identification of molecular targets regulating fatty acid
Post on 10-Nov-2021
2 Views
Preview:
TRANSCRIPT
Identification of molecular targets regulating fatty acid synthesis in bovine mammary epithelial cells
Joseph William McFadden
Dissertation submitted to the faculty of the Virginia Polytechnic Institute and State University in partial fulfillment of the
requirements for the degree of
Doctor of Philosophy In
Animal Sciences, Dairy
Committee: Dr. Benjamin A. Corl, Chair
Dr. Mark D. Hanigan Dr. Joseph H. Herbein
Dr. Michael L. McGilliard
April 27, 2009
Blacksburg, Virginia
Keywords: bovine mammary epithelial cell, fat synthesis
Identification of molecular targets regulating
fatty acid synthesis in bovine mammary epithelial cells
Joseph W. McFadden
ABSTRACT
Consumer demand for milk fat has declined due to the increased risk of cardiovascular
disease associated with consuming a high saturated fat diet. Milk fat synthesis is
energetically expensive for the dairy cow, especially during early lactation or periods of
poor nutrition. Thus, manipulating milk fat production and composition may promote the
synthesis of more market-valuable milk components and improve energy utilization in
dairy cows during periods of increased energy demand. Therefore, the objective of the
present studies was to identify molecular proteins that regulate fatty acid synthesis in
bovine mammary epithelial cells. The regulation of lipogenic genes including acetyl-
CoA carboxylase (ACC) and fatty acid synthase (FAS) is controlled by transcription
factors including sterol regulatory element binding protein-1 (SREBP1) and liver X
receptor (LXR). In vivo, diet-induced milk fat depression or supplementing diets with
polyunsaturated fatty acids inhibits milk fat synthesis by regulating SREBP1 expression.
Results confirm that polyunsaturated fatty acids inhibit fatty acid synthesis in bovine
mammary epithelial cells by regulating the expression of SREBP1. In hepatocytes, LXR
can regulate the transcription of SREBP1 in addition to ACC and FAS. Results confirm
that LXR activation enhanced synthesis of fatty acids in bovine mammary epithelial cells
by promoting the transcription of FAS and SREBP1. Activation of LXR was unable to
prevent the inhibitory effect of polyunsaturated fatty acids on fatty acid synthesis. In the
lactating mammary gland, LXR may contribute to the synthesis of fatty acids by
iii
regulating the expression of SREBP1. In addition to modifying the expression of
lipogenic genes, some enzymes can be phosphorylated by AMP-activated protein
kinase (AMPK), an energy-sensing protein, inhibiting their activity. Presence of AMPK
mRNA was identified in bovine mammary epithelial cells and activation of AMPK
dramatically decreased fatty acid synthesis in bovine mammary epithelial cells. In the
lactating mammary gland, AMPK may sense energy availability and regulate milk fat
synthesis to control energy utilization. Identification of SREBP1, LXR, and AMPK as
regulators of fatty acid synthesis in bovine mammary epithelial cells may lead to the
development of technologies allowing dairy producers to modify milk fat production and
composition to meet consumer demand and maximize profitability.
iv
DEDICATION
I dedicate this dissertation to my mother, father, and grandfather.
v
ACKNOWLEDGEMENTS
I thank Dr. Benjamin Corl, my primary advisor and mentor. You have fostered a
learning environment that ensures graduate student success. I also thank you for giving
me the opportunity to get involved in my community. My time at Virginia Tech has been
a rewarding experience and I am deeply grateful for both your patience and guidance.
To my committee, Dr. R. Michael Akers, Dr. Michael McGilliard, Dr. Mark Hanigan, and
Dr. Joseph Herbein thank you for writing my preliminary exam and critiquing my
dissertation. These tasks can be tedious and I thank you for your time and commitment
to advising. Special thanks to Andrea Lengi for assisting me with laboratory procedures
and listening to my stories. To Dean Karen DePauw, thank you for giving me the
opportunity to extend my reach outside of the laboratory and into the community. I
thank you for making my experience at Virginia Tech unique, rewarding, and
unforgettable. From traveling to Switzerland to learn about higher education to
providing graduate students the opportunity to reform university policy, I thank you. To
the hundreds of Virginia Tech graduate students I’ve been able to work with both
through the Graduate Student Assembly and within a university commission or
committee, I thank you. I hope our initiatives and ambition will further enhance the life
and academic experience of future Virginia Tech graduate students. To my close
friends, too many to list, thank you for giving me the chance to share my frustrations in
the laboratory whether in the Graduate Life Center or over a beer at the Rivermill. To
my girlfriend, Caterina Saracino; thank you for your support. I must admit, having a
serious relationship with a doctoral student can’t be easy. From my preliminary exams
to my final defense, you were there every step of the way and I know you will be there
vi
the day after tomorrow. Lastly, I thank my family. To my grandfather, William
Liszkiewicz, thank you for never saying no and the unlimited supply of gasoline. Also,
thank you for keeping everyone in Philadelphia informed about my progress. To my
mother and father, Rosemarie and Joseph McFadden, since sixth grade you have
watched my ambition to study the dairy cow blossom into reality and I hope one day I
will be able to share that same experience with my own children. After ten years, five
colleges, four states, and three theses, I have always had two loving parents and one
dream. I thank you for making my one dream come true.
vii
TABLE OF CONTENTS
ABSTRACT ................................................................................................................ ii
DEDICATION ............................................................................................................. iv
ACKNOWLEDGEMENTS ........................ .................................................................. v
LIST OF TABLES...................................................................................... ................. ix
LIST OF FIGURES......................................... ............................................................ x
LIST OF ABBREVIATIONS .................................................................................... xiii
CHAPTER 1: General Introduction................................................................. ................ 1
CHAPTER 2: Review of Literature....................................................................... ........... 4
MILK FAT SYNTHESIS ............................................................................................ 4
De novo fatty acid synthesis ................................................................................ 4
Uptake of preformed fatty acids ........................................................................... 5
Triacylglycerol synthesis ...................................................................................... 7
Coordinate regulation of lipogenic enzyme expression ....................................... 7
LIPOGENIC TRANSCRIPTION FACTORS .............................................................. 8
Sterol regulatory element binding proteins .......................................................... 8
Liver X receptors ............................................................................................... 11
Peroxisome proliferator-activated receptors ...................................................... 12
Transcription factors in the mammary gland ...................................................... 15
REGULATION OF MILK FAT SYNTHESIS BY FATTY ACIDS .............................. 17
Suppression of lipogenic enzymes by trans-10, cis-12 conjugated linoleic
acid .................................................................................................................... 18
In vitro studies ................................................................................................... 19
AMP-ACTIVATED PROTEIN KINASE .................................................................... 21
Structure of AMP-activated protein kinase ........................................................ 22
Regulation by upstream kinases ........................................................................ 23
Regulation of acetyl-CoA carboxylase ............................................................... 26
Regulation of glycerol-3-phosphate acyltransferase .......................................... 27
Regulation of lipogenic transcriptions factors .................................................... 28
HYPOTHESIS STATEMENT .................................................................................. 29
CHAPTER 3: Polyunsaturated Fatty Acids Inhibit de novo Fatty Acid Synthesis in
Bovine Mammary Epithelial Cells ................................................................................. 30
INTRODUCTION .................................................................................................... 30
MATERIALS AND METHODS ................................................................................ 31
Cell culture and treatments ................................................................................ 31
Fatty acid synthesis assay ................................................................................. 32
Real time PCR ................................................................................................... 33
DNA quantification ............................................................................................. 35
viii
Cellular fractionation .......................................................................................... 35
Immunoblotting .................................................................................................. 36
Statistical analysis ............................................................................................. 37
RESULTS ............................................................................................................... 38
DISCUSSION.......................................................................................................... 43
CHAPTER 4: Activation of Liver X Receptor Enhances de novo Fatty Acid
Synthesis in Bovine Mammary Epithelial Cells ............................................................. 50
INTRODUCTION .................................................................................................... 50
MATERIALS AND METHODS ................................................................................ 52
Cell culture and treatments ................................................................................ 52
Fatty acid synthesis assay ................................................................................. 53
Real time PCR ................................................................................................... 54
DNA quantification ............................................................................................. 54
Cellular fractionation .......................................................................................... 56
Immunoblotting .................................................................................................. 57
Statistical analysis ............................................................................................. 58
RESULTS ............................................................................................................... 58
DISCUSSION.......................................................................................................... 65
CHAPTER 5: Activation of AMP-Activated Protein Kinase Inhibits de novo Fatty
Acid Synthesis in Bovine Mammary Epithelial Cells ..................................................... 71
INTRODUCTION .................................................................................................... 71
MATERIALS AND METHODS ................................................................................ 73
Cell culture and treatments ................................................................................ 73
Fatty acid synthesis assay ................................................................................. 74
Real time PCR ................................................................................................... 75
DNA quantification ............................................................................................. 77
Immunoblotting .................................................................................................. 77
Acetyl-CoA carboxylase activity assay .............................................................. 78
Statistical analysis ............................................................................................. 79
RESULTS ............................................................................................................... 80
DISCUSSION.......................................................................................................... 88
CHAPTER 6: Conclusions ............................................................................................ 96
REFERENCES ....................................................................................................... 99
ix
LIST OF TABLES
Table 3.1. Primer sequences used to detect ACCα, FAS, PPARγ, LXRα,
SREBP1, and β-actin mRNA ........................................................................................ 34
Table 4.1. Primer sequences used to detect FAS, LXRα, SREBP1,
INSIG1, INSIG2, ABCG1, Cyp1A1, and β-actin mRNA ................................................ 55
Table 5.1. Primer sequences used to detect ACCα, FAS, LPL, FABP3,
GPAT, AGPAT, PPARγ, LXRα, SREBP1, α AMPK, β AMPK, γ AMPK
and β-actin ................................................................................................................... 76
x
LIST OF FIGURES
Figure 2.1. Proteolytic cleavage of sterol regulatory element binding
Protein (SREBP) .......................................................................................................... 10
Figure 2.2. Liver X receptors (LXR) regulate fatty acid synthesis by
increasing the transcription of lipogenic enzymes via indirect and direct
mechanisms ................................................................................................................. 13
Figure 2.3. Phosphorylation (activation) of AMP-activated protein kinase
(AMPK) by serine/threonine kinase-11 (LKB1) and Ca2+/calmodulin-
dependent kinase kinase (CaMKK) results in the phosphorylation
(inactivation) of acetyl-CoA carboxylase-α (ACCα) ...................................................... 25
Figure 3.1. Effect of treating bovine mammary epithelial cells (MAC-T)
with 50 µM linoleic acid (LA), cis-9, trans-11 conjugated LA (9,11 CLA),
trans-10, cis-12 CLA (10,12 CLA), or in the absence of fatty acid (No FA;
control) for 24 h on de novo fatty acid synthesis .......................................................... 39
Figure 3.2. Effect of treating bovine mammary epithelial cells (BME-UV)
with 50 µM linoleic acid (LA), cis-9, trans-11 conjugated LA (9,11 CLA), or
trans-10, cis-12 CLA (10,12 CLA), or in the absence of fatty acid (No FA;
control) for 24 h on de novo fatty acid synthesis .......................................................... 40
Figure 3.3. Effect of treating bovine mammary epithelial cells (BME-UV)
with 50 µM linoleic acid (LA), cis-9, trans-11 conjugated LA (9,11 CLA),
trans-10, cis-12 CLA (10,12 CLA), or in the absence of fatty acid (No FA;
control) for 24 h on lipogenic gene expression ............................................................. 41
Figure 3.4. Effect of treating bovine mammary epithelial cells (BME-UV)
with 50 µM linoleic acid (LA), cis-9, trans-11 conjugated LA (9,11 CLA),
trans-10, cis-12 CLA, or in the absence of fatty acid (No FA; control) for
24 h on acetyl-CoA carboxylase-α (ACCα) protein abundance .................................... 42
Figure 3.5. Effect of treating bovine mammary epithelial cells (BME-UV)
with 50 µM linoleic acid (LA), cis-9, trans-11 conjugated LA (9,11 CLA),
trans-10, cis-12 CLA (10,12 CLA), or in the absence of fatty acid (No FA;
control) for 24 h on lipogenic transcription factor gene expression............................... 44
xi
Figure 3.6. Effect of treating bovine mammary epithelial cells (BME-UV)
with 50 µM linoleic acid (LA), cis-9, trans-11 conjugated LA (9,11 CLA),
trans-10, cis-12 CLA, or in the absence of fatty acid (No FA; control) for
24 h on premature sterol regulatory element binding protein-1 (pSREBP1)
and mature sterol regulatory element binding protein-1 (mSREBP1)
protein abundance........................................................................................................ 45
Figure 4.1. Effect of treating bovine mammary epithelial cells (BME-UV)
with or without T09 (2 μM) for 8 (acute) or 24 h (chronic) on liver X
receptor-α (LXRα) target gene expression ................................................................... 59
Figure 4.2. Effect of treating bovine mammary epithelial cells (BME-UV)
with or without T09 (2 μM) for 8 h on de novo fatty acid synthesis ............................... 61
Figure 4.3. Effect of treating bovine mammary epithelial cells (BME-UV)
with T09 (2 µM), GGPP (10 µM), or both for 24 h on de novo fatty acid
synthesis ...................................................................................................................... 62
Figure 4.4. Effect of treating bovine mammary epithelial cells (BME-UV)
with or without T09 (2 μM) for 8 (acute) or 24 h (chronic) on gene
expression. (A) Acute and (B) chronic effects of T09 on lipogenic gene
expression .................................................................................................................... 63
Figure 4.5. Effect of treating bovine mammary epithelial cells (BME-UV)
with or without T09 (2 μM) for 8 h on premature sterol regulatory element
binding protein-1 (pSREBP1) and mature sterol regulatory element
binding protein-1 (mSREBP1) protein abundance. (A) Effects of
treatment on pSREBP1 protein abundance ................................................................. 64
Figure 4.6. Effect of treating bovine mammary epithelial cells (BME-UV)
with T09 (2 µM) and fatty acids (50 µM) on de novo fatty acid synthesis ..................... 66
Figure 5.1. Bovine tissue and bovine mammary epithelial cell (MAC-T)
presence of α AMP-activated protein kinase (AMPK), β AMPK, and γ
AMPK mRNA ............................................................................................................... 81
Figure 5.2. Effect of treating bovine mammary epithelial cells (MAC-T)
with either 0 (control), 200, 400, or 600 µM AICAR for 4 (acute) or 24 h
(chronic) on de novo fatty acid synthesis ..................................................................... 83
xii
Figure 5.3. Effect of treating bovine mammary epithelial cells (MAC-T)
with or without AICAR (600 μM) for 1 h on ratio of phosphorylated-ACCα
(P-ACCα) to total ACCα protein abundance ................................................................. 84
Figure 5.4. Effect of treating bovine mammary epithelial cells (MAC-T)
with or without AICAR (600 μM) for 1 h on acetyl-CoA carboxylase (ACC)
activity .......................................................................................................................... 85
Figure 5.5. Effect of treating bovine mammary epithelial cells (MAC-T)
with or without AICAR (600 μM) for 24 h on lipogenic gene expression ....................... 86
Figure 5.6. Effect of treating bovine mammary epithelial cells (MAC-T)
with or without AICAR (600 μM) for 24 h on various lipogenic transcription
factor gene expression ................................................................................................. 87
Figure 5.7. Effect of incubating bovine mammary epithelial cells (MAC-T)
with Dulbecco’s Modified Eagle’s Medium (DMEM) with or without glucose
for 4 h on ratio of phosphorylated-ACCα (P-ACCα) to total ACCα protein
abundance ................................................................................................................... 89
Figure 5.8. Effect of treating bovine mammary epithelial cells (MAC-T)
with either control (DMSO) or ionomycin (1 μM) for 1 h on ratio of
phosphorylated-ACCα (P-ACCα) to total ACCα protein abundance ............................ 90
xiii
LIST OF ABBREVIATIONS
ABCG1 ATP-binding cassette transporter-G1
ACC acetyl-CoA carboxylase
AGPAT acylglycerol phosphate acyltransferase
AICAR 5-aminoimidazole-4-carboxamide ribonucleoside
AMPK AMP-activated protein kinase
BME-UV bovine mammary epithelial cell line
BSA bovine serum albumin
CaMKK Ca2+/calmodulin-dependent kinase kinase
CD36 cluster of differentiation-36
CLA conjugated linoleic acid
Cyp1A1 cytochrome P4501A1
DMEM Dulbecco’s Modified Eagle’s Medium
DMSO dimethyl sulfoxide
FA fatty acid
FABP fatty acid binding protein
FAS fatty acid synthase
g gravity
GGPP geranylgeranyl pyrophosphate
GPAT glycerol-3-phosphate acyltransferase
INSIG insulin-induced gene
LA linoleic acid
LKB1 serine/threonine kinase-11
LPL lipoprotein lipase
LXR liver X receptor
LXRE liver X receptor response element
MAC-T bovine mammary epithelial cell line
mSREBP mature sterol regulatory element binding protein
No FA absence of fatty acids (bovine serum albumin control)
PPAR peroxisome proliferator-activated receptor
pSREBP premature sterol regulatory element binding protein
RXR retinoic X receptor
SCAP sterol regulatory element binding protein cleavage-activating
protein
SRE sterol response element
SREBP sterol regulatory element binding protein
TAG triacylglycerol
T09 T091317
ZMP 5-aminoimidazole-4-carboxamide ribonucleoside
monophosphate
1
CHAPTER 1
General Introduction
Over the past several decades, the Dietary Guidelines for Americans published
by the US Department of Health and Human Services and the Department of Agriculture
has advocated the consumption of a diet low in total fat, saturated fat, and cholesterol.
An increase in the human consumption of milk and butter is associated with an
increased risk for the development of cardiovascular disease (Noakes et al., 1996).
This increased risk is linked to the ability of saturated fat to elevate the plasma
concentration of low density lipoprotein cholesterol which is a primary risk factor for
coronary heart disease (LaRosa et al., 1990). Dairy foods provide a significant portion
of saturated fat to the human diet which has resulted in a decline in consumer demand
for milk fat. Therefore, the development of technologies which modify milk fat
production and composition are needed to provide consumers with healthy dairy
products.
The utilization of nutritional strategies to manipulate milk fat production and
composition appears promising. For decades, producers have observed a decrease in
milk fat production in response to feeding high concentrate/low forage diets or dietary
supplements of oils high in polyunsaturated fatty acids (Storry and Rook, 1965; Steele
et al., 1971). This observation is referred to as milk fat depression (Davis and Brown,
1970; Erdman, 1996; Bauman and Griinari, 2003). Alterations in rumen
biohydrogenation of polyunsaturated fatty acids during milk fat depression results in the
production of unique fatty acid intermediates which elicit inhibitory effects on milk fat
synthesis (Katz and Keeney, 1966; Gaynor et al., 1994). Recently, research has
2
revealed that specific isomers of conjugated linoleic acid (CLA) are responsible for this
inhibitory effect on milk fat production. The most widely studied isomer of CLA to inhibit
milk fat synthesis is trans-10, cis-12 CLA (Baumgard et al., 2000). Development of an
in vitro approach to study the regulation of fatty acid synthesis in response to trans-10, -
cis-12 CLA is needed to help elucidate the mechanism responsible for this inhibitory
effect.
Liver X receptor (LXR) is a nuclear receptor capable of regulating the
transcription of sterol regulatory element binding protein-1 (SREBP1) and SREBP1
target genes including acetyl-CoA carboxylase and fatty acid synthase (Schultz et al.,
2000; Joseph et al., 2002; Talukdar and Hillgartner, 2006). Sterol regulatory element
binding protein-1 is considered to be the primary transcriptional regulator of milk fat
synthesis in the bovine mammary gland (Harvatine and Bauman, 2006). Recent
evidence demonstrates that the mRNA expression and protein abundance of SREBP1
is decreased in response to trans-10, cis-12 CLA (Peterson et al., 2004; Harvatine and
Bauman, 2006). Whether LXR initiates these effects in the bovine mammary epithelial
cell has not yet been documented. Better understanding the role of LXR in controlling
lipogenesis may provide researchers with an additional target to prevent diet- or trans-
10, cis-12 CLA-induced decreases in milk fat synthesis.
In addition to modifying milk fat production and composition to meet consumer
demand, additional management strategies are needed to maximize animal
performance while maintaining animal health. During early lactation, dairy cows often
experience enhanced energy demand in response to copious milk secretion, decreased
dry matter intake, poor body condition, or sickness. Early lactation cows will mobilize
3
body lipid reserves as a compensatory mechanism to meet energy demand for milk
production, reproductive recovery, and maintenance (Bauman and Davis, 1975).
Identification of molecular targets that regulate energy utilization in the mammary gland
is necessary to increase milk production or modify milk composition during early
lactation or periods of poor nutrition. AMP-activated protein kinase (AMPK) is
considered to be the primary gauge of cellular energy supply (see review by Hardie
(2007)) and may prove to be a novel target for manipulation in the bovine mammary
epithelial cell. Development of strategies that control the activation of AMPK may help
alleviate energy deficits during early lactation or poor nutrition ensuring maximum
productivity and economic return.
The objective of the following research is to identify various molecular targets
that are capable of regulating fatty acid synthesis in bovine mammary epithelial cells.
These targets include SREBP1, LXR, and AMPK. Better understanding of these
molecular targets and their ability to regulate fatty acid synthesis may lead to the
development and utilization of management tools that manipulate milk fat yield and
composition based on consumer demand.
4
CHAPTER 2
Review of Literature
MILK FAT SYNTHESIS
Milk fat is the most variable component of milk and is affected by genetics,
physiological state, environment, and nutrition (see review by Palmquist (2006)). This
variability can be attributed to the control of mechanisms responsible for the
incorporation of over 400 unique fatty acids found in ruminant milk fat (Jensen, 2002).
These fatty acids are esterified to form triacylglycerol (TAG), the primary constituent of
milk fat. Phospholipids, cholesterol esters, diglycerides, monoglycerides, and free fatty
acids are minor contributors to milk fat. The fatty acids found in TAG vary in chain
length, degree of unsaturation, and origin. Short-chain fatty acids of 4 to 14 carbons
and approximately one-half of palmitate (16 carbons) are synthesized de novo from
acetate and β-hydroxybutyrate. Preformed long-chain fatty acids greater than 16
carbons and the remainder of palmitate are derived from circulation and make up the
remaining fatty acids of TAG. On a molar basis, one-half of milk fatty acids are derived
from de novo synthesis while the remaining half is derived from circulation (Palmquist et
al., 1969; Bauman and Davis, 1974).
De novo fatty acid synthesis
Acetyl-CoA carboxylase (ACC) mediates the first committed step in the synthesis
of fatty acids. This lipogenic enzyme is regulated by covalent modification, allosteric
mechanisms, and by transcriptional control (Allred and Reilly, 1996; Kim, 1997). Short-
term regulation of ACC is achieved by phosphorylation or dephosphorylation.
5
Phosphorylation of ACC inactivates the enzyme and decreases its activity (Carlson and
Kim, 1973). A number of phosphatases are responsible for dephosphorylating ACC
thereby promoting its activity (Thampy and Wakil, 1986). Change in the
phosphorylation status of ACC occurs within minutes in response to stimuli and are not
the result of changes in gene transcription (Merrill et al., 1997). Long-term changes in
ACC expression and protein abundance are often observed in response to hormones,
nutrients, or other signals (Girard et al., 1994; Baumgard et al., 2002). Multiple
transcription factors have been identified as key regulators of the expression of ACC.
These include sterol regulatory element binding protein-1 (SREBP1), liver X receptor-α
(LXRα), and peroxisome proliferator-activated receptor-γ (PPARγ), further described
below.
Fatty acid synthase (FAS) is responsible for synthesizing saturated fatty acids
ranging from 4 to 16 carbons in length from acetyl-CoA, malonyl-CoA, and nicotinamide
adenine dinucleotide phosphate. Similarly to ACC, FAS is regulated by various
lipogenic transcription factors that promote the transcription of FAS in response to
appropriate hormonal or nutrient signals (Magana and Osborne, 1996; Joseph et al.,
2002). Sterol regulatory element binding protein-1, LXRα, and PPARγ are examples of
such transcription factors detailed below.
