contactharcus@xtra.co.nz
The aim of this project isto provide solutions to a
customer’s problem withthe desired outcome of
customer satisfactionand strengthening thebusiness relationship.
Customer requirementsare to form muesli baringredients into a barform (Muesli Bar), for
prototyping and testingpurposes. Initial work
is to investigate viablesolutions to the problem.A solution will be decided on, and the main work of this project is to design and build a piece of equipment that will form long strips of bar, from a mixed muesli
bar dough.
Some of the main design considerations are: Machine is to fi t into a working envelope, machine is to deliver a product that meets certain criteria, ease of
cleaning, safety for operators, food compatible materials selection, to have the required capacity and to be cost effective to manufacture.
The project will then move into the build stage of fabricating parts and assembling the unit. The unit will then be installed and commissioned at the
customer’s site.
Customer Relations Improvement
119
CharlesDavidson
Engineering and Industrial Management (BE)
Previous EducationWairoa College
Contactcharliednz@hotmail.com
In today’s global market,organisations are looking
to compete in new andinnovative ways, through
methods such as theTheory of Constraints,
Lean Manufacturingor Kaizen (known as
continuous improvementin the West). This project
focuses on Kaizen, asthe implementation of
continuous improvementprogrammes are becomingmore and more common in
New Zealand.
Despite enthusiasm and drive to ensure sucess with Kaizen; in many organisations these initiatives have halted or failed. This project looks at creating a method of guiding
the continuous improvement programme back onto the right path and ensuring its sustainability.
The method includes judging an organisation’s capability for Kaizen and examining what factors of continuous improvement already exist. The missing factors are then planned
and implemented into the organisation, and a direction is given for the organisation to move towards. The method is then applied to a pharmaceutical manufacturing company
where the managers, team leaders and operatives engage in continuous improvement activities.
The results for the company are improved yields, quality and delivery response.
A Method of Sustaining ContinuousImprovement in a ManufacturingOrganisation
120
BrettGrobler
akaSaffaEngineering and Industrial Management (BE)
Previous EducationTawa College, Wellington
Contactbsgrobler@gmail.com
This project has focused on the redesign of the
manufacturing layout of Stevenson’s Structural Engineering (SSE). SSE
has developed a proven reputation as leaders in the supply, fabrication, surface treatment and
erection of structural steel. The Head Offi ce and main
manufacturing facility is located at Tokomaru, 19km South of Palmerston North. This is where the basis of steel fabrication and surface treatment is completed. It is at
this facility that the project was undertaken.
The company are keen to optimise their current layout of machinery, processes, inventory and fi nished goods stock, in order to optimise factory fl oor usage and
facilitate improved material fl ow.
To conduct the project, extensive research in to the area of facility layout and layout techniques were covered in order to acquire the necessary knowledge
to complete the task. The basis of the project followed a developed model called Systematic Layout Planning (SLP) which considers the product versus quantity
analysis, material fl ow, relationship matrices, space considerations, and facility fi xed constraints. These parameters need to be analysed and considered in order to
propose a new layout to facilitate improved material fl ow.
Facility Layout Design
121
LinPan
akaLinEngineering and Industrial Management (BE)
Previous EducationNanyang Girls High School
Contactl.paneim@gmail.com
The aim of thisproject is to designa more reliable and
effi cient traffi c controlsystem for complex
intersections.
Traffi c lights canhave more than
two sequences forthe various traffi c
conditions during theday. The basic principle
of traffi c light timing isthat longer green lights
for morning traffi c in one direction, and longer green lights for afternoon traffi c in the opposite direction. Furthermore, in some rural areas, the
lights may go into a red-yellow blinking pattern after midnight, and resume its normal pattern before the morning rush hour.
A Programmable Logic Controller (PLC) is actually a control device that consists of a programmable microprocessor and memory integrated
circuits. Since a single programmable logic controller can replace all of the relays and timers within a processing system, it is widely used in
control engineering.
