lesson 1: what is genetic research? powerpoint slides to accompany using bioinformatics : genetic...
Post on 15-Dec-2015
215 Views
Preview:
TRANSCRIPT
LESSON 1: What is Genetic Research?
PowerPoint slides to accompany
Using Bioinformatics: Genetic Research
Genetic Research Deals with Inherited Traits
DNA isolation.
Use bioinformatics to research differences in DNA
sequences.
Genetic researchers study inherited traits by analyzing DNA sequences.
How are we similar? How are we different?
Scientific PracticesAsk a Question Based on Observations: Plants grow in soil. What do plants use to grow larger?
Hypothesis & Prediction: If – and – then Hypothesis: Plants use materials in the soil to gain mass. Prediction: If my hypothesis is correct, and I measure the mass
of soil & plants over time, then I predict the soil mass will decrease as plant mass increases.
Gather and Analyze Data (Methods): Measure mass of bean seeds and soil at Day 1 and Day 15.
Results: Bean plants increased in mass by 24.6 grams. Soil mass stayed
the same.
Conclusions: Minerals from the soil do not affect the mass of plants.
Hypothesis is contradicted.
New Hypothesis: Plants use something in the air to gain mass.
Image Source: Wikipedia Commons
The Practices of Scientific Research
Hypothesis and Prediction
Data Collection and Analysis
Interpretation and Evaluation
The Scientist
Observations of Nature
What is Bioinformatics?
Bioinformatics is the application of computer science and information technology to biology and medicine.
Bioinformatics makes it possible to analyze large quantities of complex biological data and can be used to search biological databases, compare sequences, and draw molecular structures.
Bioinformatics Tools Help Scientists:Organize, Process, and Make Sense of Complex Biological Data Sets
Protein
Bioinformatics Tools:
DNA SequencingIdentify Mutations in
DNA.
DNA RNA
Bioinformatics Tools:
RNA SequencingIdentify tissue specific
gene expression.
Bioinformatics Tools:
Protein 3D Structure visualization.
Question: What kinds of scientific questions can we answer with bioinformatics tools?
Image Source: Wikipedia Commons
The Practices of Scientific Research
Hypothesis and Prediction
Data Collection and Analysis
Interpretation and Evaluation
The Scientist
Observations of Nature
DNA sequences from tumors
contain genetic mutations.
Genetic differences
contribute to the development of
cancer.Comparisons of genomes from
different cancers identify variants in genes X and Y.
Studies by other scientists
demonstrate that genes X and Y are involved in DNA
repair, which could explain the
increased cancer risk.
Do families with higher rates of cancer also have higher rates of DNA
damage?
DNA Sequencing Core Lab ManagerELLEN SISK, MS
Place of Employment:
Seattle Biomedical Research Institute
Type of Work:Manages the DNA Sequencing “Core.” The Core lab is a centralized facility that provides DNA sequencing for all the researchers at the Institute.
The Seattle BioMed Sequencing Core facility has been in operation for over 18 years and offers DNA sequencing and analysis to Seattle's scientific community, as well as international scientists and organizations. Our service provides cost-effective solutions for small laboratories that lack access to sequencing technology.
Which Animals are Most Closely Related to One Another?
Gray wolf
Jack RussellToy Poodle
Labradoodle
Coyote
English Shepherd
Cocker Spaniel
Red fox
Image Source: Wikipedia Commons
Reference …TTCACCAACATGCCCACA… F T N M P T Patient …TTCACCAACAGGCCCACA…
F T N R P T
…TTCACCAACAGGCCCACA…
Extract DNA from Cells.
Sequence DNA.
Compare Patient DNA Sequence to
Reference Sequence.
Search Database to Determine if Patient
Mutation is Associated with Disease.
Patient Sample: Blood or Saliva.
Inside the Gene Machine:How Information from DNA is Acquired and Used for Genetic Testing
Genetic Counselors work with patients to help them decide whether or not to have a genetic test, and help them understand the results of the test.
Lab Technicians work with patient samples in the lab, purifying and sequencing the DNA.
Bioinformatics programmers create computer programs to help biologists analyze data.
Biomedical Researchers perform experiments with patient samples to find different variations of genes that might cause disease. Bioinformatics tools like BLAST and ClustalW are used to compare sequences.
Medical Doctors and Veterinarians use the knowledge gained from genetic testing to care for their patients.
Image Source: Microsoft Clip Art
How DNA Sequence Data is Obtained for Genetic Research
Genetic Data
…TTCACCAACAGGCCCACA…
Extract DNA from Cells.
Sequence DNA.
CompareDNA
Sequences to One Another.
Obtain Samples: Blood , Saliva, Hair
Follicles, Feathers, Scales.
TTCAACAACAGGCCCACTTCACCAACAGGCCCACTTCATCAACAGGCCCAC
Image Source: Wikipedia Commons
Which Animals are Most Closely Related to One Another?
Gray wolf
Jack RussellToy Poodle
Labradoodle
Coyote
English Shepherd
Cocker Spaniel
Red fox
Image Source: Wikipedia Commons
Multiple Sequence Alignment of Canine DNA Sequences
Color Coding Reveals Differences
DNA Sequencing Core Lab ManagerELLEN SISK, MS
Place of Employment:
Seattle Biomedical Research Institute
Type of Work:Manages the DNA Sequencing “Core.” The Core lab is a centralized facility that provides DNA sequencing for all the researchers at the Institute.
The Seattle BioMed Sequencing Core facility has been in operation for over 18 years and offers DNA sequencing and analysis to Seattle's scientific community, as well as international scientists and organizations. Our service provides cost-effective solutions for small laboratories that lack access to sequencing technology.
CAREERS IN SPOTLIGHT:
DNA Sequencing Core Lab Manager
What do they do?
The manager oversees the core lab facility. These types of facilities make
it possible to perform DNA sequencing reactions and analysis for many
different researchers at a given institution, company, or university. The Core
lab facility makes it possible for many researchers to share the same DNA
sequencing facility and expertise of technicians and the Core Lab Manager.
What kind of training is involved?
Bachelor’s degree in biology, molecular biology, biochemistry,
or related discipline. Some have a Master’s degree or a PhD.
What is a typical salary for a Core Manager?
Salaries vary with experience and range from $50-$100,000 per year
($25-$50/hour).
Source: Genome Technology Salary Survey 2010
top related