identification of suitable housekeeping genes for expression analysis in mammary epithelial cells of...
Post on 09-Sep-2016
212 Views
Preview:
TRANSCRIPT
Contents lists available at SciVerse ScienceDirect
Livestock Science
Livestock Science 147 (2012) 72–76
1871-14
http://d
n Corr
fax: þ9
E-m
ddsbms
mmuke
katariar
anitaya
ashokm
bpmish1 Pr
Univers
journal homepage: www.elsevier.com/locate/livsci
Identification of suitable housekeeping genes for expression analysisin mammary epithelial cells of buffalo (Bubalus bubalis) duringlactation cycle
Poonam Yadav a, Desh Deepak Singh c,1, Manishi Mukesh a, R.S. Kataria a, Anita Yadav b,A.K. Mohanty c, B.P. Mishra a,n
a National Bureau of Animal Genetic Resources, Karnal 132001, Haryana, Indiab Department of Biotechnology, Kurukshetra University, Kurukshetra 136119, Indiac National Dairy Research Institute, Karnal 132001, India
a r t i c l e i n f o
Article history:
Received 29 June 2011
Received in revised form
27 March 2012
Accepted 7 April 2012
Keywords:
Housekeeping genes
Mammary Epithelial cell
Buffalo
Lactation
13/$ - see front matter & 2012 Published by
x.doi.org/10.1016/j.livsci.2012.04.004
esponding author. Tel.: þ91 184 2267918 (W
1 184 2267654 (W).
ail addresses: niryadav@gmail.com (P. Yadav)
@gmail.com (D. Deepak Singh),
sh_26@hotmail.com (M. Mukesh),
anji@yahoo.co.in (R.S. Kataria),
davkuk@yahoo.com (A. Yadav),
ohanty1@gmail.com (A.K. Mohanty),
ra_1@hotmail.com (B.P. Mishra).
esent address: Department of Pathology, Ki
ity, Lucknow 226003, U.P., India.
a b s t r a c t
The aim of the research reported herein was to evaluate the stability of 7 frequently used
housekeeping genes including ACTB (b-actin), glyceraldehyde 3-phosphate dehydrogenase
(GAPDH), ubiquitously expressed transcript protein (UXT), ribosomal protein S9 (RPS9),
ribosomal protein S15 (RPS15), ribosomal protein S23 (RPS23) and hypoxanthine-guanine
phosphoribosyl transferase (HPRT) in mammary epithelial cells (MECs) isolated from
buffalo milk at different phases of lactation (15 d, 30 d, 45 d, 60 d, 120 d and 240 d relative
to parturition) of three buffaloes. The expression of the genes varied considerably in
different MECs samples analyzed. GAPDH showed the highest expression, whereas the
expression of UXT was the lowest in MECs of buffalo during all stages of lactation.
Microsoft excel based visual application i.e. geNORM and Normfinder were used to rank
candidate reference genes based on expression stability. RPS9 and RPS23 were found to be
the most stable genes during lactation in buffalo. Geometric mean of these genes can be
used for normalization of real time PCR data in mammary epithelial cells during lactation.
& 2012 Published by Elsevier B.V.
1. Introduction
Gene expression analysis is becoming more prevalentin livestock species since it promotes our understanding ofcomplex biological processes such as lactation physiology(Cassar-Malek et al., 2008; Piper et al., 2008; Wang et al.,
Elsevier B.V.
);
,
ng George Medical
2009). Quantitative real time PCR is commonly used to studygene expression due to high sensitivity, specificity, reprodu-cibility and broad dynamic range. But, real time PCR requiresan internal control for normalization. The most widely usedapproach is to use housekeeping genes (HKGs) as internalcontrol. The pre-requisite of a suitable HKG is adequateexpression and minimal expression variation in cells/tissuesof interest (Hruz, 2011; Tricarico et al., 2002). However,recent studies had showed that the transcription levels ofcommonly used HKGs such as b-actin and GAPDH were notalways stable (Deindl et al., 2002; Hamalainen et al., 2001).Thus, there is necessity to identify set of reference genes, assingle gene cannot be effectively used as reference gene forcomplex biological systems/processes (Deindl et al., 2002;Glare et al., 2002; Hamalainen et al., 2001; Robinson et al.,2007). Several excel based softwares such as geNORM(Noriega et al., 2010; Vandesompele et al., 2002) and
Least stable genes Most stable genes
0.09
0.1
0.11
0.12
0.13
0.14
0.15
0.16
0.17
0.18
0.19
UXT RPS15 HPRT GAPDH B-ACTIN RPS9RPS23
Aver
age
expr
essi
on s
tabi
lity
M
Fig. 1. Expression stability and ranking of housekeeping genes as
calculated by geNORM in MECs isolated from buffalo milk during
different phases of lactation cycle (15 d, 30 d, 45 d, 60 d, 90 d, 120 d,
240 d relative to parturition). A lower value of average expression
stability, M, indicates more stable expression. RPS23 and RPS9 were
shown most stable genes.