Uptake of preformed fatty acids
Long-chain fatty acids found in milk fat are derived from nonesterified fatty acids,
TAG-rich chylomicra, and very low density lipoproteins found in circulation. In lactating
dairy cows, circulating concentrations of nonesterified fatty acids are highly correlated
6
with rate of lipolysis (Bauman et al., 1988). Thus the incorporation of long-chain fatty
acids is greatest during early lactation in response to the onset of negative energy
balance and the associated release of nonesterified fatty acids from adipose (Palmquist
et al., 1993). The hydrolysis of TAG to free fatty acids and glycerol is mediated by
mammary lipoprotein lipase (LPL). Activity of mammary LPL is increased immediately
prior to parturition and remains elevated throughout lactation (Shirley et al., 1973;
Liesman et al., 1988). The expression of LPL has been shown to be tightly controlled
by hormonal and nutritional signals (Liesman et al., 1988; Baumgard et al., 2002).
Mechanisms responsible for the transport of fatty acids from capillaries to the
interior of the mammary epithelial cell are still being defined. Barber and coworkers
(1997) have proposed the involvement of cluster of differentiation-36 (CD36), a fatty
acid translocator, in conjunction with intracellular fatty acid binding protein (FABP) to
transport fatty acids across the cell membrane. Multiple FABPs have been implicated in
transmembrane and intracellular transport of fatty acids (Hertzel and Bernlohr, 2000).
Prior to utilization, long-chain fatty acids are esterified with CoA in the inner
surface of the plasma membrane. Acyl-CoA synthetase has been shown to be
responsible for this activation (Mashek and Coleman, 2006). Lastly, acyl-CoA-binding
proteins may also play an integral role in the transport of fatty acids (Knudsen et al.,
2000). These binding proteins have been shown to bind long-chain acyl-CoA much
more effectively than FABP (Rasmussen et al., 1990). Their definitive role in fatty acid
transport needs further exploration.
7
Triacylglycerol synthesis
Triacylglycerol synthesis requires the actions of multiple enzymes to esterify
three fatty acids to glycerol (see review by Coleman and Lee (2004)). Glycerol-3-
phosphate required for esterification of fatty acids is generated by glycolysis or by
phosphorylation of free glycerol by glycerol kinase (Bickerstaffe and Annison, 1971).
Glycerol-3-phosphate acyltransferase (GPAT) is the first enzyme involved in TAG
synthesis producing the first of three acylations at sn-1 producing lysophosphatidate.
Palmitoyl-CoA has been shown to be the preferred substrate for the initial acylation of
glycerol-3-phosphate in bovine mammary tissue (Kinsella and Gross, 1973).
Acylglycerol-3-phosphate acyltransferase (AGPAT) is responsible for converting
lysophosphatidate to phosphatidate while phosphatidic acid phosphatase is responsible
for the second acylation at sn-2. Lastly, diacylglycerol acyltransferase is responsible for
the final acylation forming TAG.
Coordinate regulation of lipogenic enzyme expression
Expression and activity of lipogenic enzymes and utilization of substrates by
mammary tissue increases dramatically at the onset of lactation (Wilde et al., 1986;
Bauman and Currie, 1980; Bionaz and Loor, 2008b). For instance, the mRNA
abundance at 60 d postpartum for FABP3, acyl-CoA synthetase, and AGPAT6 was 80-,
7-, and 15-fold greater relative to 15 d prior to parturition (Bionaz and Loor, 2008a).
Interestingly, the expression pattern of enzymes involved in de novo fatty acid
synthesis, TAG synthesis, and fatty acid transport are similar to that of a lactation curve
with highest expression at peak milk production. Bionaz and Loor (2008b) observed
8
peak expression of ACC, FAS, LPL, GPAT, AGPAT6, and diacylglycerol
acyltransferase-1 at 60 days in milk. Similarly, the mRNA expression of CD36, FABP3,
acyl-CoA synthetase-1, and acyl-CoA-binding protein mimicked these results (Bionaz
and Loor, 2008b). The regulation of lipogenic enzyme expression is thought to be
controlled by central regulators of transcription (Schultz et al., 2000; Gerhold et al.,
2002; Stoeckman and Towle, 2002). These regulators are transcription factors that
control the expression of lipogenic genes. Three recognized transcription factors that
may control lipid synthesis in the mammary gland are SREBP1, LXRα, and PPARγ.
LIPOGENIC TRANSCRIPTION FACTORS
Transcription factors are cellular proteins capable of regulating gene expression
by binding to specific DNA sequences found within the promoter region of target genes.
Select transcription factors are referred to as nuclear receptors. Nuclear receptors must
bind to specific ligands in the nucleus in order to promote transcription. Example
ligands include hormones, prostaglandins, fatty acids, bile acids, and oxysterols. Unlike
SREBPs, LXRs and PPARs are nuclear receptors. Sterol regulatory element binding
proteins, LXRs, and PPARs are three highly characterized transcription factors known
to regulate the synthesis of fatty acids.
Sterol regulatory element binding proteins
Three known isoforms of SREBP currently exist in the mammalian genome.
Sterol regulatory element binding protein-1a and SREBP1c are derived from a single
gene through the use of alternate transcription start sites (Hua et al., 1995; Shimomura
9
et al., 1997). Sterol regulatory element binding protein-1a is the primary isoform
expressed in cultured cells while in most animal tissues, SREBP1c is the predominant
isoform (Shimomura et al., 1997). Sterol regulatory element binding protein-1a can
activate all SREBP-responsive genes while the synthesis of fatty acids is the
predominant role of SREBP1c (Horton et al., 2002). The third isoform, known as
SREBP2, is derived from a different gene and is involved in the transcriptional
regulation of cholesterol homeostasis (Hua et al., 1995).
In order to promote transcription of lipogenic enzymes, SREBP must be
proteolytically cleaved (see reviews by Brown and Goldstein (1997) and McPherson and
Gauthier (2004); see Figure 2.1). Newly synthesized SREBP, referred to as premature
SREBP (pSREBP), is embedded in the membrane of the endoplasmic reticulum. In
order for SREBP to initiate transcription, the NH2-terminal domain must be released
from the membrane. The COOH-terminal regulatory domain binds to the COOH-
terminal domain of SREBP cleavage-activating protein (SCAP). Insulin induced gene-1
(INSIG1) and INSIG2 are integral membrane proteins that bind SCAP and cause
retention of SREBP in the endoplasmic reticulum. When not bound to INSIG, SCAP
escorts SREBP from the endoplasmic reticulum to the golgi apparatus where two
proteases, known as Site-1 protease and Site-2 protease, are present. These
proteases are responsible for cleaving SREBP causing the release of the mature, active
form of SREBP (mSREBP). The mature form of SREBP translocates to the nucleus
and binds to sterol response elements (SRE) found within the promoter regions of target
genes thereby promoting transcription.
10
Figure 2.1. Proteolytic cleavage of sterol regulatory element binding protein (SREBP).
(1) Newly synthesized sterol regulatory element binding protein (SREBP), referred to as
premature SREBP (pSREBP), is embedded in the membrane of the endoplasmic
reticulum. In order for SREBP to initiate transcription, the NH2-terminal domain must be
released from the membrane. The COOH-terminal regulatory domain binds to the
COOH-terminal domain of SREBP cleavage-activating protein (SCAP). Insulin-induced
genes (INSIG) are integral membrane proteins that bind SCAP and cause retention of
SREBP in the endoplasmic reticulum. (2) When not bound to INSIG, SCAP escorts
SREBP from the endoplasmic reticulum to the golgi apparatus where two proteases,
known as Site-1 protease and Site-2 protease, are present. These proteases are
responsible for cleaving SREBP releasing the mature, active form of SREBP
(mSREBP). (3) The mature form of SREBP translocates to the nucleus and binds to
sterol response elements (SRE) found within the promoter regions of target genes
thereby promoting transcription. Modified from DeBose-Boyd (2008).
INSIGER
SCAP
pSREBP
pSREBP
Golgi
SCAP
Site-1
Protease
mSREBP
Site-2
Protease
NH2-
NH2-
NH2- COOH-
COOH-
Cytosol1.)
2.) 3.)
Nucleus
mSREBP
SRE
Transcription
Target Gene
11
Sterol regulatory element binding proteins can regulate fatty acid synthesis by
controlling the transcription of lipogenic enzymes (Kim et al., 1998; Stoeckman and
Towle, 2002). The promoters of the lipogenic enzymes ACC, FAS, and GPAT all
contain a SRE capable of binding SREBP1 (Lopez et al., 1996; Magana and Osborne,
1996; Ericsson et al., 1997). The binding of SREBP1 to these promoters increases lipid
synthesis by influencing transcription. In rat hepatocytes, SREBP1c is necessary for
the stimulation of ACC and FAS by glucose (Foretz et al., 1999). Overexpression of
SREBP1c in adipocyte cell lines increases FAS expression (Kim et al., 1998) and
overexpression of mSREBP1c in the liver of transgenic mice increases liver TAG
(Shimano et al., 1997). Sterol regulatory element binding protein-1c regulates TAG
synthesis by controlling the transcription of GPAT in 3T3-L1 preadipocytes (Ericsson et
al., 1997).
Liver X receptors
Liver X receptors are nuclear receptors that regulate the synthesis of lipid
including fatty acids, cholesterol, and bile acids (see review by Edwards et al. (2002)).
Liver X receptors are regulated by oxysterols that appear to be produced in proportion
to cellular cholesterol content (Janowski et al., 1999). Liver X receptor-α and LXRβ are
two known isoforms of LXR. Liver X receptor-α is expressed in adipose, liver, and
intestine while LXRβ is expressed ubiquitously (Peet et al., 1998a). These nuclear
receptors regulate the transcription of target genes by binding to DNA in a heterodimeric
complex with retinoic X receptor (RXR; Willy et al., 1995).
12
Liver X receptors regulate fatty acid synthesis by increasing the transcription of
lipogenic enzymes via indirect and direct mechanisms (see Figure 2.2). Transcription of
SREBP1 mRNA in liver and intestine was increased in response to T091317 (T09), a
LXR agonist (Repa et al., 2000; Schultz et al., 2000). This response failed to occur in
LXRα/LXRβ double knockout mice (Repa et al., 2000). In support, T09 has been shown
to increase the concentration of mSREBP in the nucleus (Talukdar and Hillgartner,
2006; Montanaro et al., 2007). The ability of T09 to promote the transcription of SREBP
is specific for the SREBP1c isoform (Repa et al., 2000; Schultz et al., 2000). As
mentioned above, LXR must form a heterodimer with RXR in order to regulate the
transcription of target genes. Co-transfection of LXR with RXR synergistically activates
the SREBP1c promoter in HePG2 cells (Yoshikawa et al., 2001).
In addition to increasing the transcription of SREBP1c, LXR can directly promote
the transcription of target genes by binding to a response element found within the
promoter region. Joseph and coworkers (2002) demonstrated that in addition to tandem
SREBP1c sites, the FAS promoter contains a binding site for the LXR/RXR
heterodimers. They conferred that maximum induction of FAS requires both LXR and
SREBP1c binding to their respective response elements within the promoter region.
Similarly, Talukdar and Hillgartner (2006) demonstrated that LXR increases ACCα
transcription by activating LXR/RXR heterodimers bound to a LXR response element
(LXRE).
Peroxisome proliferator-activated receptors
Peroxisome proliferator-activated receptors are nuclear receptor proteins capable
13
Figure 2.2. Liver X receptors (LXR) regulate fatty acid synthesis by increasing the
transcription of lipogenic enzymes via indirect and direct mechanisms. (A) LXR can
activate the transcription of acetyl-CoA carboxylase (ACC) and fatty acid synthase
(FAS) indirectly by increasing the transcription of premature sterol regulatory element
binding protein (pSREBP). Liver X receptor forms a heterodimer with retinoic X
receptor (RXR) and binds to the LXR response element (LXRE) located within the
promoter region of pSREBP. Mature SREBP can then bind to the sterol response
element (SRE) further promoting the transcription of ACC and FAS. (B) In addition to
increasing the transcription of pSREBP, LXR can directly promote the transcription of
ACC and FAS by binding to the LXRE found within the promoter region of these genes.
Nucleus
LXRE
Transcription
pSREBP
Transcription
ACC or FAS
LXR RXR
LXR RXR
SRE
A
BLXRE
SRE
Transcription
ACC or FAS
mSREBP
mSREBP
14
of regulating cellular differentiation and metabolism of lipid (see review by Berger and
Moller (2002)). As is observed with several nuclear receptors, such as LXR, PPARs
must form a heterodimer with RXR for DNA binding. Three related PPAR isoforms,
encoded by separate genes, have been identified. These include PPARα, PPARδ, and
PPARγ. Peroxisome proliferator-activated receptors are ligand-activated transcription
factors capable of regulating gene expression by binding to specific peroxisome
proliferator response elements found within the promoter region of target genes. Such
ligands include fatty acids, eicosanoids, and synthetic antidiabetic thiazolidinediones
(Krey et al., 1997).
Peroxisome proliferator-activated receptor-α is primarily expressed in tissues with
elevated rates of fatty acid oxidation such as liver, heart, brown adipose, and skeletal
muscle (Braissant et al., 1996; Auboeuf et al., 1997). Peroxisome proliferator-activated
receptor-α ligand binding has profound effects on fatty acid oxidation and lipoprotein
metabolism. Enzymes involved in fatty acid oxidation such as medium chain acyl-CoA
dehydrogenase, acyl-CoA oxidase, and cytochrome P450 fatty acid ω-hydroxylase are
upregulated by PPARα (Schoonjans et al., 1996b). Furthermore, carnitine
palmitoyltransferase-I has been shown to be upregulated by PPARα via a response
element found within the promoter region of the gene (Mascaro et al., 1998). In
addition, PPARα knockout mice failed to increase the expression of genes involved in
fatty acid oxidation in response to stimulation with PPARα agonists (Lee et al., 1995).
As a result of the shift in free fatty acid metabolism from TAG synthesis to catabolism in
response to PPARα agonists, the secretion of very low density lipoproteins is strongly
decreased (Schoonjans et al., 1996b).
15
Peroxisome proliferator-activated receptor-δ is expressed ubiquitously in white
adipose, skeletal muscle, heart, and intestinal tissue (Braissant et al., 1996). Current
evidence suggests that PPARδ may play a role in the metabolism of lipids and the
pathophysiology of atherosclerosis. Treatment of insulin-resistant obese rhesus
monkeys with a PPARδ agonist decreased blood TAG, fasting plasma insulin, and low
density lipoprotein cholesterol (Oliver et al., 2001). Treatment of myotubes with a
PPARδ agonist increased fatty acid oxidation (Tanaka et al., 2003). In addition, ligand
binding to PPARδ results in decreased expression of inflammatory cytokine genes and
diminished inflammation (Lee et al., 2003).
Peroxisome proliferator-activated receptor-γ is predominantly found in white
adipose tissue (Braissant et al., 1996). Peroxisome proliferator-activated receptor-γ is
the most widely characterized PPAR isoform and has been shown to play a central role
in the control of adipocyte gene expression and differentiation (Brun et al., 1996). Direct
activation of PPARγ induces adipocyte genes such as LPL, fatty acid transport protein,
and CD36, enzymes essential for the cellular uptake of lipid (Schoonjans et al., 1996b;
Martin et al., 1997; Sfeir et al., 1997). In addition, liver PPARγ ablation significantly
decreases ACC and FAS mRNA in mice (Gavrilova et al., 2003). Interestingly,
coexpression of PPARγ with SREBP has been shown to increase the transcriptional
activity of PPARγ (Kim et al., 1996).
Transcription factors in the mammary gland
The molecular regulation of milk fat synthesis in the bovine mammary gland
involves multiple regulatory pathways. Recent research has helped determine the
16
relative expression of SREBPs, LXRs, and PPARs during the dry period and lactation
(Bionaz and Loor, 2008a, Bionaz and Loor, 2008b); however, further research is
needed to help identify the relative contributions of each transcription factor to the
synthesis of milk fat.
Sterol regulatory element binding protein is considered to be the primary
regulator of milk fat synthesis in the lactating mammary gland (Harvatine and Bauman,
2006). The expression of SREBP1 is significantly upregulated during lactation in mice
and cows (Anderson et al., 2007; Rudolph et al., 2007; Bionaz and Loor, 2008b).
Trans-10, cis-12 CLA significantly decreases the proteolytic activation of SREBP1 in
MAC-T (Peterson et al., 2004). In support, Harvatine and Bauman (2006) observed a
downregulation of SREBP1 and SREBP1-regulated enzymes during diet-induced milk
fat depression in the lactating dairy cow. Expression of SREBP regulatory proteins
(INSIG1, INSIG2, and SCAP) is significantly increased throughout the first 120 d of
lactation in the dairy cow (Bionaz and Loor, 2008b). In addition, Harvatine and Bauman
(2006) observed a significant decrease in INSIG1 and INSIG2 mRNA in response to
trans-10, cis-12 CLA further implicating SREBP1 in the synthesis of milk fat.
The function of LXR in the mammary gland is undefined. In mice, the expression
of LXRα in the mammary gland is approximately 10-fold greater during early pregnancy
compared to early lactation (Anderson et al., 2007). In addition to LXRα, LXRβ has
been shown to be present in appreciable amounts in the lactating mammary gland of
mice (Rudolph et al., 2007). In dairy cows, LXRα, but not LXRβ expression is increased
during lactation compared to nonlactating mammary tissue (Harvatine and Bauman,
2007; Bionaz and Loor, 2008b). In contrast, Farke and coworkers (2008) observed no
17
difference in LXRα mRNA expression between dry period and lactation in dairy cows.
Harvatine and Bauman (2007) determined that the expression of LXRα and LXRβ are
not modified during milk fat depression induced by diet or treatment with trans-10, cis-
12 CLA; however the activity was not assessed.
Similarly to LXR, the role of PPARγ in the mammary gland still remains to be
defined. In mice, the expression of PPARγ is approximately 10-fold greater during early
pregnancy compared to early lactation (Anderson et al., 2007). In contrast, Bionaz and
Loor (2008b) observed a significant increase in the mRNA expression of PPARγ during
lactation. Bovine mammary epithelial cells treated with rosiglitazone, a PPARγ agonist,
resulted in a significant upregulation of FAS and SREBP1 expression (Kadegowda et
al., 2008). The observed increase in SREBP1 expression may be explained by an
increase in PPARγ coactivator-1A expression throughout the first 120 d of lactation
(Bionaz and Loor, 2008b). The observed increase in PPARγ coactivator-1A was
accompanied by a parallel increase in INSIG1. Interestingly, INSIG1 has been shown
to be a PPARγ responsive gene (Kast-Woelbern et al., 2004; Kadegowda et al., 2008).
Therefore, PPARγ may play a role in the regulation of SREBP1. Lastly, unlike
SREBP1, the expression of PPARγ is not modified by milk fat depression in lactating
dairy cows (Harvatine and Bauman, 2007). Whether or not the activity of PPARγ is
modified by milk fat depression remains undefined.
REGULATION OF MILK FAT SYNTHESIS BY FATTY ACIDS
During the past decade, a plethora of research has focused on the regulation of
milk fat synthesis by CLAs (see review by Bauman and coworkers (2008)). Conjugated
18
linoleic acids are produced as intermediates in the biohydrogenation of linoleic acid (LA)
by rumen microbes (Davis and Brown, 1970). Cis-9, trans-11 CLA is the predominant
CLA isomer found in milk fat (Parodi, 1997). This isomer is derived primarily from the
desaturation of trans-vaccenic acid within the mammary gland (Griinari et al., 2000). In
addition to cis-9, trans-11 CLA, a variety of other CLA isomers are detected in milk fat
including trans-10, cis-12 CLA (Piperova et al., 2002). In 2000, Baumgard and
coworkers (2000) identified trans-10, cis-12 CLA as the unique CLA isomer responsible
for dramatic reductions in milk fat synthesis. They also observed that cis-9, trans-11
CLA had no effect on milk fat content or yield. In addition to the well documented
effects of trans-10, cis-12 CLA on milk fat synthesis (Baumgard et al., 2000; Baumgard
et al., 2002), trans-9, cis-11 CLA and cis-10, trans-12 CLA have been identified as
inhibitors of milk fat synthesis (Saebo et al., 2005; Perfield et al., 2007).
Suppression of lipogenic enzymes by trans-10, cis-12 conjugated linoleic acid
The effects of trans-10, cis-12 CLA on lipogenic gene expression in the bovine
mammary gland have been well established. Abomasal infusions of trans-10, cis-12
CLA have resulted in ~40-50% reductions in ACC, FAS, GPAT, AGPAT, and LPL
mRNA expression (Baumgard et al., 2002). Sterol regulatory element binding protein-1
is a known regulator of these enzymes; therefore, it has been proposed that SREBP1
may be responsible for regulating their expression in response to trans-10, cis-12 CLA
(Peterson et al., 2004; Harvatine et al., 2009). In support of this theory, the mRNA
expression of SREBP1 is significantly decreased in response to trans-10, cis-12 CLA
treatment (Harvatine and Bauman, 2006). Interestingly, the mRNA expression of
19
INSIG1 was also decreased in response to treatment. Expression of PPARα, PPARβ,
PPARγ, LXRα and LXRβ was not modified by intravenous infusion of trans-10, cis-12
CLA (Harvatine and Bauman, 2007). Therefore, decreases in lipogenic gene
expression in response to trans-10, cis-12 CLA are potentially due to a decrease in
SREBP1 gene expression rather than changes in nuclear receptor gene expression.
The ability of specific CLA isomers to inhibit milk fat synthesis seems to be
unique to these polyunsaturated fatty acids. Saturated fatty acids have been shown to
have no effect on milk fat production (Drackley et al., 1992; Bremmer et al., 1998). In
addition, oleic acid, a monounsaturated fatty acid, fails to inhibit milk fat production. For
instance, LaCount and coworkers (1994) observed an increase in milk fat content and
yield in response to abomasal infusions of either canola oil (high in oleic acid and LA) or
a high oleic acid, sunflower oil. In addition, abomasal infusion of oils high in trans-fatty
acids significantly decreased milk fat production in dairy cows compared to a high oleic
acid, sunflower oil infusion (Gaynor et al., 1994). Lastly, LA alone fails to inhibit milk fat
production in the absence of CLAs (Loor and Herbein, 1998).
In vitro studies
The in vitro study of the regulation of fat synthesis by fatty acids varying in
degree of saturation has been challenging. Few studies have evaluated the effect of
fatty acids varying in degree of saturation on lipid synthesis in bovine mammary
epithelial cells. In bovine mammary epithelial cells, addition of palmitic acid to the
incubation medium stimulated synthesis of butyric acid and palmitic acid (Hansen and
Knudsen, 1987). Contrary to in vivo data, Hansen and Knudsen (1987) also observed
20
that the effect of oleic acid addition on the synthesis and esterification of short- and
medium-chain fatty acids was strongly inhibitory. These results were also observed in
goat mammary epithelial cells (Hansen et al., 1984).
Recently, a select number of studies have evaluated the effect of CLA isomers
on milk fat synthesis in vitro yielding confounding results. Incubation of MAC-T cells
with increasing concentrations (20-100 µM) of oleic acid and trans-vaccenic acid
decreased the activities of ACC and FAS (Jayan and Herbein, 2000). Treatment of
MAC-T with 75 µM trans-10, cis-12 CLA resulted in a 50% reduction in the incorporation
of radiolabeled acetate (Peterson et al., 2004). However, incubation of MAC-T with 75
µM cis-9, trans-11 CLA failed to significantly decrease the mRNA expression of ACC
and FAS compared to trans-10, cis-12 CLA. Contrary to Harvatine and Bauman (2006),
Peterson and coworkers (2004) observed no significant difference in the mRNA
expression of SREBP1 between cis-9, trans-11 CLA and trans-10, cis-12 CLA
treatments compared to a bovine serum albumin control. When comparing cis-9, trans-
11 CLA and trans-10, cis-12 CLA, trans-10, cis-12 CLA increased pSREBP protein and
decreased mSREBP compared to cis-9, trans-11 CLA (Peterson et al., 2004).
The potential differences between in vitro and in vivo data may be due to
nonspecific effects of incubating bovine mammary epithelial cells with free fatty acids.