PLC Traffi c Control
Indu
stri
al A
utom
atio
nInn
dusstt
rriaall
AAut
ooommmmaatt
iioonn Industrial Automation
Almost everything we buy and use has been produced using automation. The parts inside many of our technological gadgets have become too small to assemble by hand and even something as simple as home baking uses an oven with self-regulating temperature. Small wonder then that the Industrial Automation engineers that Massey produces are taught to understand all sorts of systems; mechanical, electrical/electronic and chemical in nature.
The fun really starts though when they learn to automate these systems using robots, vision systems, computers, valves, motors, advanced controllers and, of course, their own brains.
They can fi nd jobs almost anywhere and are in very high demand; the major is only available at Massey and only at the Palmerston North campus. Catering to all of New Zealand and places overseas isn’t easy.
Dr HuubBakkerMajor LeaderPalmerston North Campus
123
MichaelCaulton
akaMikeAutomation and Control (BE)
Previous EducationKearsney College (South Africa)
Contactmichaelcaulton@gmail.com
The home workshop is becoming equipped with
more advanced machinery due to recent advances in
electronics and automation. These advances allow the
average hobbyist to own a larger variety of more
versatile tools that were previously unavailable in
their price range.
A homemade or kitset CNC machine is no longer uncommon in hobby workshops as the prices of the components required to automate
and control these machines have gotten cheaper and people have become more computer savvy. These machines allow hobbyist to make complicated parts to very tight
tolerances that were previously near impossible for them to make.
The aim of my project was to design and build a small 3-axis CNC machine that was cheap yet still effective. The CNC machine was to interface to a standard personal
computer for the machines control and would have a hand held pendent that connected through USB to allow the user remote control of the machine.
3 Axis CNC Router
124
StevenCharles
akaSteveAutomation and Control (BE)
Previous EducationJohn Paul College
Contactsteve@charles.net.nz
Solar water heating is gainingpopularity in New Zealand
as technology improves andattitudes change in favour of
energy saving. Many systemsuse a simple solar controller,
however all water heatingsystems can reduce energy
consumption by using smartercontrol. This project set out to
develop the solar controllerto improve system effi ciency,
as well as improve the userinterface to better address the wants of a broadening customer base.
The project began by designing the controller hardware and fi tting it to a domestic solar water heating system. The controller collected data and stored it to an online database,
which was used to design improvements to the control strategy. As the project progressed, the controller was reprogrammed to include the new features. Each strategy was assessed
for energy consumption and consumer response.
The project provided a good opportunity to exercise skills in the areas of process, electronic and control engineering, which are the focus of the Industrial Automation major. The project
was kindly sponsored by the Foundation for Research, Science and Technology and Senztek, a New Zealand based company. It is anticipated that the work done during this project will
help the company develop the next generation of solar controller for local and offshore markets.
Solar Water Heating Manager
125
ChristopherHarris
akaChris, HarryAutomation and Control (BE)
Previous EducationWanganui High School
Contactchrisharris6@gmail.com
The aim of thisproject was to design
and manufacturea prototype high
speed 5.56mm beltlinker for Ordnance
Developments Limited.
The belt linker is used to create 5.56mm
ammunition belts foruse with automatic
rifl es, mainly theMinimi light machinegun which is used in
approximately 32 countries, including New Zealand.
The new design of the high speed linker should provide two to three times the throughput of the current belt linker in use.
High Speed 5.56mm Belt Linker
126
DeniseWai
akaWharfedaleAutomation and Control (BE)
Previous EducationFreyberg High School
Contactshake_the_funky_chicken@yahoo.com
Roebel cable enableslow-AC loss conductionwhile High TemperatureSuperconducting (HTS)material allows for zero
DC resistance below 77K.Combine theses two concepts
and an HTS Roebel cablethat can carry high current
effi ciently in both AC andDC applications is born. Dueto its ability to conduct with
a higher current densitythan that of conventionalcopper, equipment suchas commercial magnets
and induction heaters canbe made smaller, lighter and with less electricity loss. However, winding HTS material is
challenging; if bent too much the zero resistance conductivity is lost. Hence, few have been successful in producing a commercially viable process to produce HTS Roebel cable.