P. Yadav et al. / Livestock Science 147 (2012) 72–76 73
Normfinder (Andersen et al., 2004) have been developed torank candidate reference genes by evaluating expressionstability in array of experimental samples. In geNorm, theexpression stability is measured as stability value (M)based on pair wise variation of each control gene with allother control genes under consideration. Most stable geneshave the lowest M scores (Vandesompele et al., 2002).Riverine buffalo (Bubalus bubalis) is an important farmstockspecies accounting for the highest milk production in manyAsian (especially India) and Mediterranean countries. It isimportant to understand the mechanism of milk synthesisand modulate milk yield and composition in buffalo. It hasbeen observed that number of MECs in the milk aredeterminant of lactation curve and reflects physiologicalactivity in mammary gland (Boutinaud, 2004; Sorensen,2006). So, MECs based expression studies can lead to moreaccurate evaluation of expression patterns of genes relatedto milk synthesis as compared to mammary gland, also dueto chances of contamination with other type of cells inmammary tissue. In this study, we aim to identify reliablereference genes out of 7 HKGs, suitable for gene expressionstudies in milk purified MECs during different stages oflactation.
2. Materials and methods
Three healthy multiparous Murrah buffalo were selectedbased on lactation history including milk yield and parityfrom cattle yard of National Dairy Research Institute, Karnal.The milk samples were collected twice a day (morning andevening) at 15, 30, 45, 60, 90, 120 and 240 d of lactationrelative to parturition. Fresh milk (1.0 kg) was defatted for20 min by centrifugation at 800g at 4 1C in 250 ml centri-fuge bottles. The skim milk was removed and the remainingtotal cell pellet was resuspended and pooled in 40 ml of PBS.The cell suspension was washed twice in PBS, after a finalcentrifugation at 600g for 10 min at 4 1C; the cell pellet wasresuspended in 1 ml of PBS containing 1% BSA. Dynabeads(Dynal Biotech, Invitrogen, Cergy Pontoise, France) werefirst coated with a primary mouse monoclonal antibodydirected against cytokeratin 8 antibody, which was specificto bovine epithelial cells. Then, cell suspension was incu-bated with 250 ul antibody-bead complex for 1 h on arotary mixer at 4 1C for purification of epithelial cells. Theunbound cells were removed by placing the tube in mag-netic particle concentrator for 1 min and supernatant con-taining unbound cells was aspirated. Finally, purified MECswere re-suspended in 1 ml 1%PBS–BSA and pelleted bycentrifugation. Trizol (1 ml) was added to purified MECscell pellets, vortexed well and stored at �80 1C until pro-cessed for RNA isolation. Total RNA was isolated by Trizol(Invitrogen, Paisely, UK) according to manufacturer’sinstructions. The extracted RNA was treated with DNaseI(Fermentas UAB, Lithuania) to remove genomic DNA con-tamination. RNA was quantified by UV spectrophotometer(NanoDrop, ND-1000, USA). A260/A280 ratio was 1.7–2.0 forall the samples. Quality of RNA samples was further checkedby Experion Bioanalyzer (BioRad laboratories, Hercules, CA).cDNA was prepared by using first strand cDNA synthesiskit (Stratagene, Santa Clara) according to manufacturer’sinstructions. Real time PCR reaction was performed in
96-well LightCyclers 480 Real-Time PCR System (RocheDiagnostics, Germany) using SYBR green 1 (Roche Diag-nostics, Germany) according to manufacturer’s instruc-tions. Standard curve was prepared for each gene usingserial dilution of cDNA from MECs. Dissociation curveanalysis was then performed for each assay. A single sharppeak in the melt curve analysis and single band in gelelectrophoresis indicated specific amplification for eachgene (Fig. S1). Standard curve of all genes had efficiency inthe range of 96–107% and slope in the range from �3.1 to�3.6. No-template controls were also run for each primer.Three biological replicates and three technical replicateswere used for each sample for real time PCR. The meanvalues from triplicates were obtained for further calcula-tions. Gene expression values were then calculated foreach reference gene using DCT method. The relativeexpression values of the HKGs were analyzed for stabilityusing the visual basic application for Microsoftexcel—NormFinder and geNORM.