For instance, Keating and colleagues (2008) observed that increasing concentrations of
cis-9, trans-11 CLA and trans-10, cis-12 CLA have a negative impact on MAC-T cell
growth. Decreases in cell growth may be responsible for observed decreases in mRNA
expression and protein abundance of lipogenic genes. It may also be possible that the
in vitro inhibition of lipogenic enzyme activity by fatty acids varying in degree of
21
saturation may occur in response to a nonspecific detergent effect. Pande and Meade
(1968) state that fatty acids or acyl-CoA esters acting as potent detergents can bind to
proteins and affect their secondary and tertiary structure potentially altering their
biological activity. This theory was later supported by Bauman and Davis (1974). To
answer this question, Wright and coworkers (2002) incubated bovine mammary
explants with either palmitic acid or sodium dodecyl sulfate. They observed that
palmitic acid inhibited fatty acid synthesis and that this effect was not the result of a
nonspecific detergent effect. To study the effects of trans-10, cis-12 CLA in cell culture,
further research is needed to identify the differences between in vitro and in vivo data.
AMP-ACTIVATED PROTEIN KINASE
AMP-activated protein kinase is critical in ensuring the energy balance of
mammalian cells (see review by Hardie (2007)). Mammalian AMPK is highly sensitive
to increases in the AMP:ATP ratio and is activated by metabolic stresses that inhibit
ATP production or stimulate ATP consumption. Most notably, AMPK is activated in
response to exercise, fasting, and hypoxia (Mu et al., 2001; Minokoshi et al., 2004). It is
also modulated by cytokines that regulate energy balance (i.e. leptin; Minokoshi et al.,
2002), pharmacological activators (i.e. 5-aminoimidazole-4-carboxamide ribonucleoside
(AICAR); Corton et al., 1995), or natural plant products (i.e. (-)-epigallocatechin-3-
gallate; Collins et al., 2007). 5-Aminoimidazole-4-carboxamide ribonucleoside may be
phosphorylated to form AICAR monophosphate (ZMP), the monophosphorylated
derivative of AICAR (Corton et al., 1995). 5-Aminoimidazole-4-carboxamide
ribonucleoside monophosphate mimics the effects of AMP on AMPK by causing
22
allosteric activation but also promotes the phosphorylation and activation of an
upstream AMPK kinase (Corton et al., 1995; Henin et al., 1995). Once activated, AMPK
is able to stimulate ATP production in addition to inhibiting ATP consumption by
enhancing the uptake and metabolism of glucose and fatty acids as well as inhibit the
synthesis of fatty acids, cholesterol, glycogen, and protein (Kahn et al., 2005).
Switching on catabolic pathways and inhibiting anabolic pathways ensures a decrease
in the AMP:ATP ratio thus restoring energy homeostasis of the cell.
Structure of AMP-activated protein kinase
AMP-activated protein kinase is a complex heterotrimeric protein consisting of
one catalytic subunit (α) and two regulatory subunits (β and γ). In mammalian cells,
multiple isoforms exist for the α (α1, α2), β (β1, β2), and γ (γ1, γ2, and γ3) subunits of
AMPK. Each subunit plays a distinct role in the overall function of AMPK. The γ
subunit of AMPK binds AMP causing a conformational change exposing the catalytic
domain found on the α subunit. Exposing the AMP binding domain on the α subunit
results in the phosphorylation of threonine-172 by upstream AMPK kinases (Hawley et
al., 1996). The β subunit tethers the α and γ subunits of AMPK (Iseli et al., 2005). In
addition, the β subunit contains a carbohydrate binding domain that is capable of
binding glycogen causing a conformational change in the structure of the protein
(Hudson et al., 2003).
All three subunits are required to yield significant AMPK activity (Dyck et al.,
1996). At least twelve heterotrimeric combinations are possible (i.e. α1, β1, γ1 or α1,
β2, γ3) and can vary based on specie and tissue specificity. The tissue-specific
23
distribution of AMPK subunits in different species may explain differences in metabolic
response to AMPK activation (Chen et al., 1999; Cheung et al., 2000; Birk and
Wojtaszewski, 2006). As an example, the predominant AMPK heterotrimeric complex in
skeletal muscle contains the α2, β2, γ3 isoforms (Barnes et al., 2004; Mahlapuu et al.,
2004).
AMP-activated protein kinase is highly expressed in skeletal muscle, liver, heart,
and mammary gland of rats (Verhoeven et al., 1995; Woods et al., 1996). It should be
noted that expression does not always correlate with activity of AMPK. The α1 isoform
accounts for 90% of total AMPK activity in liver extracts yet the mRNA level of α1 was
found to be low compared to the expression of the α2 isoform (Gao et al., 1996).
Verhoeven and coworkers (1995) showed that total AMPK mRNA was 4 fold greater in
skeletal muscle compared to heart, liver, mammary gland, and brain; however, activity
failed to mimic expression. Cheung and others (2000) observed that AMPK activity in
rats was greatest in liver, lung, and heart and lower in muscle, testis, brain, and
pancreas. Similarly, AMPK activity is greatest in the kidney, liver, and heart of rat in
response to AMP (Stapleton et al., 1996).
Regulation by upstream kinases
LKB1 is a serine/threonine kinase and is the predominant AMPK kinase in
multiple mammalian cell types in response to changes in the AMP:ATP ratio (Hawley et
al., 2003; Shaw et al., 2004). As mentioned, AMP binds to the γ subunit of AMPK
allowing for a conformational change exposing the catalytic domain found on the α
subunit. LKB1 can activate AMPK by directly phosphorylating α1 and α2 subunits of
24
AMPK in addition to eleven other AMPK-related kinases (Lizcano et al., 2004).
Specifically, this upstream AMPK kinase directly phosphorylates threonine-172 of α
subunit of AMPK thereby activating AMPK (Shaw et al., 2004). Activation of AMPK by
LKB1 can result in the phosphorylation (inactivation) of ACC thereby inhibiting lipid
synthesis (Shaw et al., 2004). Sakamoto and coworkers (2005) used mice with
decreased expression of muscle LKB1 and found that phosphorylation of ACC was
profoundly reduced. Lastly, studies have shown that phenformin and AICAR fail to
activate AMPK in cells deficient in LKB1 (Hawley et al., 2003).
Ca2+/calmodulin-dependent kinase kinase is another upstream kinase
responsible for activating AMPK (Figure 2.3). Contrary to LKB1, CaMKK activates
AMPK in an AMP-independent manner by recognizing increasing concentrations of
intracellular Ca2+ (Hawley et al., 2005; Hurley et al., 2005; Woods et al., 2005).
Therefore, in addition to fluctuations in the AMP:ATP ratio, AMPK may be responsive to
nutrients, changes in physiological conditions, hormonal stimuli, or pharmaceutical
drugs. For instance, α-lipoic acid and (-)-epigallocatechin-3-gallate, two natural
compounds, activate CaMKK in myotubes and hepatocytes, respectively (Collins et al.,
2007; Shen et al., 2007). Ionomycin, an ionophore responsible for increasing
intracellular Ca2+, has been shown to increase AMPK activity and ACC phosphorylation
in HeLa cells (Hurley et al., 2005). Similarly, Woods and others (2005) observed an
increase in AMPK activity with ionomycin treatment in HeLa cells. Co-incubating
ionomycin with STO-609, a cell permeable inhibitor of CaMKK, resulted in a reduction in
ionomycin induced AMPK activity (Woods et al., 2005) and is supported by Hurley and
coworkers (2005). Lastly, ionomycin stimulated AMPK activity and ACC
25
Figure 2.3. Phosphorylation (activation) of AMP-activated protein kinase (AMPK) by
serine/threonine kinase-11 (LKB1) and Ca2+/calmodulin-dependent kinase kinase
(CaMKK) results in the phosphorylation (inactivation) of acetyl-CoA carboxylase (ACC).
AMPK
P
AMPK
LKB1 CaMKK
+
Inactive Active
AMP:ATP [Ca2+]
ACC
P
ACC
Active Inactive
++
Acetyl-CoA Malonyl-CoA
Cytosol
AMPK
Inactive
+ +
26
phosphorylation are decreased in response to downregulating CaMKKβ, one of two
isoforms of CaMKK, using RNA interference (Hurley et al., 2005; Woods et al., 2005).
Regulation of acetyl-CoA carboxylase
Phosphorylation of ACC in vitro and in vivo has been well documented and
currently two known protein kinases significantly inactivate this lipogenic enzyme –
cAMP-dependent protein kinase A and AMPK (Munday et al., 1988). Regulation of
ACC by AMPK is shown in Figure 2.3. In rat, ACCα is phosphorylated by AMPK on
serine residues 79, 1200, and 1215 while cAMP-dependent protein kinase A
phosphorylates serine residues 77 and 1200. Phosphorylation of ACC by cAMP-
dependent protein kinase A and AMPK produces 10% and 90% decreases in the Vmax
of the enzyme, respectively (Munday et al., 1988). Removal of the N-terminus of ACCα
results in the re-activation of the cAMP-dependent protein kinase A or AMPK mediated
phosphorylation indicating that only serine residues 77 and 79 exhibit the inhibitory
effect on ACCα (Davies et al., 1990). Finally, mutation of serine-79 on ACCα in HeLa
cells abolishes the inhibitory effect of AMPK phosphorylation and prevents serine-1200
phosphorylation (Ha et al., 1994). In vitro, ACCα and ACCβ in rat liver can both serve
as a substrate for AMPK phosphorylation causing inactivation (Dyck et al., 1996; Winder
et al., 1997).
Metabolic stress can result in the phosphorylation of ACC by AMPK; thereby
inhibiting lipid synthesis. Rats running on a treadmill resulted in a 2.4 fold increase in
activation of AMPK in muscle and a concurrent 67% decrease in ACC activity in muscle
(Winder and Hardie, 1996). In agreement, Park and coworkers (2002a) observed a
27
50% decrease in ACC activity in the muscle and liver of exercised rats. Park and others
(2002b) showed a significant negative correlation between AMPK-phosphorylated ACC
and ACC activity. In bovine aortic endothelial cells, hypoxia caused an increase in
AMPK and ACC phosphorylation (Zou et al., 2003). Mimicking the effects of increased
energy demand has also been shown to inactivate ACC in response to AMPK activation
(Merrill et al., 1997; Zhou et al., 2001; Park et al., 2002a).
Regulation of glycerol-3-phosphate acyltransferase
AMP-activated protein kinase may downregulate TAG synthesis to promote the
partitioning of fatty acyl-CoA towards β-oxidation (Muoio et al., 1999). In oxidative
muscle isolated from mice, incorporation of [14C]-oleate into TAG decreased by 37% in
response to AICAR (Muoio et al., 1999). Likewise incubating cultured rat hepatocytes
with AICAR decreased [14C]-oleate incorporation into TAG by 50% (Muoio et al., 1999).
Incubation of rat hepatocytes with AICAR resulted in a 29% to 43% decrease in
mitochondrial and microsomal GPAT activity (Muoio et al., 1999). In addition,
incubation of rat hepatocytes with purified recombinant AMPK decreased mitochondrial
GPAT activity (Muoio et al., 1999). In rats, mitochondrial GPAT activity in liver and
adipose decreased by 50% after exercise (Park et al., 2002a). However, exercise did
not affect mitochondrial GPAT activity in muscle or microsomal GPAT activity in liver,
adipose, or muscle.
28
Regulation of lipogenic transcription factors
Peroxisome proliferator-activated receptors are nuclear receptor proteins able to
regulate the expression of lipogenic enzymes. The transcriptional co-activator p300 is
able to mediate the activation of PPAR as well as other nuclear receptors (Gelman et
al., 1999; Vo and Goodman, 2001). AMP-activated protein kinase can phosphorylate
p300 on serine-89 causing a reduction in its affinity with various nuclear receptors
(Yang et al., 2001). Yang and others (2001) transfected Baby Hamster Kidney cells
with an expression vector producing PPARγ and a luciferase reporter plasmid
containing a PPAR-response element. Incubated transfected cells with AICAR for 24 h
resulted in a 75% decrease in the transcriptional activity of PPARγ.
Sterol regulatory element binding proteins are transcription factors able to
regulate lipid homeostasis by controlling the expression of lipogenic enzymes including
ACC and FAS. Activation of AMPK with AICAR or metformin significantly decreases
insulin induced expression of SREBP1 mRNA in rat hepatocytes (Zhou et al., 2001). In
addition, treatment of rat hepatocytes with these AMPK activators decreases the mRNA
expression of FAS and Spot-14, two genes known to be regulated by SREBP1. Rat
hepatoma H4IIEC3 cells treated with ethanol increase mature SREBP1 protein
abundance by 2.2 fold (You et al., 2004). Addition of AICAR or metformin significantly
blocked the induction of mature SREBP1 by ethanol. In support, incubating cultured
pancreatic islets with AICAR decreased the expression of endogenous SREBP1 and
FAS genes as well as reversed the effect of over-expressing mature SREBP1 on FAS
mRNA expression and cellular TAG content (Diraison et al., 2004).
29
HYPOTHESIS STATMENT
In liver tissue, LXR and AMPK have the ability to regulate lipid synthesis by either
modifying gene expression or by phosphorylating lipogenic enzymes. Our working
hypothesis is that activation of LXR and AMPK will enhance or inhibit de novo fatty acid
synthesis in bovine mammary epithelial cells, respectively. The identification of LXR
and AMPK as regulators of de novo fatty acid synthesis will further enhance our
understanding of milk fat synthesis in the mammary gland of the lactating dairy cow.
30
CHAPTER 3
Polyunsaturated Fatty Acids Inhibit de novo Fatty Acid Synthesis in Bovine Mammary Epithelial Cells
INTRODUCTION
In vitro, saturated, monounsaturated, and polyunsaturated fatty acids can
regulate fatty acid synthesis in mammary epithelial cells. Treatment of bovine
mammary epithelial cells with palmitic acid, a saturated fatty acid, stimulates the
synthesis of butyric and palmitic acid (Hansen and Knudsen, 1987). In addition, oleic
acid, a monounsaturated fatty acid, inhibited the synthesis and esterification of short-
and medium-chain fatty acids. More recently, the effects of cis-9, trans-11 conjugated
linoleic acid (CLA) and trans-10, cis-12 CLA, polyunsaturated fatty acids, on fatty acid
synthesis have been evaluated in MAC-T cells, a bovine mammary epithelial cell line
(Peterson et al., 2004). Concurrent with in vivo data (Baumgard et al., 2000), Peterson
and coworkers (2004) observed a significant decrease in de novo fatty acid synthesis
and lipogenic gene expression in response to trans-10, cis-12 CLA. Similarly,
incubation of MAC-T with increasing concentrations of oleic acid resulted in a decrease
in acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS) activity (Jayan and
Herbein, 2000).
Sterol-regulatory element binding protein-1c (SREBP1c) is a membrane-bound
transcription factor known to enhance fatty acid synthesis by activating the genes
encoding ACC, FAS, glycerol-3-phosphate acyltransferase, and other lipogenic
enzymes (Stoeckman and Towle, 2002). Exposure of mammary epithelial cells and rat
hepatoma cells to unsaturated fatty acids decreases the expression of SREBP1c (Ou et
al., 2001; Peterson et al., 2004). In vivo, the decreased expression of SREBP1 and the
31
coordinated reduction in SREBP1-responsive lipogenic enzymes is considered to play a
central role in the regulation of milk fat synthesis in response to trans-10, cis-12 CLA
(Harvatine and Bauman, 2006).
The use of an in vitro model can be used to investigate the molecular
mechanisms responsible for milk fat depression in vivo. To date, MAC-T cells have
been the most heavily investigated bovine mammary epithelial cell line. However, in
addition to MAC-T, another bovine mammary epithelial cell line (BME-UV) has been
characterized (Zavizion et al., 1996). Whether polyunsaturated fatty acids can regulate
fatty acid synthesis has yet to be evaluated in BME-UV cells. Therefore, our objective
was to evaluate the effect of polyunsaturated fatty acids on de novo fatty acid synthesis,
mRNA abundance for lipogenic enzymes, and the potential involvement of SREBP1 in
the BME-UV bovine mammary epithelial cell line.
MATERIALS AND METHODS
Cell culture and treatments
Experiments utilized BME-UV cells (Zavizion et al., 1996). BME-UV bovine
mammary epithelial cells were compared to MAC-T cells (Huynh et al., 1991) when
evaluating the effects of polyunsaturated fatty acids on de novo fatty acid synthesis.
Throughout the duration of the experiments, cells were cultured at 37°C in 5% CO2, and
the medium was changed every 24 h. Cells were seeded on gelatin coated cell culture
plates at a density of 5 × 105 cells/cm2 and 2.6 × 104 cells/cm2 for BME-UV and MAC-T
cells, respectively. Cells were grown in basal medium (Dulbecco’s Modified Eagle’s
Medium with 10 kU/ml penicillin, 10 mg/ml streptomycin, and 25 µg/ml amphotericin B)
32
supplemented with 10% fetal bovine serum. Once cells reached confluency
(approximately 72 h post seeding) serum was removed and hormones (0.1 μg/mL
insulin and 1.5 μg/mL prolactin; Sigma Chemical Co., St. Louis, MO) were added to the
basal media. Cells were cultured in basal media with hormones for 24 h and then
treatments were applied.
In all experiments, cells were treated with 50 µM linoleic acid (LA), cis-9, trans-11
CLA, or trans-10, cis-12 CLA (Nu-Chek Prep, Inc., Elysian, MN, Matreya, LLC, Pleasant
Gap, PA) for 24 h. All fatty acids were complexed with fatty acid free bovine serum
albumin (BSA; Sigma Chemicals Co., St. Louis, MO; 1:3 molar ratio of BSA:fatty acid).
Fatty acids were bound to BSA according to Ip and coworkers (1999) with the following
modifications. Pure fatty acid was incubated with preheated sodium hydroxide (70°C) in
a 1:1 molar ratio and vortexed periodically, until clear. Sodium salts were diluted in
warm (37°C) basal medium with hormones in a 3:1 molar ratio with BSA. Complexes in
media were filtered using a 0.22 µm syringe filter prior to utilization. Bovine serum
albumin served as control when evaluating the effects of fatty acids.
Fatty acid synthesis assay
De novo fatty acid synthesis in BME-UV or MAC-T was determined by
quantifying the incorporation of [1-14C]-labeled acetate into lipid. Methods were adapted
from Peterson and coworkers (2004) and modified as described. Cells were cultured in
6-well cell culture plates and treated with BSA or fatty acids. After 24 h of treatment,
cells were incubated with 14C-labeled acetate (MP Biomedicals, Solon, OH) for a period
of 4 h. During this 4 h period, cells were cultured in 3 mM acetate (0.8 µCi/µmol).
33
Following the 4 h incubation with [1-14C]-labeled acetate, cells were lysed in wells with
sodium dodecyl sulfate buffer (0.1% in phosphate buffered saline). Lipid within the
lysate was then extracted using hexane:isopropanol (3:2). The solvent layer was
combined with 16 ml of scintillation cocktail (Scintisafe 30% Cocktail; Fisher Scientific,
Pittsburgh, PA) for quantification of label incorporation into lipid using a LS 6000LL
Beckmann scintillation counter. Activity was calculated and expressed as pmol of
acetate incorporated per µg of DNA.
Real time PCR
Cultured BME-UV cells were lysed in 6-well culture plates using 1 mL of TRI
Reagent (Molecular Research Center Inc.; Cincinnati, OH) per well. Total RNA was
isolated according to manufacturer’s instructions. Ribonucleic acid pellets were
resuspended in RNase-free water, and quantified at 260 nm using a spectrophotometer.
Total RNA was reverse transcribed (500 ng per reaction) into cDNA using the
Omniscript reverse transcription kit (Qiagen; Valencia, CA) according to manufacturer’s
instructions using oligo(dT) (Roche Applied Science; Indianapolis, IN) as the primer.
Real-time PCR reactions were performed using the Quantitect SYBR Green PCR
kit (Qiagen; Valencia, CA) and an Applied Biosystems 7300 Real-time PCR machine
(Applied Biosystems; Foster City, CA). Quantification of gene transcripts for ACCα,
FAS, peroxisome-proliferator activated receptor-γ (PPARγ), liver X receptor-α (LXRα),
and SREBP1 was completed using gene-specific primers (Table 3.1). β-actin was used
as the endogenous control gene. Fold change was calculated using the 2−ΔΔCt method
(Livak and Schmittgen, 2001). Reaction conditions were as follows: 1 cycle at 95°C for
34
Table 3.1. Primer sequences used to detect ACCα, FAS, PPARγ, LXRα,
SREBP1, and β-actin mRNA1.
Target Gene
Forward Primer (5'-3') Reverse Primer (3'-5') Product Size (bp)
ACCα GGGTGAAAGACTGGGTTGGAA GTAGTGTAGGCACGAGACAG 172
FAS AATGACCACTTTGCCGATGT TGAAGGACGGTGTACCACAA 152
PPARγ CATCTTCCAGGGGTGTCAGT TCCTACCCCAGGAGTATAGG 186
LXRα TCAACCCCATCTTCGAGTTC ACGACTACTTTGACCACTCG 232
SREBP12 ATGCCATCGAGAAACGCTAC CTCTTGGACTCAGACGCCTG 180
β-actin CTCTTCCAGCCTTCCTTCCT CGTCTTTCTCTAGTGACGGG 178 1ACCα, acetyl-CoA carboxylase-α; FAS, fatty acid synthase; PPARγ, peroxisome proliferator-activated receptor-γ; LXRα, liver X receptor-α; and SREBP1, sterol regulatory element binding protein-1. 2Primer pairs do not distinguish between SREBP1a and SREBP1c isoforms.
35
10 min followed by 40 cycles at 95°C for 30 s, 58°C for 30 s, and 72°C for 1 min. Each
reaction was performed in duplicate wells.
DNA quantification
Bovine mammary epithelial cells (BME-UV or MAC-T) were harvested in DNA
assay buffer (Tris Base, EDTA, NaCl; pH 7.4) and then sonicated (2 × 5 s) on ice.
Deoxyribonucleic acid concentration of cell lysates was assayed as described by
Labarca and Paigen (1980) with the following modifications. Briefly, 2 μL of cell lysate
was transferred to a cuvette followed by 1998 μL of DNA assay buffer to yield a total
assay volume of 2 mL. Samples were measured in triplicate using a DyNA Quant 200
fluoremeter (Hoefer Pharmacia Biotech; San Francisco, CA). Calf thymus DNA (Sigma
Chemical Co.; St. Louis, MO) was used as the standard.
Cellular fractionation
For determination of ACCα and premature SREBP1 (pSREBP1) protein
abundance, BME-UV cells were seeded on 6-well cell culture plates. Following a wash
with phosphate buffered saline, cells were harvested in ice-cold lysis buffer (50 mM Tris
pH 7.4, 0.5% Triton X-100, 0.3 M NaCl, 2 mM EDTA, and protease inhibitor cocktail) for
15 min on ice. Lysate was centrifuged at 14,000 × g at 4°C for 10 min. The resulting
supernatant was used for ACCα and pSREBP1 protein detection.
For determination of mature (mSREBP1) protein, BME-UV cells were seeded on
100-mm cell culture dishes. Cells were harvested and processed as previously
described by DeBose-Boyd and coworkers (1999) with the following modifications.
36
Briefly, cells were harvested in media from two dishes, and centrifuged at 250 × g for 5
min at 4°C. The supernatant was removed and cells were washed with ice-cold
phosphate buffered saline and centrifuged at 250 × g for 5 min at 4°C. The cell pellet
was resuspended in 0.6 ml of buffer A (10 mM HEPES-KOH at pH 7.6, 10 mM KCl, 1.5
mM MgCl2, 1 mM sodium EDTA, 250 mM sucrose, and protease inhibitor cocktail),
passed through a 25-gauge needle 25 times, and centrifuged at 1,000 × g for 5 min at
4°C. The resulting pellet was resuspended in 0.1 ml of buffer B (20 mM HEPES-KOH at
pH 7.6, 2.5% (v/v) glycerol, 0.42 M NaCl, 1.5 mM MgCl2, 1 mM sodium EDTA, and
protease inhibitor cocktail), rocked at 4°C for 1 hr, and centrifuged at 100,000 × g for 15
min at 4°C. The supernatant from this centrifugation was designated the nuclear
extract.