With the support of a General Cable Superconductors Limited Scholarship and Industrial Research Limited, my project was to design, build, and program a spiral confi gured winding
head and prove that a single head can wind HTS Roebel cable rather than the current multiple head design. The fi nal design features a rotating gear holder mounted on double-vee
bearings, with wire-cut slotted rods to guide HTS strands of wire and a control system that features a Trio motion MC 206x coordinator (PLC), an MDrive23plus stepper motor, and an
Eltra encoder.
Spiral Roebel Cable Winding Head
127
DiWang
Automation and Control (BE)
Contactwangdi527@hotmail.com
This project is todesign an automatic
system to pick andplace containers in a
laboratory environment.The substance in the
container is consumeddaily. The auto system
is required to have aweighing capability,
which is able to weigh thecontainer when picking
it up. The substanceconsumption data has to
be recorded.
The project aims to design a prototype of an auto deliver system to deliver small containers with
weight around 500g with substance inside. It consists of weighing system design, data logging
and robot arm design. For my part, it is mainly to design the weighing system.
Weighing system for auto delivery system
128
JoelWhite
akaJoelyAutomation and Control (BE)
Previous EducationKaramu & Lytton High
Contactjoely__boy@hotmail.com
Horse jumping is oneof the most exciting ofall equine sports, and
one of the few to enjoythe prestige of being an
Olympic event. For manyriders, the tedious routine
of setting up jumps andconstantly adjusting
their height seems likean unavoidable task.
With the application ofAutomation, a horse jumpcan be controlled with the
push of a button, or evena remote control. This
enables the rider to adjust the jump to suit their needs while still on their horse.
The objective of my project is to design and build a wireless remote motor controller, which will be applied to a horse jump. The user will be able to raise
and lower the jump via remote control.
The project is broken up into three main parts. The fi rst is a 2 channel RF Transceiver, which will be used to signal the motor controller forward, reverse
and stop. The second is a microprocessor using PWM control for RPM stability. The third is a ball screw mechanism incorporated into a horse jump.
Automated Horse Jump
129
Derek Wills
akaDerekAutomation and Control (BE)
Previous EducationNelson College
ContactDerek.Wills.1@uni.massey.ac.nz
This platform uses wireless transceivers communicating at the
418 MHz free frequency. An 8051 microprocessor is located at the remote site and can monitor up
to seventeen sensors as well as controlling
actuators. The 8051 converts the sensor input
into a digital value using on board ADCs. The data is then sent in serial form
via the wireless link to a receiver and then to the USB port of the control PC. The platform is monitored by a Labview programme which provides a GUI (Graphic User Interface) and
polls the microprocessors to determine the states of the sensors. Multiple microprocessors can be monitored by one controller PC, with each attached
sensor assigned an identity tag. The wireless link uses Carrier Present Carrier Absent (CPCA) modulation, sometimes referred to as OOK (On Off Keying) to
send and recover data.
An advantage of this method of transmission is a greater range due to a lower average power output, with a maximum range of 1km. The advantages of this
platform are low cost, ease of installation, scalability, and a greater range than most other wireless sensor networks available.
Wireless sensor/actuator platform
130
RuiZhang
akaRayAutomation and Control (BE)
Previous EducationFreyberg High School
Contactrae8422@hotmail.com
Chewing robot is agreat research topic
introduced by theFood and Nutrition
department and Schoolof Engineering and
AdvancedTechnology,which studies
properties of food.The goal of this topic
is to develop chewingrobots in different ways
in order to analysevarious food properties.
This project is to develop one degree freedom chewing robot actuated by artifi cial muscle. Mechanical structure is design to hold a pair of jaw
model. Upper jaw is fi xed. Lower jaw is able to move up and down at various frequencies, driven by artifi cial muscle that is controlled by PLC.
Chewing robot
131
132
133
134
top related