3. Results and discussion
Our results indicated differential expression of thehousekeeping genes in MECs of buffalo during differentstages of lactation. GAPDH showed the highest expressionlevel and expression of UXT was the lowest in MECs ofbuffalo across different stages of lactation (Fig. S2).
The geNORM software analyzed the expression stabi-lity value (M) of genes and ranked the candidate referencegenes accordingly. All the 7 genes showed expressionstability values within the acceptable range (o1.5) ran-ging from 0.90 (RPS23) to 0.179 (UXT) (Fig. 1). The RPS9and RPS23, with the lowest M values, were most stablegenes across all the stages of lactation evaluated in thepresent study (Fig. 1).
Vandesompele et al. (2002) demonstrated that use of asingle non-validated reference gene as normalizer resultedin a false interpretation of fold change in gene expressionranging from 3-fold to 6-fold in different tissue samples.Thus, a set of validated housekeeping genes are requi-red for accurate normalization of gene expression data(Vandesompele et al., 2002). Despite stability, there can
0
0.05
0.1
0.15
0.2
0.25
0.3
0.35
RPS23 RPS9 UXT RPS15 GAPDH B-ACTIN HPRT
S D
Fig. 3. Expression stability and ranking of housekeeping genes as
calculated by NormFinder in MECs isolated from buffalo milk during
different phases of lactation cycle (15 d, 30 d, 45 d, 60 d, 90 d, 120 d,
240 d relative to parturition). A lower value of stability value indicates
more stable expression. RPS23 was shown most stable genes, which is
shown in gray color.
0
0.01
0.02
0.03
0.04
0.05
0.06
0.07
1 2 3 4 5 6 7
Accu
mul
ated
SD
No. of genes
Fig. 4. Accumulated standard deviation to determine the optimal
number of control genes for optimal normalization. The least accumu-
lated SD was obtained with three most stable gene which indicated that
3 genes are required for accurate normalization. Least accumulated SD is
indicated by gray color.
P. Yadav et al. / Livestock Science 147 (2012) 72–7674
be problems related to expression variation, as in somecases, the expression level of HKG is either too low or toohigh leading to discrepancy in transcript abundance ofseveral orders of magnitude relative to target gene beingquantified. Also, lactation specific genes show dramaticincrease in expression during lactation; hence genes withstable expression i.e. HKGs seem to be down regulateddue to dilution effect in MECs (Neville et al., 2002). HKGsselected through the conventional statistical analysis donot account for the dilution effect. Therefore, HKGs selec-tion by pair wise comparison method can lead to moreaccurate results, as, geometric mean of 2 or 3 most stableHKGs is appropriate for normalization of real time PCRdata (Bionaz and Loor, 2007). Therefore, further analysisby geNORM was carried out to identify optimal number ofHKGs to be used for normalization. This measure knownas pair wise variation (V) calculates normalization factorratios between control genes. The pair wise variationanalysis indicated that two genes (i.e. RPS9 and RPS23)are appropriate for real time PCR data normalization inMECs from buffalo milk (Fig. 2).
Further, Normfinder was used to validate the resultsobtained by geNORM (Andersen et al., 2004). Normfindercalculates standard deviation (SD) and accumulative stan-dard deviation (acc. SD) for all the candidate reference genes.Values obtained for standard deviations for each gene areshown in Fig. 3, which showed that RPS23 with the leaststandard deviation was most stable gene in the MECs frombuffalo milk. Accumulative standard deviation is a goodindicator of the optimal number of reference genes. Accu-mulative standard deviations indicated that 3 referencegenes (i.e. RPS23, RPS9 and UXT) should be used for optimalnormalization of real time PCR data in MECs from buffalomilk (Fig. 4).