Immunoblotting
Cell fractionation supernatants were assayed for protein concentration using the
Bradford assay (Bio-Rad; Hercules, CA). To ensure equal loading, samples were
diluted to the same protein concentrations with Laemmli sample buffer (Bio-Rad;
Hercules, CA) and heated at 95°C for 7 min. Acetyl-CoA carboxylase-α and SREBP1
were separated by electrophoresis using 7.5% or 12% polyarcylamide gels (Cambrex
Corporation, East Rutherford, NJ), respectively. Proteins were transferred to a PVDF
membrane using a Bio-Rad trans-blot SD semi-dry transfer cell (Bio-Rad; Hercules,
CA). Membranes were blocked in blocking buffer (0.05 M Tris pH 7.4, 0.2 M NaCl,
0.1% Tween and 5% dried nonfat milk) on a rocker. In blocking buffer, primary anti-
ACC antibody (Cell Signaling Technology; Beverly, MA) or anti-SREBP1 antibody
37
(Santa Cruz Biotechnology, Santa Cruz, CA) were applied at 1:1000 or 1:750,
respectively. Membranes were then washed in blocking buffer. Following wash,
membranes were incubated with horseradish peroxidase-conjugated goat anti-rabbit
(1:2000) or anti-mouse antibodies (1:1500; Santa Cruz Biotechnology, Santa Cruz, CA)
in blocking buffer for ACC and SREBP1 detection, respectively. Proteins were detected
using ECL-Plus chemiluminescence substrate (Amersham Biosciences; Pittsburg, PA)
according to manufacturer’s instructions. Chemiluminescence was measured using a
Chemidoc XRS digital imaging system and densitometry was quantified using Quantity
One software (Bio-Rad; Hercules, CA).
Statistical analysis
Data are reported as least squares means ± SEM unless otherwise noted. All
data were analyzed using the Mixed procedure of SAS (SAS for Windows Version 9.1,
SAS Institute Inc., Cary, NC). When analyzing the abundance of mSREBP1 in BME-
UV, the model included the fixed effects of treatment and set. For analysis of all other
data, the model included the fixed effects of treatment, set, and treatment by set
interaction. Replicate within set was the random effect. Treatments included the
presence the presence of fatty acids. One set represents one independent experiment.
If a significant treatment effect was observed, Tukey’s multiple comparison procedure
was used to separate treatment means. Real-time PCR data were analyzed using
original ΔCt values normalized with β-actin as the endogenous control gene. For the
purpose of presentation, least squares means are illustrated as fold change (2-ΔΔCt)
relative to control.
38
RESULTS
In the bovine mammary gland, fatty acids can regulate milk fat synthesis by
controlling the transcription of lipogenic genes. It has been well documented that the
inhibition of milk fat synthesis in the lactating dairy cow is caused by various isomers of
CLA including trans-10, cis-12. In support of in vivo data, we observed significant
reductions in the incorporation of acetate into lipid in response to trans-10, cis-12 CLA
treatment in MAC-T (Figure 3.1); however, we observed similar reductions in response
to LA and cis-9, trans-11CLA (Figure 3.1). We examined another bovine mammary
epithelial cell line for its response to polyunsaturated fatty acids. Incubation of BME-UV
cells with 50 µM LA, cis-9, trans-11 CLA, or trans-10, cis-12 CLA significantly reduced
the incorporation of acetate into fatty acids (Figure 3.2).
We next focused on the mechanism of polyunsaturated fatty acid regulation of
fatty acid synthesis. Acetyl-CoA carboxylase-α and FAS are two lipogenic enzymes
required for de novo fatty acid synthesis in the bovine mammary epithelial cell. The
mRNA expression of ACCα was unaffected by LA, cis-9, trans-11 CLA, or trans-10, cis-
12 CLA (Figure 3.3); however, polyunsaturated fatty acid treatment significantly
decreased ACCα protein abundance (Figure 3.4). Treatment of BME-UV with LA or
trans-10, cis-12 CLA decreased the mRNA expression of FAS (Figure 3.3); however,
the mRNA expression of FAS was unaffected by cis-9, trans-11 CLA (Figure 3.3).
In the bovine mammary gland, SREBP1 is considered the predominant
transcriptional regulator of lipid synthesis. Sterol regulatory element binding protein-1
regulates the transcription of various lipogenic enzymes including ACCα and FAS. In
the present study, treatment of BME-UV with LA or trans-10, cis-12 CLA significantly
39
Figure 3.1. Effect of treating bovine mammary epithelial cells (MAC-T) with 50 µM
linoleic acid (LA), cis-9, trans-11 conjugated LA (9,11 CLA), trans-10, cis-12 CLA (10,12
CLA), or in the absence of fatty acid (No FA; control) for 24 h on de novo fatty acid
synthesis. Error bars represent SEM for two independent experiments with three
replicates per experiment. Treatment differences are signified by differing superscripts,
P < 0.0001.
0
25
50
75
No FA LA 9,11 CLA 10,12 CLA
Aceta
te I
nco
rpo
rate
d
(pm
ol/
µg
deo
xyri
bo
nu
cle
icacid
)
b
c
a c
b
d
a
40
Figure 3.2. Effect of treating bovine mammary epithelial cells (BME-UV) with 50 µM
linoleic acid (LA), cis-9, trans-11 conjugated LA (9,11 CLA), or trans-10, cis-12 CLA
(10,12 CLA), or in the absence of fatty acid (No FA; control) for 24 h on de novo fatty
acid synthesis. Error bars represent SEM for two independent experiments with three
replicates per experiment. Treatment differences are signified by differing superscripts,
P < 0.0001.
0
5
10
15
20
25
30
35
No FA LA 9,11 CLA 10,12 CLA
Aceta
te I
nco
rpo
rate
d
(pm
ol/
µg
deo
xyri
bo
nu
cle
icacid
)
b b
c
a
41
Figure 3.3. Effect of treating bovine mammary epithelial cells (BME-UV) with 50 µM
linoleic acid (LA), cis-9, trans-11 conjugated LA (9,11 CLA), trans-10, cis-12 CLA (10,12
CLA), or in the absence of fatty acid (No FA; control) for 24 h on lipogenic gene
expression. Lipogenic genes evaluated were (A) acetyl-CoA carboxylase-α (ACCα) and
(B) fatty acid synthase (FAS). Data is illustrated as least squares means and
represents two independent experiments with three replicates per experiment.
Differences in ΔCt values for treatments are signified by differing superscripts within
transcript, P < 0.05.
0.0
0.5
1.0
1.5
No FA LA 9,11 CLA 10,12 CLA
Fo
ldch
an
ge (
2-ΔΔ
Ct )
A
0.0
0.5
1.0
1.5
No FA LA 9,11 CLA 10,12 CLA
Fo
ldch
an
ge (
2-ΔΔ
Ct )
B
a
ac
b bc
42
Figure 3.4. Effect of treating bovine mammary epithelial cells (BME-UV) with 50 µM
linoleic acid (LA), cis-9, trans-11 conjugated LA (9,11 CLA), trans-10, cis-12 CLA, or in
the absence of fatty acid (No FA; control) for 24 h on acetyl-CoA carboxylase-α (ACCα)
protein abundance. Error bars represent SEM for two independent experiments with
three replicates per experiment. Treatment differences within transcript are signified by
differing superscripts, P < 0.10.
0
100
200
300
400
500
600
700
No FA LA 9,11 CLA 10,12 CLA
ACCα
Net
Inte
nsit
y
No FA LA 9,11 CLA 10,12 CLA
a
b b b
43
decreased the mRNA expression of SREBP1 (Figure 3.5); however, the mRNA
expression of SREBP1 was unaffected by cis-9, trans-11 CLA (Figure 3.5). In addition,
treatment of BME-UV with LA, cis-9, trans-11 CLA, or trans-10, cis-12 CLA resulted in
the reduction of pSREBP1 and mSREBP1 protein abundance (Figure 3.6). Peroxisome
proliferator-activated receptor-γ and LXRα are two other lipogenic transcription factors
expressed in the mammary gland. The mRNA expression of PPARγ was unaffected by
polyunsaturated fatty acid treatment (Figure 3.5). The mRNA expression of LXRα
increased in response to treating BME-UV with trans-10, cis-12 CLA (Figure 3.5).
However, treatment of BME-UV with either LA or cis-9, trans-11 CLA failed to affect the
mRNA expression of LXRα (Figure 3.5).
DISCUSSION
The inhibitory effects of trans-10, cis-12 CLA on milk fat production and lipogenic
gene expression in the bovine mammary gland have been well established (Baumgard
et al., 2002; Harvatine and Bauman, 2006). Abomasal infusions of trans-10, cis-12 CLA
have resulted in ~40-50% reductions in lipogenic enzyme mRNA expression including
ACC, FAS, glycerol-3-phosphate acyltransferase, and lipoprotein lipase (Baumgard et
al., 2002). Sterol regulatory element binding protein-1 is a known regulator of these
enzymes (Lopez et al., 1996; Magana and Osborne, 1996); therefore, it has been
proposed that SREBP1 may be responsible for regulating their expression in response
to trans-10, cis-12 CLA (Peterson et al., 2004; Harvatine et al., 2009). In support of this
hypothesis, the mRNA expression of SREBP1 is significantly decreased in response to
trans-10, cis-12 CLA treatment in lactating cows (Harvatine and Bauman, 2006).
44
Figure 3.5. Effect of treating bovine mammary epithelial cells (BME-UV) with 50 µM
linoleic acid (LA), cis-9, trans-11 conjugated LA (9,11 CLA), trans-10, cis-12 CLA (10,12
CLA), or in the absence of fatty acid (No FA; control) for 24 h on lipogenic transcription
factor gene expression. Genes involved in the transcriptional regulation of lipogenic
enzymes included (A) peroxisome proliferator-activated receptor-γ (PPARγ), (B) liver X
receptor-α (LXRα), and (C) sterol regulatory element binding protein-1 (SREBP1). Data
is illustrated as least squares means and represents two independent experiments with
three replicates per experiment. Differences in ΔCt values for treatments are signified
by differing superscripts within transcript, P < 0.01.
0.0
0.5
1.0
1.5
No FA LA 9,11 CLA 10,12 CLA
Fo
ldch
an
ge (
2-ΔΔ
Ct )
A
0.0
0.5
1.0
1.5
No FA LA 9,11 CLA 10,12 CLA
Fo
ldch
an
ge (
2-ΔΔ
Ct )
B
C
0.0
0.5
1.0
1.5
No FA LA 9,11 CLA 10,12 CLA
Fo
ldch
an
ge (
2-ΔΔ
Ct )
aa a
b
a
b
acc
45
Figure 3.6. Effect of treating bovine mammary epithelial cells (BME-UV) with 50 µM
linoleic acid (LA), cis-9, trans-11 conjugated LA (9,11 CLA), trans-10, cis-12 CLA, or in
the absence of fatty acid (No FA; control) for 24 h on premature sterol regulatory
element binding protein-1 (pSREBP1) and mature sterol regulatory element binding
protein-1 (mSREBP1) protein abundance. (A) Effects of treatment on pSREBP1 protein
abundance. (B) Effects of treatment on mSREBP1 protein abundance. For pSREBP1,
error bars represent SEM for two independent experiments with three replicates per
experiment. For mSREBP1, error bars represent SEM for two independent
experiments. Treatment differences within either pSREBP1 or mSREBP1 are signified
by differing superscripts, P < 0.05.
46
In dairy cows, the ability of specific CLA isomers to inhibit milk fat synthesis
seems to be unique to these polyunsaturated fatty acids. Saturated fatty acids have
been shown to have no effect on milk fat production (Drackley et al., 1992; Bremmer et
al., 1998). Oleic acid, a monounsaturated fatty acid, fails to inhibit milk fat synthesis
(Gaynor et al., 1994; Lacount et al., 1994). In addition, LA alone fails to inhibit milk fat
production in the absence of CLAs (Loor and Herbein, 1998). In the present study, we
established that 50 µM LA, cis-9, trans-11 CLA, or trans-10, cis-12 CLA reduced de
novo fatty acid synthesis in the BME-UV and MAC-T bovine mammary epithelial cell
lines. We also observed similar decreases in de novo fatty acid synthesis in response
to stearic acid, a saturated fatty acid, and oleic acid (data not shown). In support,
Hansen and Knudsen (1987) observed, in vitro, that the effect of oleic acid addition on
the synthesis and esterification of short- and medium-chain fatty acids was strongly
inhibitory. Recently, treatment of MAC-T with 75 µM trans-10, cis-12 CLA resulted in a
50% reduction in the incorporation of radiolabeled acetate (Peterson et al., 2004).
Incubating BME-UV with polyunsaturated fatty acids inhibits de novo fatty acid
synthesis by modifying lipogenic gene expression. In response to the inhibitory effect of
polyunsaturated fatty acids in BME-UV, we observed a reduction in FAS mRNA
expression and ACCα protein abundance. Abomasal infusions of trans-10, cis-12 CLA
have resulted in ~40-50% reductions in ACC and FAS mRNA expression (Baumgard et
al., 2002). Liver X receptor-α, PPARγ, and SREBP1 are known regulators of lipogenic
gene expression in the mammary gland. In BME-UV, treatment with polyunsaturated
fatty acids did not modify the expression of LXRα. In addition, the mRNA expression of
PPARγ was not modified by LA or cis-9, trans-11 CLA; however, treatment with trans-
47
10, cis-12 CLA increased PPARγ mRNA expression. Harvatine and Bauman (2007)
observed that the expression of LXRα and PPARγ was not modified by intravenous
infusion of trans-10, cis-12 CLA. Whether or not treatment with trans-10, cis-12 CLA
modifies the activity of these nuclear receptors has yet to be determined. Contrary to
LXRα and PPARγ, SREBP1 is considered to be the primary regulator of milk fat
synthesis in response to trans-10, cis-12 CLA (Peterson et al., 2004; Harvatine et al.,
2009). Incubation of BME-UV with 50 µM LA or trans-10, cis-12 CLA decreased
SREBP1 mRNA expression in addition to the abundance of pSREBP1 and mSREBP1.
Treatment of BME-UV cells with 50 µM cis-9, trans-11 CLA was also able to inhibit the
abundance of pSREBP1 and mSREBP1. Harvatine and Bauman (2006) also observed
a decrease in SREBP1 mRNA expression in response to trans-10, cis-12 CLA
treatment in lactating dairy cows. Contrary to Harvatine and Bauman (2006), Peterson
and coworkers (2004) observed no significant difference in the mRNA expression of
SREBP1 between cis-9, trans-11 CLA and trans-10, cis-12 CLA treatments compared
to a BSA control. When comparing cis-9, trans-11 CLA and trans-10, cis-12 CLA, trans-
10, cis-12 CLA increased pSREBP1 protein and decreased mSREBP1 compared to cis-
9, trans-11 CLA (Peterson et al., 2004).
Understanding the mechanisms responsible for the differences observed in vitro
compared to in vivo data is difficult. Keating and coworkers (2008) treated MAC-T with
increasing concentrations of either cis-9, trans-11 CLA or trans-10, cis-12 CLA. They
observed a reduction in cell number and a 2-fold increase in induction of apoptosis at
concentrations of 35 µM and above. To rule out cell death as a plausible explanation
for our observed decrease in de novo fatty acid synthesis in response to fatty acids, we
48
measured cell viability using trypan blue dye exclusion. Culture viability was estimated
at approximately 97% in response to treating BME-UV with stearic acid, oleic acid, LA,
cis-9, trans-11 CLA, or trans-10, cis-12 CLA (data not shown). Bauman and Davis
(1974) discussed the possibility that the suppression of de novo fatty acid synthesis
observed in vitro is due to the detergent properties of long-chain fatty acids. However,
Wright and coworkers (2002) concluded that the inhibitory effect of palmitic acid on fatty
acid synthesis in bovine mammary tissue was not the result of a detergent effect.
Finally, Jayan and Herbein (2000) propose that long-chain unsaturated fatty acids may
influence cell membrane fluidity. Fatty acids provided in the media of cultured
mammary epithelial cells are primarily incorporated into cell membrane phospholipids
(Baughman, 1995). The amount of saturated and unsaturated fatty acids, as well as the
chain length of fatty acids, determines membrane fluidity. Short- and medium-chain
saturated fatty acids and long-chain unsaturated fatty acids enhance cell membrane
fluidity. Jayan and Herbein (2000) suggest that the presence of long-chain unsaturated
fatty acids inhibits the synthesis of short- and medium-chain saturated fatty acids in
order to maintain membrane fluidity. In the present study, it is possible that the
presence of polyunsaturated fatty acids inhibited de novo fatty acid synthesis in order to
maintain membrane fluidity.
In the present study, we demonstrated that the BME-UV bovine mammary
epithelial cell line expresses SREBP1 and that reductions in de novo fatty acid synthesis
by polyunsaturated fatty acids results in the downregulation of SREBP1 and SREBP1
target genes. Preliminary evidence also suggests no difference between the BME-UV
and MAC-T bovine mammary epithelial cell lines in response to fatty acids varying in
49
degree of saturation. Further research is needed to better understand the molecular
mechanisms responsible for controlling fatty acid synthesis in vitro and in vivo.
50
CHAPTER 4
Activation of Liver X Receptor Enhances de novo Fatty Acid Synthesis in Bovine Mammary Epithelial Cells
INTRODUCTION
Liver X receptors (LXR) are nuclear receptors that can regulate the synthesis of
lipid and control cholesterol homeostasis upon activation by oxysterols or synthetic
agonists (Lehmann et al., 1997; Schultz et al., 2000). Liver X receptor-α and LXRβ are
two known isoforms (Song et al., 1994; Willy et al., 1995) and both regulate the
transcription of lipogenic enzymes by binding to DNA in a heterodimeric complex with
retinoid X receptor (RXR; Willy et al., 1995). Mice carrying a mutated LXRα gene have
decreased expression of acetyl-CoA carboxylase (ACC), fatty acid synthase (FAS), and
sterol regulatory element binding protein-1 (SREBP1), cellular proteins with significant
roles in the synthesis of fatty acids (Peet et al., 1998b).
Sterol regulatory element binding protein-1 is a membrane-bound transcription
factor that directly regulates the synthesis and uptake of cholesterol and fatty acids (see
review by Brown and Goldstein (1997)). The promoters of the lipogenic enzymes ACC,
FAS, and glycerol-3-phosphate acyltransferase (GPAT) all contain a sterol response
element (SRE) capable of binding SREBP1 (Lopez et al., 1996; Magana and Osborne,
1996; Ericsson et al., 1997). Interestingly, the promoter of SREBP1c contains a liver X
response element (LXRE) for LXRα and LXRβ suggesting the potential for
transcriptional regulation of SREBP1c by LXRs (Yoshikawa et al., 2001).
Sterol regulatory element binding protein-1 is responsive to LXR activation. In rat
hepatoma cells, transcription of SREBP1c was stimulated by oxysterols that activate
LXRα and LXRβ (DeBose-Boyd et al., 2001). Incubation of human preadipocytes with
51
T0901317 (T09), a LXR agonist, increased ACC, FAS, and SREBP1c mRNA
expression (Darimont et al., 2006). In addition, activation of LXR by T09 resulted in
increased relative amounts of hepatic SREBP1, ACC, FAS, and GPAT mRNA and this
effect was markedly reduced in SREBP1c knockout mice indicating an essential role of
SREBP1c in the LXR response (Liang et al., 2002). In addition to LXR indirectly
promoting the transcription of ACC and FAS by increasing the expression of SREBP1c,
LXR can regulate the transcription of ACC and FAS by binding to a LXRE found within
the promoter region of these lipogenic genes (Joseph et al., 2002; Talukdar and
Hillgartner, 2006). In SREPB1c knockout mice, Liang and coworkers (2002) still
observed an increase in ACC and FAS mRNA expression in response to T09
suggesting a direct effect on ACC and FAS mRNA expression by LXR.
Sterol regulatory element binding protein-1 is one of the primary regulators of
mammary lipid synthesis during diet-induced milk fat depression and treatment with
conjugated linoleic acid (CLA; Harvatine and Bauman, 2006); however, the role of LXR
in mammary lipid synthesis is unknown. In dairy cows, LXRα, but not LXRβ expression
is increased during lactation compared to nonlactating mammary tissue (Harvatine and
Bauman, 2007). In addition, Farke and coworkers (2008) have identified the presence
of LXRα in bovine mammary tissue, but did not elucidate its role in lipid metabolism.
Therefore, our objective was to evaluate the effect of LXR activation on de novo fatty
acid synthesis in bovine mammary epithelial cells.
52
MATERIALS AND METHODS
Cell culture and treatments
In vitro experiments utilized BME-UV bovine mammary epithelial cells (Zavizion
et al., 1996). Throughout the duration of the experiments, cells were cultured at 37°C in
5% CO2, and the medium was changed every 24 h. All cells were seeded on plastic cell
culture plates at a density of 5 × 105 cells/cm2. Cells were grown in basal medium
(Dulbecco’s Modified Eagle’s Medium with 10 kU/ml penicillin, 10 mg/ml streptomycin,
and 25 µg/ml amphotericin B) supplemented with 10% fetal bovine serum. Once cells
reached confluency (approximately 72 h post seeding), serum was removed and
hormones (0.1 μg/mL insulin and 1.5 μg/mL prolactin; Sigma Chemical Co., St. Louis,
MO) were added to the basal media. Cells were cultured in basal media with hormones
for 24 h and then treatments were applied.
Cells were treated with T09 (2 µM; Sigma Chemical Co., St. Louis, MO) for 8
(acute) or 24 h (chronic). In a separate experiment, cells were treated with T09 (2 µM)
with or without 10 µM geranylgeranyl pyrophosphate (GGPP; Sigma Chemical Co., St.
Louis, MO) for 24 h. Dimethyl sulfoxide (DMSO; Sigma Chemicals Co., St. Louis, MO)
served as control when evaluating the effects of T09 or GGPP. Cells were treated with
no more than 0.4% DMSO.
When evaluating the effects of fatty acids in combination with T09 on de novo
fatty acid synthesis, cells were treated with fatty acids and T09 for 24 and 8 h,
respectively. Fatty acids included linoleic acid (LA), cis-9, trans-11 CLA, or trans-10,
cis-12 CLA (Nu-Chek Prep, Inc., Elysian, MN, Matreya, LLC, Pleasant Gap, PA). All
fatty acids were complexed with fatty acid free bovine serum albumin (BSA; Sigma
53
Chemicals Co., St. Louis, MO; 1:3 molar ratio of BSA:fatty acid). Fatty acids were
bound to BSA according to Ip and coworkers (1999) with the following modifications.
Pure fatty acid was incubated with preheated sodium hydroxide (70°C) in a 1:1 molar
ratio and vortexed periodically, until clear. Sodium salts were diluted in warm (37°C)
basal medium with hormones in a 3:1 molar ratio with BSA. Complexes in media were
filtered using a 0.22 µm syringe filter prior to utilization. Bovine serum albumin served
as control when evaluating the effects of fatty acids.
Fatty acid synthesis assay
De novo fatty acid synthesis was determined by quantifying the incorporation of
[1-14C]-labeled acetate into lipid. Methods were adapted from Peterson and coworkers
(2004) and modified as described. After 8 or 24 h of treatment, cells cultured in 12-well
culture plates, were incubated with 14C-labeled acetate (MP Biomedicals, Solon, OH) for
a period of 4 h. During this 4 h period, cells were cultured in 3 mM acetate (0.37
µCi/µmol). Following 4 h incubation with [1-14C]-labeled acetate, cells were lysed in
wells with sodium dodecyl sulfate buffer (0.1% in phosphate buffered saline). Lipid
within the lysate was then extracted using hexane:isopropanol (3:2). The solvent layer
was combined with 16 mL of scintillation cocktail (Scintisafe 30% Cocktail; Fisher
Scientific, Pittsburgh, PA) for quantification of label incorporation into lipid using a LS
6000LL Beckmann scintillation counter. Activity was calculated and expressed as pmol
of acetate incorporated per µg of DNA.
54
Real time PCR
Following either acute or chronic treatment with T09, cells were lysed in 6-well
culture plates using 1 mL of TRI Reagent (Molecular Research Center Inc.; Cincinnati,
OH) per well. Total RNA was isolated according to manufacturer’s instructions. RNA
pellets were resuspended in RNase-free water, and quantified at 260 nm using a
spectrophotometer. Total RNA was reverse transcribed (500 ng per reaction) into
cDNA using the Omniscript reverse transcription kit (Qiagen; Valencia, CA) according to
manufacturer’s instructions using oligo(dT) (Roche Applied Science; Indianapolis, IN) as
the primer.