Study of HKGs expression stability for finding suitablereference gene(s) for normalization of gene expressioninvolved in lactation and mammary gland development isimportant. It could aid in studying the expression of genesassociated with important traits such as milk yield andcomposition across lactation. No such reports are avail-able in buffalo. However, some studies have been carriedout on identification of housekeeping genes in bovine thathave been a vital support for designing present work (Bionaz
0
0.005
0.01
0.015
0.02
0.025
0.03
V2/3 V3/4 V4/5 V5/6 V6/7
Paiw
ise
Varia
tion
(V)
*
Fig. 2. Pairwise variation (V) to determine the optimal number of
control genes for accurate normalization. Asterisk indicates the optimal
number of genes for normalization.
and Loor, 2007; Janvovick-Guretzky et al., 2007). Further, Ithas been reported that HKGs can have variable expressionunder different systems; hence the stability of HKGs expres-sion should be validated for each experimental system(Bas et al., 2004; Huggett et al., 2005). Studies have shownthat ACTB and GAPDH genes which were earlier consideredas universal HKGs are not suitable for normalization ofexpression data under all conditions (Aswal et al., 2008;Hruz, 2011). Similarly, ACTB and GAPDH also showedunstable expression in present study. Ribosomal proteinshave shown constant expression across lactation and can beused as reference genes in gene expression studies duringlactation in different species (Janvovick-Guretzky et al., 2007;Bionaz and Loor, 2007). Present study also reports that RPS9and RPS23 have most stable expression in buffalo MECsacross lactation.
In conclusion, we have validated 7 housekeeping geneand identified RPS23 and RPS9 as the most stable refer-ence genes in MECs from buffalo milk across lactation.These genes can be used as a reliable normailizer in geneexpression studies associated with some important dairytraits such as milk production and composition in buffalo(Table 1).
Table 1Selected candidate reference genes, mRNA accession numbers, functions and primers.
Gene name mRNA accessionnumbers
Primer sequences Gene functions
Beta actin ACTB NM_173979.3 F: GCGTGGCTACAGCTTCACC Cytoskeletal structural protein
R: TTGATGTCACGGACGATTTC
Glyceraldehyde-
3-phosphate dehydrogenase
GAPDH NM_001034034.1 F: TGGAAAGGCCATCACCATCT Oxidoreductase in glycolysis and
gluconeogenesis
R: CCCACTTGATGTTGGCAG
Hypoxanthine
phosphoribosyl-transferase
HPRT NM_001034035.1 F: GAGAAGTCCGAGTTGAGTTTGGAA Purine synthesis in salvage
pathway
R: GGCTCGTAGTGCAAATGAAGAGT
Ubiquitously expressed
transcript protein
UXT NM_001037471.1 F: TGTGGCCCTTGGATATGGTT Potential component of
mitochondrial-associated LRPPRC, a
multidomain organizer that
potentially integrates mitochondria
and the microtubular cytoskeleton
with chromosome remodeling
R: GGTTGTCGCTGAGCTCTGTG
Ribosomal protein S15 RPS15 NM_001024541.1 F: CAGCTTATGAGCAAGGTCGT Structural constituent of ribosome
R:GCTCATCAGCAGATAGCGCTT
Ribosomal protein 23 RPS23 NM_001034690.1 F: CCCAATGATGGTTGCTTGAA Structural constituent of ribosome
R: CGGACTCCAGGAATGTCACC
Ribosomal protein S9 RPS9 NM_001101152.1 F: CCTCGACCAAGAGCTGAAG Structural constituent of ribosome
R: CCTCCAGACCTCACGTTTGTTC
P. Yadav et al. / Livestock Science 147 (2012) 72–76 75
Conflict of interest statement
The present study reports for the first time in mammaryepithelial cells (MECs) in B. bubalis. It involves evaluation ofhousekeeping genes (HKGs) stability which is an essentialcomponent in gene expression studies. Since, suitableHKGs appear to be specific for each tissue, physiologicalstages and species, it becomes important to identify stablereference genes in buffalo MECs during different stages oflactation. Also, while progress in the development of cattle,pig, sheep and chicken genome database continues world-wide, similar efforts for buffalo are negligible. This reportwill help in studying the gene expression studies in MECsof buffalo regarding milk yield and composition. Thiswould help in better understanding of lactation physiologyof this important dairy animal. There was no conflict ofinterest regarding this manuscript submission.
Acknowledgments
We would like to acknowledge financial support receivedunder National Agricultural Innovation Project (NAIP) forthis study.
Appendix A. Supplementary materials
Supplementary data associated with this article can befound in the online version at http://dx.doi.org/10.1016/j.livsci.2012.04.004.
References
Andersen, C.L., Jensen, J.L., Orntoft, T.F., 2004. Normalization of real-timequantitative reverse transcription-PCR data: a model-based varianceestimation approach to identify genes suited for normalization,
applied to bladder and colon cancer data sets. Cancer Res. 64,5245–5250.
Aswal, A.P.S., Raghav, S., De, S., Thakur, M., Goswami, S.L., Datta, T.K.,2008. Expression stability of two housekeeping genes (18S rRNA andGAPDH) during in vitro maturation of follicular oocytes in buffalo(Bubalus bubalis). Anim. Reprod. Sci. 103, 164–171.
Bas, A., Forsberg, G., Hammarstrom, S., Hammarstrom, M.L., 2004. Utilityof the housekeeping genes 18S rRNA, beta-actin and glyceraldehyde-3-phosphate-dehydrogenase for normalization in real-time quanti-tative reverse transcriptase-polymerase chain reaction analysis ofgene expression in human T lymphocytes. Scand. J. Immunol. 59,566–573.
Bionaz, M., Loor, J.J., 2007. Identification of reference genes for quanti-tative real-time PCR in the bovine mammary gland during thelactation cycle. Physiol. Genom. 29, 312–319.
Cassar-Malek, I., Picard, B., Bernard, C., Hocquette, H., 2008. Applicationof gene expression studies in livestock production system: a Europeanperspective. Aus. J. Exp. Agric. 48, 701–710.
Deindl, E., Boengler, K., van Royen, N., Schaper, W., 2002. Differentialexpression of GAPDH and beta3-actin Bovine reference genes 371 ingrowing collateral arteries. Mol. Cell. Biochem. 236, 139–146.
Glare, G.M., Divjak, M., Bailey, M.J., Walters, E.H., 2002. beta-Actin andGAPDH housekeeping gene expression in asthmatic airways isvariable and not suitable for normalising mRNA levels. Thorax 57,765–770.
Hamalainen, H.K., Tubman, J.C., Vikman, S., Kyrola, T., Ylikoski, E.,Warrington, J.A., Lahesmaa, R., 2001. Identification and validationof endogenous reference genes for expression profiling of T helpercell differentiation by quantitative real-time RT-PCR. Anal. Biochem.299, 63–70.
Hruz, T., 2011. RefGenes: identification of reliable and condition specificreference genes for RT-qPCR data normalization. BMC Genom. 12,156–162.
Huggett, J., Dheda, K., Bustin, S., Zumla, A., 2005. Real-time RT-PCR normal-isation: strategies and considerations. Gene Immun. 6, 279–284.
Janvovick-Guretzky, N.A., Dann, H.M., Carlson, D.B., Murphy, M.R., Loor,J.J., Drackley, J.K., 2007. Housekeeping gene expression in bovineliver is affected by physiological state, feed intake, and dietarytreatment. J. Dairy Sci. 90, 2246–2252.
Neville, M.C., McFadden, T.B., Forsyth, I., 2002. Hormonal regulation ofmammary differentiation and milk secretion. J. Mammary GlandBiol. Neoplasia 7, 49–66.
Noriega, N.C., Kohama, S.G., Urbanski, H.F., 2010. Microarray analysis ofrelative gene expression stability for selection of internal referencegenes in the rhesus macaque brain. BMC Mol. Biol. 11, 47–53.
Piper, E.K., Jackson, L.A., Bagnall, N.H., Kongsuwan, K.K., Lew, A.E., Jonsson,N.N., 2008. Gene expression in the skin of Bos Taurus and Bos indicus
P. Yadav et al. / Livestock Science 147 (2012) 72–7676
cattle infested with the cattle tick, Rhipicephalus (Boophilus) micro-plus. Vet. Immunol. Immunopathol. 126, 110–119.
Robinson, T.L., Sutherland, I.A., Sutherland, J., 2007. Validation ofcandidate bovine reference genes for use with real-time PCR. Vet.Immunol. Immunopathol. 115, 160–165.
Sorensen, T.M., 2006. Cell turnover and activity in mammary tissue duringlactation and the dry period in dairy cows. J. Dairy Sci. 89, 4632–4639.
Tricarico, C., Pinzani, P., Bianchi, S., Paglleranl, M., Distante, V., Pazzagll,M., Bustin, S.A., Orlando, C., 2002. Quantitative real-time reversetranscription polymerase chain reaction: normalization to rRNA or
single housekeeping genes is inappropriate for human tissue biop-sies. Anal. Biochem. 309, 293–300.
Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., DePaepe, A., Speleman, F., 2002. Accurate normalization of real-timequantitative RT-PCR data by geometric averaging of multiple inter-nal control genes. Genome Biol. 3, 34–38.
Wang, Y.H., Bower, N.I., Reverter, A., Tan, S.H., Jager, N.D., Wang, W.,McWilliam, S.M., Cafe, L.M., Greenwood, P.L., Lehnert, S.A., 2009.Gene expression patterns during intramuscular fat development incattle. J. Anim. Sci. 87, 119–130.
top related