Real-time PCR reactions were performed using the Quantitect SYBR Green PCR
kit (Qiagen; Valencia, CA) and an Applied Biosystems 7300 Real-time PCR machine
(Applied Biosystems; Foster City, CA). Quantification of gene transcripts FAS, LXRα,
SREBP1, insulin-induced gene-1 (INSIG1), insulin-induced gene-2 (INSIG2), ATP-
binding cassette transporter-G1 (ABCG1), and cytochrome P4501A1 (Cyp1A1) was
completed using gene-specific primers (Table 4.1). β-actin was used as the
endogenous control gene. Fold change was calculated using the 2−ΔΔCt method (Livak
and Schmittgen, 2001). Reaction conditions were as follows: 1 cycle at 95°C for 10
min followed by 40 cycles at 95°C for 30 s, 58°C for 30 s, and 72°C for 1 min. Each
reaction was performed in duplicate wells.
DNA quantification
Cells were harvested in DNA assay buffer (Tris Base, EDTA, NaCl; pH 7.4) then
sonicated (2 × 5 s) on ice. Deoxyribonucleic acid concentration of cell lysates was
55
Table 4.1. Primer sequences used to detect FAS, LXRα, SREBP1, INSIG1,
INSIG2, ABCG1, Cyp1A1, and β-actin mRNA1.
Target Gene
Forward Primer (5'-3') Reverse Primer (3'-5') Product Size (bp)
FAS AATGACCACTTTGCCGATGT TGAAGGACGGTGTACCACAA 152
LXRα TCAACCCCATCTTCGAGTTC ACGACTACTTTGACCACTCG 232
SREBP12 ATGCCATCGAGAAACGCTAC CTCTTGGACTCAGACGCCTG 180
INSIG1 GTCATCGCCACCATCTTCTC AGTGGAACCTCTCGGTGTGTT 115
INSIG2 TCCAGTGTGATGCGGTGTGTA AGTGTGACCGACGTGATAGTT 108
ABCG1 GACTCGGTCCTCACGCAC CGGAGAAACACGCTCATCTC 231
Cyp1A1 CCGACCTCTACAGCTTCACC CTTGGCCTCCTTGTTCACAT 185
β-actin CTCTTCCAGCCTTCCTTCCT CGTCTTTCTCTAGTGACGGG 178 1FAS, fatty acid synthase; LXRα, liver X receptor-α; SREBP1, sterol regulatory element binding protein-1; INSIG1, insulin induced gene-1; INSIG2, insulin-induced gene-2; ABCG1, ATP-binding cassette transporter-G1; and Cyp1A1, cytochrome P4501A1. 2Primer pairs do not distinguish between SREBP1a and SREBP1c isoforms.
56
assayed as described by Labarca and Paigen (1980) with the following modifications.
Briefly, 2 μL of cell lysate were placed into a cuvette followed by 1998 μL of DNA assay
buffer to yield a total assay volume of 2 mL. Samples were measured in triplicate using
a DyNA Quant 200 fluoremeter (Hoefer Pharmacia Biotech; San Francisco, CA). Calf
thymus DNA (Sigma Chemical Co.; St. Louis, MO) was used as a standard.
Cellular fractionation
For determination of premature and mature SREBP1 (pSREBP1 and mSREBP1,
respectively) proteins, BME-UV cells were seeded on 100 mm cell culture dishes. Cells
were harvested and processed as previously described by DeBose-Boyd and coworkers
(1999) with the following modifications. Briefly, cells were harvested in media from two
dishes, and centrifuged at 250 × g for 5 min at 4°C. The supernatant was removed and
cells were washed with ice-cold phosphate buffered saline and centrifuged at 250 × g
for 5 min at 4°C. The cell pellet was resuspended in 0.6 ml of buffer A (10 mM HEPES-
KOH at pH 7.6, 10 mM KCl, 1.5 mM MgCl2, 1 mM sodium EDTA, 250 mM sucrose, and
protease inhibitor cocktail), passed through a 25-gauge needle 25 times, and
centrifuged at 1,000 × g for 5 min at 4°C. The resulting pellet was resuspended in 0.1
ml of buffer B (20 mM HEPES-KOH at pH 7.6, 2.5% (v/v) glycerol, 0.42 M NaCl, 1.5 mM
MgCl2, 1 mM sodium EDTA, and protease inhibitor cocktail), rocked at 4°C for 1 hr, and
centrifuged at 100,000 × g for 15 min at 4°C. The supernatant from this centrifugation
was designated the nuclear extract. The supernatant from the original 1,000 × g spin
was used to prepare the membrane fraction by centrifugation at 10,000 × g for 15 min at
4°C. The resulting membrane pellets were resuspended in 0.1 ml of ice-cold lysis buffer
57
(50 mM Tris pH 7.4, 0.5% Triton X-100, 0.3 M NaCl, 2 mM EDTA, and protease inhibitor
cocktail).
Immunoblotting
Cell fractionation supernatants were assayed for protein concentration using the
Bradford assay (Bio-Rad; Hercules, CA). To ensure equal loading, samples were
diluted to the same protein concentrations with Laemmli sample buffer (Bio-Rad;
Hercules, CA) and heated at 95°C for 7 min. Premature and mature SREBP1 proteins
were separated by electrophoresis using 12% polyarcylamide gels (Cambrex
Corporation, East Rutherford, NJ). Proteins were transferred to a PVDF membrane
using a Bio-Rad trans-blot SD semi-dry transfer cell (Bio-Rad; Hercules, CA).
Membranes were blocked in blocking buffer (0.05 M Tris pH 7.4, 0.2 M NaCl, 0.1%
Tween and 5% dried nonfat milk) on a rocker. Primary anti-SREBP1 antibody (Santa
Cruz Biotechnology, Santa Cruz, CA) was applied at 1:750 in blocking buffer.
Membranes were then washed in blocking buffer. Following wash, membranes were
incubated with horseradish peroxidase-conjugated goat anti-mouse antibody (Santa
Cruz Biotechnology, Santa Cruz, CA) in blocking buffer at 1:1500. Proteins were
detected using ECL-Plus chemiluminescence substrate (Amersham Biosciences;
Pittsburg, PA) according to manufacturer’s instructions. Chemiluminescence was
measured using a Chemidoc XRS digital imaging system and densitometry was
quantified using Quantity One software (Bio-Rad; Hercules, CA).
58
Statistical analysis
Data are reported as least squares means ± SEM unless otherwise noted. All
data were analyzed using the Mixed procedure of SAS (SAS for Windows Version 9.1,
SAS Institute Inc., Cary, NC). When analyzing the abundance of pSREBP1 or
mSREBP1 in BME-UV, the model included the fixed effects of treatment and set. For
analysis of all other data, the model included the fixed effects of treatment, set, and
treatment by set interaction. Replicate within set was the random effect. Treatments
include the presence of T09, GGPP, and the presence of fatty acids. One set
represents one independent experiment. If a significant treatment effect was observed,
Tukey’s multiple comparison procedure was used to separate treatment means. Real-
time PCR data were analyzed using original ΔCt values normalized with β-actin as the
endogenous control gene. For the purpose of presentation, least squares means are
illustrated as fold change (2-ΔΔCt) relative to control.
RESULTS
Liver X receptor is a nuclear receptor capable of regulating the synthesis of fatty
acids. The LXR agonist, T09, is used to activate LXR without modifying the expression
of LXR (Houck et al., 2004). Comparable to published data, the mRNA expression of
LXRα was unaffected by chronic treatment with T09 (Figure 4.1). The mRNA
expression of several LXR target genes can be evaluated to assess the efficacy of T09
in activating LXR. Acute and chronic treatment of BME-UV with T09 dramatically
increased the mRNA expression of ABCG1; however, expression of Cyp1A1 remained
unaffected (Figure 4.1).
59
Figure 4.1. Effect of treating bovine mammary epithelial cells (BME-UV) with or without
T09 (2 μM) for 8 (acute) or 24 h (chronic) on liver X receptor-α (LXRα) target gene
expression. (A) Acute and (B) chronic effects of T09 on gene expression. Genes
evaluated were liver X receptor-α (LXRα), ATP-binding cassette transporter-G1
(ABCG1), and cytochrome P4501A1 (Cyp1A1). Solid and open bars represent control
and T09 treatments, respectively. Data is illustrated as least squares means and
represents two independent experiments with three replicates per experiment. An
asterisk indicates a significant difference in ΔCt from control, P < 0.0001.
*
0
5
10
15
20
LXRα ABCG1 Cyp1A1
Fo
ld C
han
ge (
2-ΔΔ
Ct )
A
*
0
20
40
60
LXRα ABCG1 Cyp1A1
Fo
ld C
han
ge (
2-ΔΔ
Ct )
B
60
Acute treatment of BME-UV with T09 significantly increased the incorporation of
acetate into lipid (Figure 4.2). Similarly, chronic treatment of BME-UV with T09 for 24 h
significantly increased acetate incorporation (Figure 4.3). Geranylgeranyl
pyrophosphate, a LXR antagonist, inhibits the transcription of LXR target genes (Gan et
al., 2001). Incubation of BME-UV with GGPP failed to reverse the T09 induced
increase in acetate incorporation into fatty acids (Figure 4.3). Surprisingly, GGPP
significantly increased de novo fatty acid synthesis in BME-UV when incubated alone or
in combination with T09 (Figure 4.3).
Liver X receptor can regulate the transcription of lipogenic genes. In the present
study, acute treatment of BME-UV with T09 significantly increased the mRNA
expression of FAS and SREBP1 (Figure 4.4). However, the mRNA expression of
INSIG1 and INSIG2 was unaffected by acute treatment of T09 (Figure 4.4). Compared
to the acute treatment of BME-UV with T09, chronic treatment resulted in a greater
increase in the mRNA expression of FAS and SREBP1 (Figure 4.4). Interestingly, the
mRNA expression of INSIG1, a SREBP1 regulatory protein, was also enhanced in
response to chronic T09 (Figure 4.4). The mRNA expression of INSIG2 was unaffected
by chronic treatment with T09 (Figure 4.4).
Sterol regulatory element binding protein-1 is responsive to LXR activation.
Acute incubation of BME-UV with T09 significantly increased the premature and mature
forms of SREBP1 (Figure 4.5). In vivo and in vitro, trans-10, cis-12 CLA-induced
decreases in de novo fatty acid synthesis are often in response to a decrease in
SREBP1 protein abundance. In addition, fatty acids varying in degree of saturation
inhibit fatty acid synthesis in cell culture. Incubation of BME-UV with T09 failed to
61
Figure 4.2. Effect of treating bovine mammary epithelial cells (BME-UV) with or without
T09 (2 μM) for 8 h on de novo fatty acid synthesis. Error bars represent SEM for two
independent experiments with three replicates per experiment. An asterisk indicates a
significant difference from control, P < 0.0001.
0
5
10
15
20
25
30
35
Control T09
Aceta
te I
nco
rpo
rate
d
(pm
ol/
µg
deo
xyri
bo
nu
cle
icacid
)
*
62
Figure 4.3. Effect of treating bovine mammary epithelial cells (BME-UV) with T09 (2
µM), GGPP (10 µM), or both for 24 h on de novo fatty acid synthesis. Control
represents the absence of T09 and GGPP. Error bars represent SEM for two
independent experiments with three replicates per experiment. Treatment differences
are signified by differing superscripts, P < 0.0001.
0
100
200
300
Control T09 GGPP T09 + GGPP
Aceta
te I
nco
rpo
rate
d
(pm
ol/
µg
deo
xyri
bo
nu
cle
icacid
)
bb
c
a
Aceta
te I
nco
rpo
rate
d
(pm
ol/
µg
deo
xyri
bo
nu
cle
icacid
)
*
63
Figure 4.4. Effect of treating bovine mammary epithelial cells (BME-UV) with or without
T09 (2 μM) for 8 (acute) or 24 h (chronic) on gene expression. (A) Acute and (B)
chronic effects of T09 on lipogenic gene expression. Lipogenic genes evaluated were
fatty acid synthase (FAS), sterol regulatory element binding protein-1 (SREBP1),
insulin-induced gene-1 (INSIG1), and insulin-induced gene-2 (INSIG2). Solid and open
bars represent control and T09 treatments, respectively. Data is illustrated as least
squares means and represents two independent experiments with three replicates per
experiment. An asterisk indicates a significant difference in ΔCt from control, P < 0.001.
*
0
5
10
15
20
LXRα ABCG1 Cyp1A1
A
0
1
2
3
4
5
FAS SREBP1 INSIG1 INSIG2
Fo
ld C
han
ge (
2-ΔΔ
Ct )
B
0
2
4
6
FAS SREBP1 INSIG1 INSIG2
Fo
ld C
han
ge (
2-ΔΔ
Ct )
Fo
ld C
han
ge (
2-ΔΔ
Ct )
A
*
*
*
**
*
Fo
ld C
han
ge (
2-ΔΔ
Ct )
B
64
Figure 4.5. Effect of treating bovine mammary epithelial cells (BME-UV) with or without
T09 (2 μM) for 8 h on premature sterol regulatory element binding protein-1 (pSREBP1)
and mature sterol regulatory element binding protein-1 (mSREBP1) protein abundance.
(A) Effects of treatment on pSREBP1 protein abundance. (B) Effects of treatment on
mSREBP1 protein abundance. Error bars represent SEM for two independent
experiments. An asterisk indicates a significant difference from control, (A) P < 0.05
and (B) P < 0.10.
0
100
200
300
Control T09
A
mSREBP1
Net
Inte
nsit
y
pSREBP1
B
0
700
1,400
Control T09
Net
Inte
nsit
y
Control T09
Control T09
*
*
65
reverse the inhibitory effect of polyunsaturated fatty acids on de novo fatty acid
synthesis (Figure 4.6).
DISCUSSION
The function of LXRs in the mammary gland is undefined. In dairy cows, LXRα,
but not LXRβ expression is increased during lactation compared to nonlactating
mammary tissue (Harvatine and Bauman, 2007). To our knowledge, the activation of
LXRα in BME-UV has not been investigated prior to this experiment.
Nuclear receptors such as LXR undergo a conformational change upon ligand
binding enhancing their activity. T0901317 is a synthetic nonsteroidal compound and a
highly potent, selective nonsteroidal LXRα ligand (Schultz et al., 2000). In addition, T09
is capable of increasing LXR activity without modifying LXR expression (Houck et al.,
2004). Similarly, LXRα mRNA expression was unaffected by acute or chronic treatment
with T09 in BME-UV. ATP-binding cassette transporter-G1 and Cyp1A1 are known
LXR target genes and are upregulated in response to T09 (Dressel et al., 2003;
Westerink and Schoonen, 2007). ATP-binding cassette transporter-G1 has been
implicated in the efflux of cholesterol to high density lipoprotein (Wang et al., 2004).
Recently, the presence of ABCG1 has been verified in the bovine mammary gland
(Farke et al., 2008). In response to acute and chronic treatment with T09, ABCG1
mRNA expression increased 11- and 43-fold, respectively. Cytochrome P4501A1 was
unresponsive to T09. We can conclude that T09 is capable of affecting the expression
of ABCG1, a primary target gene, without influencing LXRα mRNA expression therefore
66
Figure 4.6. Effect of treating bovine mammary epithelial cells (BME-UV) with T09 (2
µM) and fatty acids (50 µM) on de novo fatty acid synthesis. Cells were incubated with
T09 and fatty acids 8 and 24 h prior to addition of radio-labeled acetate, respectively.
Fatty acids included linoleic acid (LA), cis-9, trans-11 conjugated LA (9,11 CLA), or
trans-10, cis-12 CLA (10,12 CLA). Cells incubated in the absence of fatty acids (No FA)
and T09 represented the control. Error bars represent SEM for two independent
experiments with three replicates per experiment. Treatment differences are signified
by differing superscripts, P < 0.0001.
0
10
20
30
40
No FA No FA LA 9,11 CLA 10,12 CLA
Aceta
te I
nco
rpo
rate
d
(pm
ol/
µg
deo
xyri
bo
nu
cle
icacid
) b
c c
a
d
T09
67
T09 is an effective LXR agonist in BME-UV. In addition, LXR activation may serve as a
potential regulator of cholesterol homeostasis in the bovine mammary gland.
Liver X receptors regulate the synthesis of lipid including cholesterol, bile acids,
and fatty acids (see review by Edwards et al. (2002)). Liver X receptor-α is a major
sensor of dietary cholesterol and functions as an important transcriptional control point
in bile acid synthesis (Peet et al., 1998b). The ability of LXR to regulate fatty acid
synthesis has also been evaluated. Peet and coworkers (1998b) discovered that mice
carrying a targeted disruption in the LXRα gene had decreased expression of ACC,
FAS, steroyl-CoA desaturase-1, and SREBP1. Furthermore, oral administration of T09
to mice resulted in the upregulation of lipogenic enzyme expression and increased
plasma triacylglycerol levels (Schultz et al., 2000). In the present study, acute and
chronic treatment with 2 µM T09 significantly increased de novo fatty acid synthesis in
BME-UV by 38% and 60%, respectively. Treatment of BME-UV with T09
concentrations greater that 2 µM resulted in significant cell death (data not shown).
Geranylgeranyl pyrophosphate is a LXR antagonist and can decrease the transcription
of LXR target genes (Gan et al., 2001; Argmann et al., 2005). Chronic treatment of
BME-UV with GGPP failed to reverse the T09-induced increase in de novo fatty acid
synthesis.
Activation of LXR by T09 enhances the expression of SREBP1 (Repa et al.,
2000; Montanaro et al., 2007). Repa and coworkers (2000) concluded that cholesterol-
derived oxysterols activate LXR to induce expression of the mouse SREBP1c gene
through a LXRE located within its proximal promoter. In addition, the SREBP1a and
SREBP2 isoforms are unresponsive to LXR activation by T09 (Schultz et al., 2000;
68
DeBose-Boyd et al., 2001). The expression of SREBP1 has been shown to be
significantly upregulated during lactation in mice and cows and is considered the
primary regulator of milk fat synthesis (Anderson et al., 2007; Rudolph et al., 2007;
Bionaz and Loor, 2008b). In the present study, acute and chronic treatment of BME-UV
with T09 increased the mRNA expression of SREBP1 255% and 416%, respectively.
We also observed a significant increase in protein abundance for the premature and
mature forms of SREBP1. Insulin-induced gene-1 and INSIG2 are integral membrane
proteins that cause retention of SREBP1 in the endoplasmic reticulum, preventing
SREBP1 activation. In the present study, chronic treatment of BME-UV with T09
increased the mRNA expression of INSIG1. Interestingly, the INSIG1 promoter can be
regulated by transcriptionally active SREBP1 (Kast-Woelbern et al., 2004).
Overexpression of INSIG1 in the livers of transgenic mice inhibits SREBP1 processing
and reduces insulin-stimulated lipogenesis (Engelking et al., 2004). In the current
study, it is possible that INSIG1 retained a portion of pSREBP1 within the endoplasmic
reticulum.
Fatty acid synthase is a known SREBP1 target gene and an essential enzyme in
the de novo synthesis of fatty acids (Magana and Osborne, 1996; Harvatine and
Bauman, 2006). In human preadipocytes, the mRNA expression of FAS and SREBP1c
is increased in response to T09 (Darimont et al., 2006). In the present study, acute and
chronic treatment with T09 increased FAS mRNA expression by 89% and 185%,
respectively. Liver X receptors regulate fatty acid synthesis by increasing the
transcription of FAS via indirect and direct mechanisms. Enhanced expression of
SREBP1 in response to T09 most likely increased FAS expression indirectly. However,
69
Joseph and coworkers (2002) demonstrated that in addition to tandem SREBP1c sites,
the FAS promoter contains a binding site for the LXR/RXR heterodimers. Joseph and
coworkers (2002) confirmed that maximum induction of FAS requires both LXR and
SREBP1c binding to their respective response elements within the promoter region.
Therefore, it is possible that LXR activation in bovine mammary epithelial cells may
regulate FAS gene expression via indirect and direct mechanisms. Further examination
of the activation of the FAS promoter will be required to evaluate this hypothesis.
Additionally, bioinformatic examination of the promoters of other lipogenic genes in the
bovine genome may reveal liver X receptor response element (LXRE) sites that regulate
transcription. We can conclude that the dramatic increase in SREBP1 and FAS
expression most likely contributed to the significant increase in acetate incorporation in
response to acute and chronic treatment with T09.
The effects of trans-10, cis-12 CLA on lipogenic gene expression in the bovine
mammary gland have been well established (Baumgard et al., 2000; Harvatine and
Bauman, 2006). Sterol regulatory element binding protein-1 is a known regulator of milk
fat synthesis; therefore, it has been proposed that SREBP1 may be responsible for
regulating their expression in response to trans-10, cis-12 CLA (Peterson et al., 2004;
Harvatine et al., 2009). In support of this theory, the mRNA expression of SREBP1 is
significantly decreased in response to trans-10, cis-12 CLA treatment in vivo (Harvatine
and Bauman, 2006). In vitro, Peterson and coworkers (2004) observed a similar
decrease in the mRNA expression of SREBP1 in response to cis-9, trans-11 CLA and
trans-10, cis-12 CLA treatments compared to a bovine serum albumin control. In the
present study, BME-UV cells treated with LA, cis-9, trans-11 CLA, or trans-10, cis-12
70
CLA for 24 h significantly decreased acetate incorporation into fatty acids by 34%, 31%,
and 46%, respectively. Treatment of BME-UV with T09 for 8 h failed to reverse the
inhibitory effect of polyunsaturated fatty acids on de novo fatty acid synthesis. Recent
studies may suggest that polyunsaturated fatty acids suppress SREBP1c gene
expression by inhibiting LXR/RXR heterodimers binding to LXRE found within the
promoter region SREBP1c (Ou et al., 2001; Yoshikawa et al., 2002). It is possible that
the concentration of fatty acid was high enough to prevent the LXR/RXR heterodimers
from binding to the LXRE. If the concentration of fatty acid was lower, T09 may have
been able to reverse the inhibitory effect of polyunsaturated fatty acids on de novo fatty
acid synthesis. The ability of unsaturated fatty acids to accelerate SREBP1 mRNA
degradation has been documented and may explain our observed effects (Xu et al.,
2001). Activation of LXR may have upregulated the expression of SREBP1; however,
the presence of polyunsaturated fatty acid may have accelerated its degradation.
In conclusion, LXR regulates the de novo synthesis of fatty acids in BME-UV by
promoting the transcription of SREBP1 and FAS. We also propose the inhibition of de
novo fatty acid synthesis by polyunsaturated fatty acids cannot be reversed by LXR
activation. Activation of LXR by T09 may prove to be a useful tool in identifying the
relative contributions of LXRα and SREBP1 towards the overall synthesis of fatty acids
in the bovine mammary gland.
71
CHAPTER 5
Activation of AMP-Activated Protein Kinase Inhibits de novo Fatty Acid Synthesis in Bovine Mammary Epithelial Cells
INTRODUCTION
AMP-activated protein kinase (AMPK) plays an integral role in monitoring
intracellular energy status and regulating the uptake and metabolism of glucose and
fatty acids as well as the synthesis and oxidation of fatty acids, cholesterol, glycogen,
and protein to meet energy demand. AMP-activated protein kinase is activated by
increases in ATP utilization or decreases in ATP production caused by exercise,
prolonged fasting, and/or hypoxia (Stephens et al., 2002; Zou et al., 2003; Minokoshi et
al., 2004). In addition to increases in the AMP to ATP ratio, AMPK is activated by rises
in intracellular Ca2+ (Hurley et al., 2005; Woods et al., 2005). Rises in intracellular Ca2+
can be caused by inositol triphosphate produced by phospholipase C coupled to the G
protein Gq (Kishi et al., 2000).
AMP-activated protein kinase is a heterotrimeric protein composed of one
catalytic (α) and two regulatory subunits (β and γ). Each subunit has more than one
isoform derived from a specific gene; therefore, twelve possible heterotimeric
combinations may exist. The known AMPK isoforms include α1, α2, β1, β2, γ1, γ2, and
γ3 (Thornton et al., 1998; Stephens et al., 2002; Barnes et al., 2004). The AMPK
complex becomes activated when AMP binds to Bateman domains on the γ subunit
resulting in a conformational change permitting the phosphorylation of a threonine
residue (Thr-172) on the α subunit. Upstream kinases that phosphorylate the α subunit
following conformational change include serine/threonine kinase 11 (LKB1) and
Ca2+/calmodulin-dependent kinase kinase (CaMKK). Serine/threonine kinase 11 is
72
considered the major upstream AMPK kinase responsible for increasing energy supply
by sensing increases in the AMP to ATP ratio (Woods et al., 2003; Lizcano et al., 2004).
Ca2+/calmodulin-dependent kinase kinase is activated by increases in intracellular Ca2+
concentration (Hawley et al., 2005; Woods et al., 2005). Ca2+/calmodulin-dependent
kinase kinase-β, one of two known isoforms of CaMKK, directly activates AMPK in HeLa
cells (Hurley et al., 2005) as well as C2C12 myotubes (Shen et al., 2007).
The ability of AMPK to regulate lipid metabolism has multiple dimensions. 5-
aminoimidazole-4-carboxamide ribonucleoside (AICAR) activates AMPK which
phosphorylates and inactivates acetyl-CoA carboxylase (ACC; Park et al., 2002a).
Acetyl-CoA carboxylase is the rate limiting enzyme of de novo fatty acid synthesis in the
mammary gland of the lactating dairy cow (Wakil et al., 1983). Activation of AMPK has
also been shown to downregulate glycerol-3-phosphate acyltransferase (GPAT), an
enzyme necessary for triacylglycerol (TAG) synthesis (Muoio et al., 1999). Interestingly,
AMPK activation may also regulate the transcription of lipogenic transcription factors in
addition to post-translationally modifying lipogenic enzymes. Activation of AMPK by
Metformin can decrease the expression of lipogenic genes including sterol regulatory
element-binding protein-1 (SREBP1) and ACCα in rat hepatocytes (Zhou et al., 2001).
Fortez and coworkers (1998) observed decreases in fatty acid synthase (FAS) gene
expression in response to AMPK activation.
Milk fat from cows is primarily composed of TAG and is the most variable
component of milk (see review by (Palmquist, 2006)). Acetyl-CoA carboxylase, FAS,
and GPAT are three lipogenic enzymes required for milk fat production (Palmquist,
2006). In ruminants, these enzymes can be downregulated in response to restricted
73
dietary intake (Ingle et al., 1973; Bauman et al., 2006). Since milk fat synthesis
represents a significant energy expenditure for the cow, AMPK may regulate milk fat
synthesis, an energy consuming process, to modulate mammary epithelial cell energy
utilization. Little is known about the role of AMPK in the lactating dairy cow. The
objectives of the present study were to determine the mRNA expression of α, β, and γ
subunits of AMPK in various bovine tissues and evaluate the effect of AMPK activation
on de novo fatty acid synthesis in bovine mammary epithelial cells.
MATERIALS AND METHODS
To evaluate the tissue distribution of AMPK, adipose, liver, and muscle tissue
samples were harvested from three bulls killed at the Department of Food Science and
Technology, Virginia Tech. Mammary tissue was harvested from two Holstein cows and
one Jersey cow euthanized at the College of Veterinary Medicine, Virginia Tech, for
orthopedic injuries. Tissues were compared with cells from the MAC-T bovine
mammary epithelial cell line (Huynh et al., 1991). All tissues collected at slaughter were
immediately snap-frozen in liquid nitrogen and stored at -80°C until analysis.
Cell culture and treatments
All experiments utilized the MAC-T bovine mammary epithelial cell line. Cells
were routinely cultured at 37°C in 5% CO2, and the medium was changed every 24 h
throughout the duration of the experiment. Cells were seeded on plastic cell culture
plates at a density of 2.6 × 104 cells/cm2. Cells were grown in basal medium
(Dulbecco’s Modified Eagle’s Medium (DMEM) with 10 kU/ml penicillin, 10 mg/ml
74
streptomycin, and 25 µg/ml amphotericin B) supplemented with 10% fetal bovine serum.
Once cells reached confluence (approximately 72 h post seeding), serum was removed
and hormones (0.1 μg/mL insulin and 1.5 μg/mL prolactin; Sigma Chemical Co., St.
Louis, MO) were added to the basal media. Cells were cultured in basal media with
hormones for 24 h and then treatments were applied.
Cells were treated with AICAR (200, 400, or 600 µM; Sigma Chemical Co., St.
Louis, MO) for 1, 4, or 24 h. In a separate experiment, cells were treated with
ionomycin (1 µM; Sigma Chemical Co., St. Louis, MO) for 1 h. Dimethyl sulfoxide
(DMSO; Sigma Chemicals Co., St. Louis, MO) served as control when evaluating the
effects of ionomycin. Cells were treated with no more than 0.23% DMSO. To evaluate
the effects of energy removal, cells were incubated with DMEM without glucose for 4 h.
Cells incubated with DMEM with glucose served as control.
Fatty acid synthesis assay
De novo fatty acid synthesis was determined by quantifying the incorporation of
[1-14C]-labeled acetate into lipid. Methods were adapted from Peterson and coworkers
(2004) and modified as described. Cells were cultured in 12-well cell culture plates and
incubated with [1-14C]-acetate (MP Biomedicals, Solon, OH) for a period of 4 h. After 1
or 20 h of AICAR treatment, cells were cultured in 3 mM acetate (0.37 μCi/µmol).
Following the 4 h incubation with [1-14C]-labeled acetate, cells were lysed in wells with
sodium dodecyl sulfate buffer (0.1% in phosphate buffered saline). Lipid within the
lysate was then extracted using hexane:isopropanol (3:2). The solvent layer was
combined with 16 ml of scintillation cocktail (Scintisafe 30% Cocktail; Fisher Scientific,
75
Pittsburgh, PA) for quantification of label incorporation into lipid using a LS 6000LL
Beckmann scintillation counter. Activity was calculated and expressed as pmol of
acetate incorporated per µg of DNA.
Real time PCR
Total RNA was extracted from snap-frozen tissues using TRI Reagent (1 ml/50-
100 mg tissue; Molecular Research Center, Cincinnati, OH). Cultured cells were lysed
in 6-well culture plates using 1 mL of TRI Reagent (Molecular Research Center Inc.;
Cincinnati, OH) per well. Total RNA was isolated according to manufacturer’s
instructions. Ribonucleic acid pellets were resuspended in RNase-free water, and
quantified at 260 nm using a spectrophotometer. Total RNA was reverse transcribed
(500 ng per reaction) into cDNA using the Omniscript reverse transcription kit (Qiagen;
Valencia, CA) according to manufacturer’s instructions using oligo(dT) (Roche Applied
Science; Indianapolis, IN) as the primer.
Real-time PCR reactions were performed using the Quantitect SYBR Green PCR
kit (Qiagen; Valencia, CA) and an Applied Biosystems 7300 Real-time PCR machine
(Applied Biosystems; Foster City, CA). Quantification of gene transcripts for ACCα,
FAS, lipoprotein lipase (LPL), fatty acid binding protein-3 (FABP3), GPAT, 1-
acylglycerol-3-phosphate acyltransferase-6 (AGPAT), peroxisome-proliferator activated
receptor-γ (PPARγ), liver X receptor-α (LXRα), SREBP1, α1 AMPK, α2 AMPK, β1
AMPK, β2 AMPK, γ1 AMPK, γ2 AMPK, and γ3 AMPK was completed using gene-
specific primers (Table 5.1). β-actin was used as the endogenous control gene, and
adipose was used as the calibrator for making relative comparisons between tissues
76
Table 5.1. Primer sequences used to detect ACCα, FAS, LPL, FABP3, GPAT, AGPAT, PPARγ, LXRα, SREBP1, α AMPK, β AMPK, γ AMPK and β-actin1.
Target Gene
Forward Primer (5'-3') Reverse Primer (3'-5') Product Size (bp)
ACCα GGGTGAAAGACTGGGTTGGAA GTAGTGTAGGCACGAGACAG 172
FAS AATGACCACTTTGCCGATGT TGAAGGACGGTGTACCACAA 152
LPL GAGCCAAAAGAAGCAGCAAG TGTAGGGAAAATGGGACGGA 181
FABP3 GAACTCGACTCCCAGCTTGAA GAAGCTACTAACACCATCCGAA 101
GPAT ATTGACCCTTGGCACGATAG GAAACACCCTTCCACGACAA 187
AGPAT AAGCAAGTTGCCCATCCTCA AGCTTTAACCTCGGTGTCAAA 100
PPARγ CATCTTCCAGGGGTGTCAGT TCCTACCCCAGGAGTATAGG 186
LXRα TCAACCCCATCTTCGAGTTC ACGACTACTTTGACCACTCG 232
SREBP12 ATGCCATCGAGAAACGCTAC CTCTTGGACTCAGACGCCTG 180
α1 AMPK GAGCTTGCCAAAGGAATGAT AACTCTACACGCGCTTAGAT 158
α2 AMPK ACAGCCCTAAAGCACGATGT GTAGAACCTTAGGCTTCAGTT 101
β1AMPK CGATCTGGAAGTGAACGACA AGACCCAGGAAATTGTTGACC 106
β2 AMPK AGGATTTGGAGGACTCCGTA CTCGTGGTTCTAAGGTGACT 126
γ1 AMPK GCTGTATGGAGGAGGCTGAG CCAATAACGAAAAGGACCGT 173
γ2 AMPK CTCTTCGATGCTGTGCACTCG AGGAGTTCAAGGAGGTCGAA 123
γ3 AMPK TAGAGTTCTCAGCCCCAGCA CCAGATGTACGTGAAGTACGT 154
β-actin CTCTTCCAGCCTTCCTTCCT CGTCTTTCTCTAGTGACGGG 178 1ACCα, acetyl-CoA carboxylase; FAS, fatty acid synthase; LPL, lipoprotein lipase;
FABP3, fatty acid binding protein-3; GPAT, glycerol-3-phosphate acyltransferase;
AGPAT, acylglycerol phosphate acyltransferase; PPARγ, peroxisome proliferator-
activated receptor-γ; LXRα, liver X receptor-α; SREBP1, sterol regulatory element
binding protein-1; AMPK, AMP-activated protein kinase.
2Primer pairs do not distinguish between SREBP1a and SREBP1c isoforms.
77
within each AMPK isoform. Fold change was calculated using the 2−ΔΔCt method (Livak
and Schmittgen, 2001). Reaction conditions were as follows: 1 cycle at 95°C for 10
min followed by 40 cycles at 95°C for 30 s, 58°C for 30 s, and 72°C for 1 min. Each
reaction was performed in duplicate wells.
DNA quantification
Cells were harvested in DNA assay buffer (Tris Base, EDTA, NaCl; pH 7.4) then
sonicated (2 × 5 s) on ice. Deoxyribonucleic acid concentration of cell lysates was
assayed as described by Labarca and Paigen (1980) with the following modifications.
Briefly, 2 μL of cell lysate was transferred to a cuvette followed by 1998 μL of DNA
assay buffer to yield a total assay volume of 2 mL. Samples were measured in triplicate
using a DyNA Quant 200 fluoremeter (Hoefer Pharmacia Biotech; San Francisco, CA).
Calf thymus DNA (Sigma Chemical Co.; St. Louis, MO) was used as a standard.
Immunoblotting
Cells were seeded on 6-well cell culture plates. In one well, ice-cold phosphate
buffered saline with phosphatase inhibitors (5 mM NaF and 1 mM Na3VO4) was used to
wash cells prior to harvest. Cells were harvested in ice-cold lysis buffer (50 mM Tris pH
7.4, 0.5% Triton X-100, 0.3 M NaCl, 2 mM EDTA, and protease inhibitor cocktail) with
phosphatase inhibitors for 15 min on ice. Lysate was centrifuged at 14,000 × g at 4°C
for 10 min. Pellets were discarded and supernatants were assayed for protein
concentration using the Bradford assay (Bio-Rad; Hercules, CA). To ensure equal
loading, samples were diluted to the same protein concentrations with Laemmli sample
78
buffer (Bio-Rad; Hercules, CA) and heated at 95°C for 7 min. Proteins were separated
by electrophoresis using 7.5% polyarcylamide gels (Cambrex Corporation, East
Rutherford, NJ) and transferred to a PVDF membrane using a Bio-Rad trans-blot SD
semi-dry transfer cell (Bio-Rad; Hercules, CA). Membranes were blocked in blocking
buffer (0.05 M Tris pH 7.4, 0.2M NaCl, 0.1% Tween, and 5% dried nonfat milk) on a
rocker. Primary anti-ACC or anti-phospho-ACC antibodies (Cell Signaling Technology;
Beverly, MA) were applied at 1:1000 in blocking buffer. Membranes were then washed
in blocking buffer. Following washing, membranes were incubated with horseradish
peroxidase-conjugated goat anti-rabbit antibody (Santa Cruz Biotechnology, Santa
Cruz, CA) in blocking buffer at 1:2000. Proteins were detected using ECL-Plus
chemiluminescence substrate (Amersham Biosciences; Pittsburg, PA) according to
manufacturer’s instructions. Chemiluminescence was measured using a Chemidoc
XRS digital imaging system and densitometry was quantified using Quantity One
software (Bio-Rad; Hercules, CA).
Acetyl-CoA carboxylase activity assay
Bovine mammary epithelial cells were seeded on 100-mm cell culture dishes and
treated with AICAR for 1 h. After treatment, ice-cold phosphate buffered saline with
phosphatase inhibitors (5 mM NaF and 1 mM Na3VO4) was used to wash cells prior to
harvest. Cells were harvested in ice-cold lysis buffer (50 mM Tris pH 7.4, 0.5% Triton
X-100, 0.3 M NaCl, 2 mM EDTA, and protease inhibitor cocktail) with phosphatase
inhibitors for 15 min on ice. Lysate was centrifuged at 14,000 × g at 4°C for 10 min.
79
Pellets were discarded and supernatants were assayed for protein concentration using
the Bradford assay.
Activity of ACC in MAC-T was determined by quantifying the incorporation of 14C-
labeled NaH14CO3 into acid-stable malonyl-CoA. Methods were adapted from Chang
and coworkers (1967) and modified as described. Samples were first pre-incubated at
37°C for 30 min. The pre-incubation reaction composition was 100 mM Tris-HCl pH 7.3,
200 mM sodium citrate, 200 mM MgCl2, 2 mM glutathione, and 8 mg/mL bovine serum
albumin, in a final volume of 0.5 mL. Following pre-incubation, reactions were initiated
by the addition of 0.5 mL of assay mixture containing 100 mM Tris-HCl pH 7.3, 7.8 mM
ATP, 0.4 mM acetyl-CoA, 2 mM glutathione, and 5 mM NaH14CO3 (1.25 µCi/mL).
Reactions were allowed to proceed for 45 minutes at 37°C and then terminated with
0.25 mL of 6 N HCl followed by evolution of unincorporated 14CO2. Scintillation cocktail
was added and quantification of label into malonyl-CoA was determined using a LS
6000LL Beckmann scintillation counter. Activity was calculated and expressed as nmol
of NaH14CO3 incorporated per mg of protein.
Statistical analysis
Data are reported as least squares means ± SEM unless otherwise noted. All
data were analyzed using the Mixed procedure of SAS (SAS for Windows Version 9.1,
SAS Institute Inc., Cary, NC). When analyzing the presence of AMPK subunits in
bovine tissues and MAC-T, the model included tissues or cells and animal or plate of
cells. Treatments included adipose, liver, muscle, and mammary tissue in addition to
MAC-T. One sample represents one animal or one well of plated MAC-T. When
80
analyzing the activity of ACC in MAC-T, the model included the fixed effects of
treatment and set. For analysis of all other data, the model included the fixed effects of
treatment, set, and treatment by set interaction. Replicate within set was the random
effect. Treatments include the presence of AICAR, the presence of glucose, or the
presence of ionomycin. One set represents one independent experiment. If a
significant treatment effect was observed, Tukey’s multiple comparison procedure was
used to separate treatment means. Real-time PCR data were analyzed using original
ΔCt values normalized with β-actin as the endogenous control gene. For the purpose of
presentation, least squares means are illustrated as fold change (2-ΔΔCt) relative to
control
RESULTS
AMP-activated protein kinase is expressed in various tissues throughout the
mammalian body. The relative mRNA expression of the known α, β, and γ isoforms of
AMPK varies depending on tissue type. In the present study, α AMPK, β AMPK, and γ
AMPK mRNA were found in all bovine tissues examined and the MAC-T bovine
mammary epithelial cell line; however, the α2 isoform was not expressed in MAC-T nor
was the γ3 isoform found in mammary tissue or MAC-T (Figure 5.1). For all three
subunits of AMPK, the mRNA expression was greater in muscle compared to other
bovine tissues and MAC-T.
Activation of AMPK occurs in response to an increase in the AMP:ATP ratio. The
AMPK activator, AICAR, is routinely used to mimic this effect after activation to AICAR
monophosphate (ZMP), an AMP analog (Corton et al., 1995). Acute treatment of MAC-
81
Figure 5.1. Bovine tissue and bovine mammary epithelial cell (MAC-T) presence of α
AMP-activated protein kinase (AMPK), β AMPK, and γ AMPK mRNA. (A) Tissue and
MAC-T presence of α1 and α2 isoforms. (B) Tissue and MAC-T presence of β1 and β2
isoforms. (C) Tissue and MAC-T presence of γ1, γ2, and γ3 isoforms. Real-time PCR
was performed using RNA extracted from bull tissues (adipose, liver, muscle; n = 3),
cow mammary tissue (n = 3), and MAC-T (n = 3). β-actin was used as the endogenous
control gene, and adipose was used as the calibrator for making relative comparisons
between tissues within each isoform. Data is illustrated as least squares means.
Differences in ΔCt values for treatments are signified by differing superscripts within
isoform, P < 0.01. Isoforms not detected are denoted as ND.
0
2
4
6
γ1 γ2 γ3
A
B
C
150
170
190
0
5
10
α1 α2
Fo
ld C
han
ge (
2-ΔΔ
Ct )
50
70
90
0
2
4
β1 β2
Fo
ld C
han
ge (
2-ΔΔ
Ct )
430
435
440
Fo
ld C
han
ge (
2-ΔΔ
Ct )
a a
b
a
c
A
C
AD
B
ND
A
B
AA
A
NDND
†
‡
†A
B
DA
E
a a
b
aa
Adipose Liver Muscle Mammary MAC-T
82
T with increasing concentrations of AICAR significantly decreased incorporation of
acetate into lipid (Figure 5.2). Similarly, chronic treatment of MAC-T with 400 and 600
µM AICAR significantly decreased acetate incorporation compared to control; however,
treatment with 200 µM AICAR significantly increased acetate incorporation (Figure 5.2).
AMP-activated protein kinase phosphorylates a variety of cellular proteins
thereby stimulating or inhibiting their activity. The phosphorylation and subsequent
inactivation of ACC by AMPK is widely observed in response to AICAR treatment
(Merrill et al., 1997; Zhou et al., 2001; Park et al., 2002a). Bovine mammary epithelial
cells incubated with AICAR for 1 h significantly increased the phosphorylation of ACCα
(Figure 5.3). The phosphorylation of ACC by AMPK has been shown to be
accompanied by a decrease in ACC activity (Munday et al., 1988). In response to
increased phosphorylation of ACCα, we observed a significant decrease in ACC activity
after treating MAC-T with AICAR for 1 h (Figure 5.4)
In addition to the short-term regulation of proteins by phosphorylation, AMPK
may also exert long-term effects by controlling gene transcription. Chronic treatment of
AICAR (600 µM) resulted in a significant decrease in the mRNA expression of LPL,
GPAT, and PPARγ (Figure 5.5. and 5.6). However, chronic treatment of AICAR
significantly increased the mRNA expression of FAS, FABP3, and SREBP1 (Figure 5.5
and 5.6). The mRNA expression of ACCα, AGPAT, and LXRα were unaffected by
chronic treatment of AICAR.
AMP-activated protein kinase is able to detect decreases in energy supply, and
reductions in glucose availability can dramatically alter the ratio of AMP:ATP, resulting
in activation of AMPK (Salt et al., 1998). Incubation of MAC-T in the absence of
83
Figure 5.2. Effect of treating bovine mammary epithelial cells (MAC-T) with either 0
(control), 200, 400, or 600 µM AICAR for 4 (acute) or 24 h (chronic) on de novo fatty
acid synthesis. Solid and open bars represent acute and chronic treatments,
respectively. Error bars represent SEM for two independent experiments with three
replicates per experiment. Treatment differences are signified by differing superscripts
within acute (lowercase) or chronic (uppercase) treatments, P < 0.0001.
0
50
100
150
200
250
0 200 400 600
[AICAR (µM)]
Aceta
te I
nco
rpo
rate
d
(pm
ol/
µg
deo
xyri
bo
nu
cle
icacid
)
B
A
C
D
b
c c
a
84
Figure 5.3. Effect of treating bovine mammary epithelial cells (MAC-T) with or without
AICAR (600 μM) for 1 h on ratio of phosphorylated-ACCα (P-ACCα) to total ACCα
protein abundance. Error bars represent SEM for two independent experiments with
three replicates per experiment. An asterisk indicates a significant difference from
control, P < 0.0001.
0
6
12
18
Control AICAR
P-ACCα
Total ACCα
Control AICAR
Control AICAR
*
Ph
osp
ho
ryla
ted
AC
Cα
:To
tal A
CCα
85
Figure 5.4. Effect of treating bovine mammary epithelial cells (MAC-T) with or without
AICAR (600 μM) for 1 h on acetyl-CoA carboxylase (ACC) activity. Error bars represent
SEM for two independent experiments. An asterisk indicates a significant difference
from control, P < 0.01.
0
1
2
3
Control AICAR
NaH
14C
O3
Inco
rpo
rate
d(n
mo
l/m
g p
rote
in)
A
*
86
Figure 5.5. Effect of treating bovine mammary epithelial cells (MAC-T) with or without
AICAR (600 μM) for 24 h on lipogenic gene expression. (A) Lipogenic genes evaluated
were acetyl-CoA carboxylase-α (ACCα), fatty acid synthase (FAS), lipoprotein lipase
(LPL), and fatty acid binding protein-3 (FABP3). (B) Genes involved in the synthesis of
triacylglycerol were also evaluated. These included glycerol phosphate acyltransferase
(GPAT) and acylglycerol phosphate acyltransferase (AGPAT). Solid and open bars
represent control and AICAR treatments, respectively. Data is illustrated as least
squares means and represents two independent experiments with three replicates per
experiment. An asterisk indicates a significant difference in ΔCt from control, P < 0.01.
0.0
0.5
1.0
1.5
GPAT AGPAT
*
0.0
0.5
1.0
1.5
2.0
ACCα FAS LPL FABP3
Fo
ldch
an
ge (
2-ΔΔ
Ct )
*
**
Fo
ldch
an
ge (
2-ΔΔ
Ct )
B
A
87
Figure 5.6. Effect of treating bovine mammary epithelial cells (MAC-T) with or without
AICAR (600 μM) for 24 h on various lipogenic transcription factor gene expression.
Transcription factors evaluated were peroxisome proliferator-activated receptor-γ
(PPARγ), liver X receptor-α (LXRα), and sterol regulatory element binding protein-1
(SREBP1). Solid and open bars represent control and AICAR treatments, respectively.
Data is illustrated as least squares means and represents two independent experiments
with three replicates per experiment. An asterisk indicates a significant difference in
ΔCt from control, P < 0.01.
0
1
2
PPARγ LXRα SREBP1
Fo
ldch
an
ge (
2-ΔΔ
Ct )
*
*
88
glucose in the culture medium for 4 h significantly increased the ratio of P-ACCα to total
ACCα (Figure 5.7).
Ca2+/calmodulin-dependent kinase kinase is an AMPK kinase sensitive to rises in
intracellular Ca2+. Ionomycin, a Ca2+ ionophore, is often used to study CaMKK because
it increases intracellular Ca2+. Increases in intracellular Ca2+ result in the
phosphorylation of AMPK (Hurley et al., 2005; Tamas et al., 2006). In the present
study, treatment of MAC-T with ionomycin for 1 h resulted in a significant inactivation of
ACCα (Figure 5.8).
DISCUSSION
Activation of AMPK occurs when AMP binds to Bateman domains on its γ subunit
resulting in a conformational change permitting the phosphorylation of the α subunit.
The β subunit of AMPK structurally supports the α and γ subunits of AMPK. The mRNA
of all three subunits of AMPK were found in bovine adipose, liver, muscle, and
mammary tissue in addition to MAC-T. The relative expression of α, β, and γ AMPK
was greatest in muscle compared to other tissues and MAC-T. Likewise, AMPK mRNA
is most abundant in skeletal muscle compared to other tissues (Verhoeven et al., 1995;
Woods et al., 1996). We also observed the absence of the γ3 isoform in mammary
tissue and MAC-T. Mahlapuu and coworkers (2004) determined that the γ3 isoform of
AMPK is predominantly expressed in skeletal muscle, whereas the γ1 and γ2 isoforms
show broad tissue distributions (Cheung et al., 2000; Buhl et al., 2001). Lastly, we also
failed to detect the α2 isoform in MAC-T. In rats, the mRNA expression of α2 AMPK is
89
Figure 5.7. Effect of incubating bovine mammary epithelial cells (MAC-T) with
Dulbecco’s Modified Eagle’s Medium (DMEM) with or without glucose for 4 h on ratio of
phosphorylated-ACCα (P-ACCα) to total ACCα protein abundance. Error bars
represent SEM for two independent experiments with three replicates per experiment.
An asterisk indicates a significant difference from control, P < 0.0001.
0
1
2
3
Glucose No Glucose
P-ACCα
Total ACCα
Glucose No Glucose
*
Ph
osp
ho
ryla
ted
AC
Cα
:To
tal A
CCα
Glucose No Glucose
90
Figure 5.8. Effect of treating bovine mammary epithelial cells (MAC-T) with either
control (DMSO) or ionomycin (1 μM) for 1 h on ratio of phosphorylated-ACCα (P-ACCα)
to total ACCα protein abundance. Error bars represent SEM for two independent
experiments with three replicates per experiment. An asterisk indicates a significant
difference from control, P < 0.0001.
0
0.5
1
1.5
Control Ionomycin
P-ACCα
Total ACCα
Control Ionomycin
*
Ph
osp
ho
ryla
ted
AC
Cα
:To
tal A
CCα
Control Ionomycin
91
greatest in skeletal muscle and liver while α1 AMPK is expressed ubiquitously
(Stapleton et al., 1996; Stephens et al., 2002). The phosphorylation of both α isoforms
by upstream AMPK kinases has been well documented (Hawley et al., 2003; Hawley et
al., 2005); therefore, use of MAC-T as an in vitro model of the mammary gland is
appropriate.
Activation of AMPK can regulate lipid synthesis (see review by Hardie and Pan
(2002)). In the present study, acute AICAR (200-600 µM) treatment significantly
decreased de novo fatty acid synthesis in MAC-T up to 85%. Similar observations were
observed with chronic AICAR (400-600 µM) treatment. However, treatment with 200
µM AICAR for 24 h significantly increased fatty acid synthesis as measured by
radiolabeled acetate incorporation into lipid and this was unexpected. Administration of
AICAR decreased lipid synthesis in human hepatoma cells (Brusq et al., 2006). In
certain cell types and species, AMPK can regulate the transcription of various lipogenic
genes (Zhou et al., 2001; Diraison et al., 2004). Treatment of MAC-T with 600 μM
AICAR for 24 h resulted in 38% and 66% increases in the mRNA expression of FAS
and SREBP1, respectively. Sterol regulatory element binding protein-1 can regulate the
transcription of FAS (Magana and Osborne, 1996). It is possible that FAS expression
was upregulated by SREBP1 as a compensatory mechanism in response to the
dramatic reduction in lipid synthesis. This finding may also explain why we observed a
significant increase in acetate incorporation after chronic treatment with 200 µM AICAR.
Whether chronic treatment of MAC-T with 200 μM AICAR increases FAS and SREBP1
expression remains to be verified.
92
Activation of AMPK by AICAR results in the phosphorylation of ACC and its
inactivation (Zhou et al., 2001; Park et al., 2002b). In the present study, treating MAC-T
with 600 µM AICAR significantly increased the ratio of P-ACCα to total ACCα by 959%.
In addition, the activity of ACC decreased by 86%. Increasing concentrations of AICAR
linearly increases ZMP production in muscle of rats (Merrill et al., 1997). 5-
Aminoimidazole-4-carboxamide ribonucleoside monophosphate is an AMP analog
which can bind to the γ subunit of AMPK promoting phosphorylation. The mRNA
expression of the α2 isoform of AMPK was absent in MAC-T. Therefore, AICAR was
converted to ZMP subsequently increasing the phosphorylation of α1 AMPK and
resulting in the inactivation of ACCα in MAC-T. The dramatic increase in the ratio of P-
ACCα to total ACCα most likely contributed to the significant decrease in acetate
incorporation in response to acute and chronic treatment of AICAR.
Lipoprotein lipase is essential for the hydrolysis of TAG and subsequent uptake
of preformed fatty acids. The mRNA expression of LPL decreased by 50% in response
to AMPK activation. Knockdown of AMPKα in 3T3-L1 adipocytes results in increased
activation of LPL (Kim et al., 2007). In addition, stimulation of LPL activity is likely an
AMPK-dependent process in cardiac muscle (An et al., 2005). Interestingly, we also
observed a 44% decrease in the expression of PPARγ. A PPARy response element
has been identified within the promoter region of LPL (Schoonjans et al., 1996a). In
addition, AICAR can dramatically decrease PPARγ protein abundance in 3T3-L1
adipocytes (Habinowski and Witters, 2001). We propose that the dramatic reduction in
de novo fatty acid synthesis decreases the demand for the incorporation of preformed
fatty acids into TAG and therefore decreased the expression of LPL by decreasing the
93
expression of PPARγ. In support, activation of AMPK in adipocytes dramatically
suppresses fatty acid uptake (Gaidhu et al., 2009). Gaidhu and coworkers (2009)
propose that fatty acid uptake is decreased in order to prevent the esterification of
excess fatty acids, an energy consuming process.
The mRNA expression of GPAT was decreased by 81% in response to AICAR;
however, AGPAT mRNA expression was not modified by treatment. Glycerol-3-
phosphate acyltransferase is responsible for the first acylation in TAG synthesis. The
incorporation of radiolabeled oleate into TAG is decreased in response to AICAR
(Muoio et al., 1999). Muoio and coworkers (1999) also observed a significant decrease
in GPAT activity. We believe GPAT expression was reduced in response to a dramatic
reduction in substrate (short-, medium-, and long-chain fatty acids) caused by the
inactivation of ACCα and the downregulation of LPL mRNA expression.
Fatty acid binding protein-3 is closely associated with the β-oxidation of fatty
acids (Hertzel and Bernlohr, 2000). In addition, AMPK activation has been shown to
increase FABP3 mRNA expression (Lee et al., 2006). In the present study, the mRNA
expression of FABP3 increased 56%. We believe the intracellular concentration of
preformed, long-chain fatty acids was increased due to a decrease in TAG synthesis
caused by a reduction in de novo fatty acid synthesis. Therefore, the increase in
FABP3 may have supported an increase in mitochondrial β-oxidation of fatty acids.
AMP-activated protein kinase is sensitive to decreases in energy supply. The
bovine mammary epithelial cell utilizes acetate as the primary source of energy supply.
However, glucose can also be oxidized in the bovine mammary epithelial cell in addition
to serving as a substrate for lactose synthesis. Removal of glucose from the incubation
94
medium for 4 h resulted in a 251% increase in the P-ACCα to total ACCα ratio (Figure
5.7). Removal of glucose from the cell culture medium activates AMPK in cardiac
myocytes (An et al., 2005). Low glucose supply also increases the AMP/ATP and
ADP/ATP ratios in pancreatic β cells resulting in the activation of AMPK (Salt et al.,
1998). We propose that removal of energy supply can result in the phosphorylation of
ACCα by AMPK thereby inhibiting fatty acid synthesis, an energy consuming process in
the bovine mammary epithelial cell.
Ca2+/calmodulin-dependent kinase kinase is one of two known upstream kinases
of AMPK. In the present study, 1 µM ionomycin significantly increased the ratio of P-
ACCα to total ACCα by 308%. Ionomycin increased the phosphorylation of AMPK and
its activity by ~500% in HeLa cells (Hurley et al., 2005). STO-609, a CaMKK inhibitor,
completely reversed the effects of ionomycin on AMPK phosphorylation. In addition,
ionomycin-stimulated AMPK activity, AMPK phosphorylation, and ACC phosphorylation
are substantially reduced in HeLa cells transfected with small interfering RNAs specific
for both isoforms of CaMKK (Hurley et al., 2005). Hurley and coworkers (2005) also
observed that the activation of AMPK by ionomycin is not impaired in LKB1 knockout
murine embryo fibroblasts. We can therefore hypothesize that ionomycin inactivated
ACCα in a CaMKK-dependent, LKB1-independent manner. Further research is needed
to indentify the presence of CaMKK in MAC-T and its ability to regulate lipid synthesis.
In conclusion, we identified the presence of AMPK mRNA in various bovine
tissues and MAC-T. In MAC-T, we conclude that AMPK regulates the synthesis and
utilization of fatty acids by phosphorylating ACCα and modifying gene transcription. We
also propose that AMPK is able to inhibit fatty acid synthesis, an energy consuming
95
process, in response to decreases in energy supply. In addition, our results suggest the
presence of CaMKK and its potential regulation of lipid synthesis in MAC-T.
96
CHAPTER 6
Conclusions
The synthesis of fatty acids in bovine mammary epithelial cells is controlled by
various regulatory proteins which include SREBP1, LXR, and AMPK. We conclude that
de novo fatty acid synthesis is inhibited by polyunsaturated fatty acids by
downregulating the expression of SREBP1 in BME-UV bovine mammary epithelial cells.
In BME-UV, we demonstrate that LXR activation enhances de novo fatty acid synthesis
by upregulating the expression of SREBP1. Thus, we conclude that SREBP1 is a LXR
target and hypothesize that activation of LXR in the mammary gland may modify milk fat
production. However, LXR activation was unable to prevent observed decreases in de
novo fatty acid synthesis in response to polyunsaturated fatty acids. In vivo, LXR
activation may not be able to prevent the inhibitory effect of trans-10, cis-12 CLA;
therefore, LXR activation wouldn’t be an effective strategy when managing milk fat
depression. Activation of AMPK dramatically decreased de novo fatty acid synthesis in
MAC-T bovine mammary epithelial cells by inactivating ACCα. In addition to
inactivating ACCα, we also demonstrate that AMPK activation can modify gene
transcription. Identifying AMPK as a molecular target capable of modifying energy
substrate utilization may result in the development of new technologies that increase
milk production or modify milk composition during periods of increased energy demand.
We also provide evidence that LKB1 and CaMKK are expressed in MAC-T. With
additional research, these AMPK kinases may prove to be additional targets for
modifying milk fat production in dairy cows.
97
Milk fat is not only a major component of the economic value of milk, but
represents a significant portion of the energy cost associated with lactation. It may be
advantageous for producers to induce milk fat depression during periods of limited
feedstuff availability (i.e. pasture feeding during drought) or during the periparturient
period. A reduction in milk fat yield can allow for a repartitioning of nutrients to support
increased milk and milk protein yield. For example, milk protein synthesis in grazing
dairy cows is often limited by energy availability. A decrease in milk fat production could
reduce the energy requirements for milk production and as a consequence dietary CLA
could increase milk protein yield. In addition to performance, reductions in milk fat yield
may improve animal health. For example, early lactation is often associated with a
period of negative energy balance which is known to negatively affect reproduction and
increase the susceptibility of dairy cows to various metabolic disorders, thereby limiting
milk yield throughout lactation. Reducing milk fat production during negative energy
balance may alleviate the severity of increased energy demand and improve animal
performance and well-being. Better understanding the molecular regulation milk fat
synthesis will give producers the ability to not only regulate milk fat synthesis but also
control nutrient utilization.
Including the inhibitory effects of AMPK activation on milk fat synthesis, AMPK
may also inhibit the synthesis of other milk components including milk protein and
decrease milk production by regulating the uptake of glucose in the lactating mammary
gland. Since glucose is the precursor of milk lactose which is the major osmotic
component of milk, a decrease in glucose availability could result in a decrease in milk
synthesis. Therefore, activation of AMPK may decrease the production of milk lactose
98
which could decrease milk production. To avoid this loss in potential profit, the
American dairy producer should strive to ensure their dairy cows are consuming enough
dietary energy to meet the dairy cow’s demands of maintenance, growth, reproduction,
and lactation. If producers fail to meet this standard, AMPK will most likely become
activated in the lactating mammary gland resulting in a decrease in milk components
and yield.
Based on our findings, we feel that LXR and AMPK play an active role in the
regulation of de novo fatty acid synthesis in bovine mammary epithelial cells.
Therefore, the development of technologies that control LXR or AMPK activation may
provide dairy producers with additional management strategies to modify milk fat
production and composition to meet consumer demand and maximize profitability.
Future research should identify the relative contribution of SREBP1 and LXR to the de
novo synthesis of fatty acids in the bovine mammary gland. Also, identifying
endogenous LXR ligands should be determined to further elaborate the role of LXR in
the mammary gland. In the bovine mammary gland, better understanding the role of
AMPK activation in response to energy demand is needed. Characterizing the effect of
AMPK activation on other metabolic pathways such as fatty acid uptake and oxidation
should also be investigated. Lastly, identifying the presence of LKB1 and CaMKK and
their relative contributions to the activation of AMPK in the bovine mammary gland is
necessary.
99
REFERENCES
Allred, J. B. and K. E. Reilly. 1996. Short-term regulation of acetyl CoA carboxylase in
tissues of higher animals. Prog. Lipid Res. 35:371-385.
An, D., T. Pulinilkunnil, D. Qi, S. Ghosh, A. Abrahani, and B. Rodrigues. 2005. The
metabolic "switch" AMPK regulates cardiac heparin-releasable lipoprotein lipase.
Am. J. Physiol. Endocrinol. Metab. 288:E246-253.
Anderson, S. M., M. C. Rudolph, J. L. McManaman, and M. C. Neville. 2007. Key
stages in mammary gland development. Secretory activation in the mammary
gland: it's not just about milk protein synthesis! Breast Cancer Res. 9:204.
Argmann, C. A., J. Y. Edwards, C. G. Sawyez, C. H. O'Neil, R. A. Hegele, J. G.
Pickering, and M. W. Huff. 2005. Regulation of macrophage cholesterol efflux
through hydroxymethylglutaryl-CoA reductase inhibition: A role for RhoA in
ABCA1-mediated cholesterol efflux. J. Biol. Chem. 280:22212-22221.
Auboeuf, D., J. Rieusset, L. Fajas, P. Vallier, V. Frering, J. P. Riou, P. Staels, J.
Auwerx, M. Laville, and H. Vidal. 1997. Tissue distribution and quantification of
the expression of mrnas of peroxisome proliferator-activated receptors and liver x
receptor-alpha in humans: no alteration in adipose tissue of obese and NIDDM
patients. Diabetes 46:1319-1327.
Barber, M. C., R. A. Clegg, M. T. Travers, and R. G. Vernon. 1997. Review. Lipid
metabolism in the lactating mammary gland. Biochim. Biophys. Acta 1347:101-
126.
Barnes, B. R., S. Marklund, T. L. Steiler, M. Walter, G. Hjalm, V. Amarger, M.
Mahlapuu, Y. Leng, C. Johansson, D. Galuska, K. Lindgren, M. Abrink, D.
Stapleton, J. R. Zierath, and L. Andersson. 2004. The 5'-AMP-activated protein
kinase γ3 isoform has a key role in carbohydrate and lipid metabolism in
glycolytic skeletal muscle. J. Biol. Chem. 279:38441-38447.
Baughman, C. A. 1995. Influence of in vitro elaidic or trans-vaccenic acid uptake and lactogenic hormone stimulation on fatty acid content in mouse mammary cells. Pages 30-100 in Department of Dairy Science. Master of Science Thesis. Virginia Polytechnic Institute and State University, Blacksburg, VA.
Bauman, D. E. and W. B. Currie. 1980. Partitioning of nutrients during pregnancy and
lactation: A review of mechanisms involving homeostasis and homeorhesis. J.
Dairy Sci. 63:1514-1529.
100
Bauman, D. E. and C. L. Davis. 1974. Biosynthesis of milk fat. In lactation: A
comprehensive treatise. Vol. 2. B. L. Larson and V. R. Smith ed. Academic
Press, Inc., New York.
Bauman, D. E. and C. L. Davis. 1975. Regulation of lipid metabolism. In Digestion and
metabolism in the ruminant. I. W. M. and A. C. I. Warner , ed. University of New
England Publishing Unit, Armidale, Australia, pg. 496.
Bauman, D. E. and J. M. Griinari. 2003. Nutritional regulation of milk fat synthesis.
Annu. Rev. of Nutr. 23:203-227.
Bauman, D. E., I. H. Mather, R. J. Wall, and A. L. Lock. 2006. Major advances
associated with the biosynthesis of milk. J. Dairy Sci. 89:1235-1243.
Bauman, D. E., C. J. Peel, W. D. Steinhour, P. J. Reynolds, H. F. Tyrrell, A. C. Brown,
and G. L. Haaland. 1988. Effect of bovine somatotropin on metabolism of
lactating dairy cows: Influence on rates of irreversible loss and oxidation of
glucose and nonesterified fatty acids. J. Nutr. 118:1031-1040.
Bauman, D. E., J. W. Perfield, K. J. Harvatine, and L. H. Baumgard. 2008. Regulation of
fat synthesis by conjugated linoleic acid: Lactation and the ruminant model. J.
Nutr. 138:403-409.
Baumgard, L. H., B. A. Corl, D. A. Dwyer, A. Saebo, and D. E. Bauman. 2000.
Identification of the conjugated linoleic acid isomer that inhibits milk fat synthesis.
Am. J. Physiol. Regulatory Integrative Comp. Physiol. 278:R179-R184.
Baumgard, L. H., E. Matitashvili, B. A. Corl, D. A. Dwyer, and D. E. Bauman. 2002.
Trans-10, cis-12 conjugated linoleic acid decreases lipogenic rates and
expression of genes involved in milk lipid synthesis in dairy cows. J. Dairy Sci.
85:2155-2163.
Berger, J. and D. E. Moller. 2002. The mechanisms of action of PPARs. Annu. Rev.
Med. 53:409-435.
Bickerstaffe, R. and E. F. Annison. 1971. Triglyceride synthesis in goat and sow
mammary tissue. Int. J. Biochem. 2:153-162.
Bionaz, M. and J. J. Loor. 2008a. ACSL1, AGPAT6, FABP3, LPIN1, and SLC27A6 are
the most abundant isoforms in bovine mammary tissue and their expression is
affected by stage of lactation. J. Nutr. 138:1019-1024.
101
Bionaz, M. and J. J. Loor. 2008b. Gene networks driving bovine milk fat synthesis
during the lactation cycle. BMC Genomics 9:366.
Birk, J. B. and J. F. P. Wojtaszewski. 2006. Predominant α2/β2/γ3 AMPK activation
during exercise in human skeletal muscle. J. Physiol. (Lond.) 577:1021-1032.
Braissant, O., F. Foufelle, C. Scotto, M. Dauca, and W. Wahli. 1996. Differential
expression of peroxisome proliferator-activated receptors (PPARs): Tissue
distribution of PPAR-α, -β, and -γ in the adult rat. Endocrinol. 137:354-366.
Bremmer, D. R., L. D. Ruppert, J. H. Clark, and J. K. Drackley. 1998. Effects of chain
length and unsaturation of fatty acid mixtures infused into the abomasum of
lactating dairy cows. J. Dairy Sci. 81:176-188.
Brown, M. S. and J. L. Goldstein. 1997. The SREBP pathway: Regulation of cholesterol
metabolism by proteolysis of a membrane-bound transcription factor. Cell
89:331-340.
Brun, R. P., P. Tontonoz, B. M. Forman, R. Ellis, J. Chen, R. M. Evans, and B. M.
Spiegelman. 1996. Differential activation of adipogenesis by multiple PPAR
isoforms. Genes Dev. 10:974-984.
Brusq, J. M., N. Ancellin, P. Grondin, R. Guillard, S. Martin, Y. Saintillan, and M.
Issandou. 2006. Inhibition of lipid synthesis through activation of AMP-kinase: an
additional mechanism for the hypolipidemic effects of Berberine. J. Lipid Res.
47:1281-1288.
Buhl, E. S., N. Jessen, O. Schmitz, S. B. Pedersen, O. Pedersen, G. D. Holman, and S.
Lund. 2001. Chronic treatment with 5-aminoimidazole-4-carboxamide-1-β-d-
ribofuranoside increases insulin-stimulated glucose uptake and GLUT4
translocation in rat skeletal muscles in a fiber type-specific manner. Diabetes
50:12-17.
Carlson, C. A. and K. H. Kim. 1973. Regulation of hepatic acetyl coenzyme A
carboxylase by phosphorylation and dephosphorylation. J. Biol. Chem. 248:378-
380.
Chang, H. C., I. Seidman, G. Teebor, and M. D. Lane. 1967. Liver acetyl CoA
carboxylase and fatty acid synthetase: Relative activities in the normal state and
in hereditary obesity. Biochem. Biophys. Res. Commun. 28:682-686.
102
Chen, Z. P., J. Heierhorst, R. J. Mann, K. I. Mitchelhill, B. J. Michell, L. A. Witters, G. S.
Lynch, B. E. Kemp, and D. Stapleton. 1999. Expression of the AMP-activated
protein kinase β1 and β2 subunits in skeletal muscle. FEBS Lett. 460:343-348.
Cheung, P. C. F., I. P. Salt, S. P. Davies, D. G. Hardie, and D. Carling. 2000.
Characterization of AMP-activated protein kinase γ-subunit isoforms and their
role in AMP binding. Biochem. J. 346:659-669.
Coleman, R. A. and D. P. Lee. 2004. Enzymes of triacylglycerol synthesis and their
regulation. Prog. Lipid Res. 43:134-176.
Collins, Q. F., H. Y. Liu, J. B. Pi, Z. Q. Liu, M. J. Quon, and W. H. Cao. 2007.
Epigallocatechin-3-gallate (EGCG), a green tea polyphenol, suppresses hepatic
gluconeogenesis through 5 '-AMP-activated protein kinase. J. Biol. Chem.
282:30143-30149.
Corton, J. M., J. G. Gillespie, S. A. Hawley, and D. G. Hardie. 1995. 5-aminoimidazole-
4-carboxamide ribonucleoside: A specific method for activating protein kinase in
intact cells? Eur. J. Biochem. 229:558-565.
Darimont, C., O. Avanti, I. Zbinden, P. Leone-Vautravers, R. Mansourian, V. Giusti, and
K. Mace. 2006. Liver x receptor preferentially activates de novo lipogenesis in
human preadipocytes. Biochim. 88:309-318.
Davies, S. P., A. T. R. Sim, and D. G. Hardie. 1990. Location and function of three sites
phosphorylated on rat acetyl-CoA carboxylase by the AMP-activated protein
kinase. Eur. J.Biochem. 187:183-190.
Davis, C. L. and R. E. Brown. 1970. Low-fat milk syndrome. Pages 545-565 in
Physiology of digestion and metabolism in the ruminant. A. T. Phillipson, ed,
Newcastle Upon Tyne, UK.
DeBose-Boyd, R. A., M. S. Brown, W. P. Li, A. Nohturfft, J. L. Goldstein, and P. J.
Espenshade. 1999. Transport-dependent proteolysis of SREBP: Relocation of
site-1 protease from Golgi to ER obviates the need for SREBP transport to Golgi.
Cell 99:703-712.
DeBose-Boyd, R. A., J. F. Ou, J. L. Goldstein, and M. S. Brown. 2001. Expression of
sterol regulatory element-binding protein 1c (SREBP-1c) mRNA in rat hepatoma
cells requires endogenous LXR ligands. Proc. Nat. Acad. Sci. USA 98:1477-
1482.
103
Diraison, R., L. Parton, P. Ferre, F. Foufelle, C. P. Briscoe, I. Leclerc, and G. A. Rutter.
2004. Over-expression of sterol regulatory element binding protein-1c in rat
pancreatic islets induces lipogenesis and decreases glucose-stimulated insulin
release: Modulation by 5-aminoimidazole-4-carboxamide ribonucleoside.
Biochem. J. 378:769-778.
Drackley, J. K., T. H. Klusmeyer, A. M. Trusk, and J. H. Clark. 1992. Infusion of long-
chain fatty-acids varying in saturation and chain-length into the abomasum of
lactating dairy-cows. J. Dairy Sci. 75:1517-1526.
Dressel, U., T. L. Allen, J. B. Pippal, P. R. Rohde, P. Lau, and G. E. Muscat. 2003. The
peroxisome proliferator-activated receptor β/δ agonist, GW501516, regulates the
expression of genes involved in lipid catabolism and energy uncoupling in
skeletal muscle cells. Mol. Endocrinol. 17:2477-2493.
Dyck, J. R. B., G. Gao, J. Widmer, D. Stapleton, C. S. Fernandez, B. E. Kemp, and L. A.
Witters. 1996. Regulation of 5-'AMP-activated protein kinase activity by the
noncatalytic β and γ subunits. J. Biol. Chem. 271:17798-17803.
Edwards, P. A., M. A. Kennedy, and P. A. Mak. 2002. LXRs; oxysterol-activated nuclear
receptors that regulate genes controlling lipid homeostasis. Vascul. Pharmacol.
38:249-256.
Engelking, L. J., H. Kuriyama, R. E. Hammer, J. D. Horton, M. S. Brown, J. L. Goldstein,
and G. Liang. 2004. Overexpression of Insig-1 in the livers of transgenic mice
inhibits SREBP processing and reduces insulin-stimulated lipogenesis. J. Clin.
Invest. 113:1168-1175.
Erdman, R. 1996. Milk fat depression: Some new insights. In: Proceedings of Southwest
Nutrition and Management Conference, University of Arizona, Tucson, pp. 113-
125.
Ericsson, J., S. M. Jackson, J. B. Kim, B. M. Spiegelman, and P. A. Edwards. 1997.
Identification of glycerol-3-phosphate acyltransferase as an adipocyte
determination and differentiation factor 1- and sterol regulatory element-binding
protein-responsive gene. J. Biol. Chem. 272:7298-7305.
Farke, C., H. H. Meyer, R. M. Bruckmaier, and C. Albrecht. 2008a. Differential
expression of ABC transporters and their regulatory genes during lactation and
dry period in bovine mammary tissue. J. Dairy Res. 75:406-414.
104
Foretz, M., C. Pacot, I. Dugail, P. Lemarchand, C. Guichard, X. Le Liepvre, C.
Berthelier-Lubrano, B. Spiegelman, J. B. Kim, P. Ferre, and F. Foufelle. 1999.
ADD1/SREBP-1c is required in the activation of hepatic lipogenic gene
expression by glucose. Mol. Cell. Bio. 19:3760-3768.
Gaidhu, M. P., S. Fediuc, N. M. Anthony, M. So, M. Mirpourian, R. L. Perry, and R. B.
Ceddia. 2009. Prolonged AICAR-induced AMP-kinase activation promotes
energy dissipation in white adipocytes: Novel mechanisms integrating HSL and
ATGL. J. Lipid Res. 50:704-715.
Gan, X., R. Kaplan, J. G. Menke, K. MacNaul, Y. Chen, C. P. Sparrow, G. Zhou, S. D.
Wright, and T. Q. Cai. 2001. Dual mechanisms of ABCA1 regulation by
geranylgeranyl pyrophosphate. J. Biol. Chem. 276:48702-48708.
Gao, G., C. S. Fernandez, D. Stapleton, A. S. Auster, J. Widmer, J. R. B. Dyck, B. E.
Kemp, and L. A. Witters. 1996. Non-catalytic β- and γ-subunit isoforms of the 5'-
AMP-activated protein kinase. J. Biol. Chem. 271:8675-8681.
Gavrilova, O., M. Haluzik, K. Matsusue, J. J. Cutson, L. Johnson, K. R. Dietz, C. J.
Nicol, C. Vinson, F. J. Gonzalez, and M. L. Reitman. 2003. Liver PPARγ
contributes to hepatic steatosis, triglyceride clearance, and regulation of body fat
mass. J. Biol. Chem. 278:34268-34276.
Gaynor, P. J., R. A. Erdman, B. B. Teter, J. Sampugna, A. V. Capuco, D. R. Waldo, and
M. Hamosh. 1994. Milk-fat yield and composition during abomasal infusion of cis
or trans octadecenoates in Holstein cows. J. Dairy Sci. 77:157-165.
Gelman, L., G. Zhou, L. Fajas, E. Raspe, J. C. Fruchart, and J. Auwerx. 1999. p300
interacts with the n- and c-terminal part of PPARγ2 in a ligand-independent and -
dependent manner, respectively. J. Biol. Chem. 274:7681-7688.
Gerhold, D. L., F. Liu, G. Jiang, Z. Li, J. Xu, M. Lu, J. R. Sachs, A. Bagchi, A. Fridman,
D. J. Holder, T. W. Doebber, J. Berger, A. Elbrecht, D. E. Moller, and B. B.
Zhang. 2002. Gene expression profile of adipocyte differentiation and its
regulation by peroxisome proliferator-activated receptor-γ agonists. Endocrinol.
143:2106-2118.
Girard, J., D. Perdereau, F. Foufelle, C. Pripbuus, and P. Ferre. 1994. Regulation of
lipogenic enzyme gene-expression by nutrients and hormones. FASEB J. 8:36-
42.
105
Griinari, J. M., B. A. Corl, S. H. Lacy, P. Y. Chouinard, K. V. Nurmela, and D. E.
Bauman. 2000. Conjugated linoleic acid is synthesized endogenously in lactating
dairy cows by Δ(9)-desaturase. J. Nutr. 130:2285-2291.
Ha, J., S. Daniel, S. S. Broyles, and K.-H. Kim. 1994. Critical phosphorylation sites for
acetyl-CoA carboxylase activity. J. Biol. Chem. 269:22162-22168.
Habinowski, S. A. and L. A. Witters. 2001. The effects of AICAR on adipocyte
differentiation of 3T3-L1 cells. Biochem. Biophys. Res. Commun. 286:852-856.
Hansen, H. O., I. Grunnet, and J. Knudsen. 1984. Triacylglycerol synthesis in goat
mammary gland. Factors influencing the esterification of fatty acids synthesized
de novo. Biochem. J. 220:521-527.
Hansen, H. O. and J. Knudsen. 1987. Effect of exogenous long-chain fatty acids on
individual fatty acid synthesis by dispersed ruminant mammary gland cells. J.
Dairy Sci. 70:1350-1354.
Hardie, D. G. 2007. AMP-activated/SNF-1 protein kinases: Conserved guardians of
cellular energy. Nat. Rev. Mol. Cell Biol. 8:774-785.
Hardie, D. G. and D. A. Pan. 2002. Regulation of fatty acid synthesis and oxidation by
the AMP-activated protein kinase. Biochem. Soc. Trans. 30:1064-1070.
Harvatine, K. J. and D. E. Bauman. 2006. SREBP1 and thyroid hormone responsive
Spot 14 (S14) are involved in the regulation of bovine mammary lipid synthesis
during diet-induced milk fat depression and treatment with CLA. J. Nutr.
136:2468-2474.
Harvatine, K. J. and D. E. Bauman. 2007. Expression of PPAR and LXR nuclear
hormone receptor families are not modified during milk fat depression induced by
diet or treatment with trans-10, cis-12 conjugated linoleic acid (CLA). J. Dairy Sci.
90(E-Suppl. 1):M175.
Harvatine, K. J., Y. R. Boisclair, and D. E. Bauman. 2009. Recent advances in the
regulation of milk fat synthesis. Anim. 3:40-54.
Hawley, S. A., J. Boudeau, J. L. Reid, K. J. Mustard, L. Udd, T. P. Makela, D. R. Alessi,
and D. G. Hardie. 2003. Complexes between the LKB1 tumor suppressor,
STRADα/β and MO25α/β are upstream kinases in the AMP-activated protein
kinase cascade. J. Biol. 2:1-28.
106
Hawley, S. A., M. Davison, A. Woods, S. P. Davies, R. K. Beri, D. Carling, and D. G.
Hardie. 1996. Characterization of the AMP-activated protein kinase kinase from
rat liver and identification of threonine 172 as the major site at which it
phosphorylates AMP-activated protein kinase. J. Biol. Chem. 271:27879-27887.
Hawley, S. A., D. A. Pan, K. J. Mustard, L. Ross, J. Bain, A. M. Edelman, B. G.
Frenguelli, and D. G. Hardie. 2005. Calmodulin-dependent protein kinase kinase-
β is an alternative upstream kinase for AMP-activated protein kinase. Cell Metab.
2:9-19.
Henin, N., M. F. Vincent, H. E. Gruber, and B. J. Van Denderen. 1995. Inhibition of fatty
acid and cholesterol synthesis by stimulation of AMP-activated protein kinase.
FASEB J. 9:541-546.
Hertzel, A. V. and D. A. Bernlohr. 2000. The mammalian fatty acid-binding protein
multigene family: Molecular and genetic insights into function. Trends Endocrinol.
Metab. 11:175-180.
Horton, J. D., J. L. Goldstein, and M. S. Brown. 2002. SREBPs: activators of the
complete program of cholesterol and fatty acid synthesis in the liver. J. Clin.
Invest. 109:1125-1131.
Houck, K. A., K. M. Borchert, C. D. Hepler, J. S. Thomas, K. S. Bramlett, L. F. Michael,
and T. P. Burris. 2004. T0901317 is a dual LXR/FXR agonist. Mol. Genet. Metab.
83:184-187.
Hua, X. X., J. Wu, J. L. Goldstein, M. S. Brown, and H. H. Hobbs. 1995. Structure of the
human gene encoding sterol regulatory element-binding protein-1 (SREBF1) and
localization of SREBF1 and SREBF2 to chromosomes 17p11.2 and 22q13.
Genomics 25:667-673.
Hudson, E. R., D. A. Pan, J. James, J. M. Lucocq, S. A. Hawley, K. A. Green, O. Baba,
T. Terashima, and D. G. Hardie. 2003. A novel domain in AMP-activated protein
kinase causes glycogen storage bodies similar to those seen in hereditary
cardiac arrhythmias. Curr. Biol. 13:861-866.
Hurley, R. L., K. A. Anderson, J. M. Franzone, B. E. Kemp, A. R. Means, and L. A.
Witters. 2005. The Ca(2+)/calmodulin-dependent protein kinase kinases are
AMP-activated protein kinase kinases. J. Biol. Chem. 280:29060-29066.
Huynh, H. T., G. Robitaille, and J. D. Turner. 1991. Establishment of bovine mammary
epithelial-cells (MAC-T) - an in vitro model for bovine lactation. Exp. Cell
Res.197:191-199.
107
Ingle, D. L., D. E. Bauman, R. W. Mellenberger, and D. E. Johnson. 1973. Lipogenesis
in the ruminant: Effect of fasting and refeeding on fatty acid synthesis and
enzymatic activity of sheep adipose tissue. J. Nutr. 103:1479-1488.
Ip, M. M., P. A. Masso-Welch, S. F. Shoemaker, W. K. Shea-Eaton, and C. Ip. 1999.
Conjugated linoleic acid inhibits proliferation and induces apoptosis of normal rat
mammary epithelial cells in primary culture. Exp. Cell Res. 250:22-34.
Iseli, T. J., M. Walter, B. J. van Denderen, F. Katsis, L. A. Witters, B. E. Kemp, B. J.
Michell, and D. Stapleton. 2005. AMPK beta subunit tethers alpha and gamma
subunits via its c-terminal sequence(186-270). J. Biol. Chem. 280:13395-13400.
Janowski, B. A., M. J. Grogan, S. A. Jones, G. B. Wisely, S. A. Kliewer, E. J. Corey, and
D. J. Mangelsdorf. 1999. Structural requirements of ligands for the oxysterol liver
x receptors LXRα and LXRβ. Proc. Natl. Acad. Sci. USA 96:266-271.
Jayan, G. C. and J. H. Herbein. 2000. "Healthier" dairy fat using trans-vaccenic acid.
Nutr. Food Sci. 30:304-309.
Jensen, R. G. 2002. The composition of bovine milk lipids: January 1995 to December
2000. J. Dairy Sci. 85:295-350.
Joseph, S. B., B. A. Laffitte, P. H. Patel, M. A. Watson, K. E. Matsukuma, R. Walczak, J.
L. Collins, T. F. Osborne, and P. Tontonoz. 2002. Direct and indirect
mechanisms for regulation of fatty acid synthase gene expression by liver x
receptors. J. Biol. Chem. 277:11019-11025.
Kadegowda, K. G., M. Bionaz, L. S. Piperova, R. A. Erdman, and J. J. Loor. 2008.
Lipogenic gene expression in MAC-T cells is affected differently by fatty acids
and enhanced by PPAR-gamma activation. J. Dairy Sci. 91(E-Suppl. 1):678.
Kahn, B. B., T. Alquier, D. Carling, and D. G. Hardie. 2005. AMP-activated protein
kinase: Ancient energy gauge provides clues to modern understanding of
metabolism. Cell Metab. 1:15-25.
Kast-Woelbern, H. R., S. L. Dana, R. M. Cesario, L. Sun, L. Y. de Grandpre, M. E.
Brooks, D. L. Osburn, A. Reifel-Miller, K. Klausing, and M. D. Leibowitz. 2004.
Rosiglitazone induction of Insig-1 in white adipose tissue reveals a novel
interplay of peroxisome proliferator-activated receptor γ and sterol regulatory
element-binding protein in the regulation of adipogenesis. J. Biol. Chem.
279:23908-23915.
108
Katz, I. and M. Keeney. 1966. Characterization of the octadecenoic acids in rumen
digesta and rumen bacteria. J. Dairy Sci. 49:962-966.
Keating, A. F., F. Q. Zhao, K. A. Finucane, D. R. Glimm, and J. J. Kennelly. 2008. Effect
of conjugated linoleic acid on bovine mammary cell growth, apoptosis and
stearoyl Co-A desaturase gene expression. Domest. Anim. Endocrinol. 34:284-
292.
Kim, J. B., P. Sarraf, M. Wright, K. M. Yao, E. Mueller, G. Solanes, B. B. Lowell, and B.
M. Spiegelman. 1998. Nutritional and insulin regulation of fatty acid synthetase
and leptin gene expression through ADD1/SREBP1. J. Clin. Invest. 101:1-9.
Kim, J. B., H. M. Wright, M. Wright, and B. M. Spiegelman. 1996. ADD1/SREBP1 activates PPARγ through the production of endogenous ligand. Proc. Natl. Acad. Sci. USA 95:4333-4337.
Kim, K. H. 1997. Regulation of mammalian acetyl-coenzyme A carboxylase. Annu. Rev.
Nutr. 17:77-99.
Kim, S. J., C. Nian, and C. H. McIntosh. 2007. Activation of lipoprotein lipase by
glucose-dependent insulinotropic polypeptide in adipocytes. A role for a protein
kinase B, LKB1, and AMP-activated protein kinase cascade. J. Biol. Chem.
282:8557-8567.
Kinsella, J. E. and M. Gross. 1973. Palmitic acid and initiation of mammary glyceride
synthesis via phosphatidic acid. Biochim. Biophys. Acta. 316:109-113.
Kishi, K., T. Yuasa, A. Minami, M. Yamada, A. Hagi, H. Hayashi, B. E. Kemp, L. A.
Witters, and Y. Ebina. 2000. AMP-activated protein kinase is activated by the
stimulations of G(q)-coupled receptors. Biochem. Biophys. Res.
Commun.276:16-22.
Knudsen, J., T. B. Neergaard, B. Gaigg, M. V. Jensen, and J. K. Hansen. 2000. Role of
acyl-CoA binding protein in acyl-CoA metabolism and acyl-CoA-mediated cell
signaling. J. Nutr. 130:294S-298S.
Krey, G., O. Braissant, F. L’Horset, E. Kalkhoven, M. Perroud, M. G. Parker, and W.
Wahli. 1997. Fatty acids, eicosanoids, and hypolipidemic agents identified as
ligands of peroxisome proliferator-activated receptors by coactivator-dependent
receptor ligand assay. Mol. Endocrinol. 11:779-791.
Labarca, C. and K. Paigen. 1980. Simple, rapid, and sensitive DNA assay procedure.
Anal. Biochem. 102:344-352.
109
Lacount, D. W., J. K. Drackley, S. O. Laesch, and J. H. Clark. 1994. Secretion of oleic-
acid in milk-fat in response to abomasal infusions of canola or high oleic
sunflower fatty-acids. J. Dairy Sci. 77:1372-1385.
LaRosa, J. C., D. Hunninghake, D. Bush, M. H. Criqui, G. S. Getz, A. M. Gotto, Jr., S.
M. Grundy, L. Rakita, R. M. Robertson, M. L. Weisfeldt. 1990. The cholesterol
facts. A summary of the evidence relating dietary fats, serum cholesterol, and
coronary heart disease. A joint statement by the American Heart Association and
the National Heart, Lung, and Blood Institute. The task force on cholesterol
issues, American Heart Association. Circulation 81:1721-1733.
Lee, C. H., A. Chawla, N. Urbiztondo, D. Liao, W. A. Boisvert, and R. M. Evans. 2003.
Transcriptional repression of atherogenic inflammation: Modulation by PPARδ.
Science 302:453-457.
Lee, S. S. T., T. Pineau, J. Drago, E. J. Lee, J. W. Owens, D. L. Kroetz, P. M.
Fernandezsalguero, H. Westphal, and F. J. Gonzalez. 1995. Targeted disruption
of the α-isoform of the peroxisome proliferator-activated receptor gene in mice
results in abolishment of the pleiotropic effects of peroxisome proliferators. Mol.
Cell. Biol. 15:3012-3022.
Lee, W. J., M. Kim, H. S. Park, H. S. Kim, M. J. Jeon, K. S. Oh, E. H. Koh, J. C. Won,
M. S. Kim, G. T. Oh, M. Yoon, K. U. Lee, and J. Y. Park. 2006. AMPK activation
increases fatty acid oxidation in skeletal muscle by activating PPARα and PGC-1.
Biochem. Biophys. Res. Commun. 340:291-295.
Lehmann, J. M., S. A. Kliewer, L. B. Moore, T. A. SmithOliver, B. B. Oliver, J. L. Su, S.
S. Sundseth, D. A. Winegar, D. E. Blanchard, T. A. Spencer, and T. M. Willson.
1997. Activation of the nuclear receptor LXR by oxysterols defines a new
hormone response pathway. J. Biol. Chem. 272:3137-3140.
Liang, G. S., J. Yang, J. D. Horton, R. E. Hammer, J. L. Goldstein, and M. S. Brown.
2002. Diminished hepatic response to fasting/refeeding and liver x receptor
agonists in mice with selective deficiency of sterol regulatory element-binding
protein-1c. J. Biol. Chem. 277:9520-9528.
Liesman, J. S., R. S. Emery, R. M. Akers, and H. A. Tucker. 1988. Mammary lipoprotein
lipase in plasma of cows after parturition or prolactin infusion. Lipids 23:504-507.
Livak, K. J. and T. D. Schmittgen. 2001. Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-ΔΔc)(T) method. Methods 25:402-408.
110
Lizcano, J. M., O. Goransson, R. Toth, M. Deak, N. A. Morrice, J. Boudeau, S. A.
Hawley, L. Udd, T. P. Makela, D. G. Hardie, and D. R. Alessi. 2004. LKB1 is a
master kinase that activates 13 kinases of the AMPK subfamily, including
MARK/PAR-1. EMBO J. 23:833-843.
Loor, J. J. and J. H. Herbein. 1998. Exogenous conjugated linoleic acid isomers reduce
bovine milk fat concentration and yield by inhibiting de novo fatty acid synthesis.
J. Nutr. 128:2411-2419.
Lopez, J. M., M. K. Bennett, H. B. Sanchez, J. M. Rosenfeld, and T. F. Osborne. 1996.
Sterol regulation of acetyl coenzyme A carboxylase: A mechanism for coordinate
control of cellular lipid. Proc. Natl. Acad. Sci. USA 93:1049-1053.
Magana, M. M. and T. F. Osborne. 1996. Two tandem binding sites for sterol regulatory
element binding proteins are required for sterol regulation of fatty-acid synthase
promoter. J. Biol. Chem. 271:32689-32694.
Mahlapuu, M., C. Johansson, K. Lindgren, G. Hjalm, B. R. Barnes, A. Krook, J. R.
Zierath, L. Andersson, and S. Marklund. 2004. Expression profiling of the γ-
subunit isoforms of AMP-activated protein kinase suggests a major role for γ3 in
white skeletal muscle. Am. J. Physiol. Endocrinol. Metab. 286:E194-E200.
Martin, G., K. Schoonjans, A. M. Lefebvre, B. Staels, and J. Auwerx. 1997. Coordinate
regulation of the expression of the fatty acid transport protein and acyl-CoA
synthetase genes by PPARα and PPARγ activators. J. Biol. Chem. 272:28210-
28217.
Mascaro, C., E. Acosta, J. A. Ortiz, P. F. Marrero, F. G. Hegardt, and D. Haro. 1998.
Control of human muscle-type carnitine palmitoyltransferase I gene transcription
by peroxisome proliferator-activated receptor. J. Biol. Chem. 273:8560-8563.
Mashek, D. G. and R. A. Coleman. 2006. Cellular fatty acid uptake: The contribution of
metabolism. Curr. Opin. Lipidol. 17:274-278.
McPherson, R. and A. Gauthier. 2004. Molecular regulation of SREBP function: The
Insig-SCAP connection and isoform-specific modulation of lipid synthesis.
Biochem. Cell Biol. 82:201-211.
Merrill, G. F., E. J. Kurth, D. G. Hardie, and W. W. Winder. 1997. AICA riboside
increases AMP-activated protein kinase, fatty acid oxidation, and glucose uptake
in rat muscle. Am. J. Physiol. 273:E1107-E1112.
111
Minokoshi, Y., Y.-B. Kim, O. D. Peroni, L. G. D. Fryer, C. Muller, D. Carling, and B. B.
Kahn. 2002. Leptin stimulates fatty-acid oxidation by activating AMP-activated
protein kinase.Nature 415:339-343.
Minokoshi, Y., T. Alquier, N. Furukawa, Y. B. Kim, A. Lee, B. Z. Xue, J. Mu, F. Foufelle,
P. Ferre, M. J. Birnbaum, B. J. Stuck, and B. B. Kahn. 2004. AMP-kinase
regulates food intake by responding to hormonal and nutrient signals in the
hypothalamus. Nature 428:569-574.
Montanaro, M. A., M. S. Gonzalez, A. M. Bernasconi, and R. R. Brenner. 2007. Role of
liver x receptor, insulin and peroxisome proliferator activated receptor-α on in
vivo desaturase modulation of unsaturated fatty acid biosynthesis. Lipids 42:197-
210.
Mu, J., J. T. Brozinick, O. Valladares, M. Bucan, and M. J. Birnbaum. 2001. A role for
AMP-activated protein kinase in contraction- and hypoxia-regulated glucose
transport in skeletal muscle. Mol. Cell 7:1085-1094.
Munday, M. R., D. G. Campbell, D. Carling, and D. G. Hardie. 1988. Identification by
amino acid sequencing of three major regulatory phosphorylation sites on rat
acetyl-CoA carboxylase. Eur. J. Biochem. 175:331-338.
Muoio, D. M., K. Seefeld, L. A. Witters, and R. A. Coleman. 1999. AMP-activated kinase
reciprocally regulates triacylglycerol synthesis and fatty acid oxidation in liver and
muscle: Evidence that sn-glycerol-3-phosphate acyltransferase is a novel target.
Biochem. J. 338:783-791.
Noakes, M., P. J. Nestel, and P. M. Clifton. 1996. Modifying the fatty acid profile of dairy
products through feedlot technology lowers plasma cholesterol of humans
consuming the products. Am. J. Clin. Nutr. 63:42-46.
Oliver, W. R., J. L. Shenk, M. R. Snaith, C. S. Russell, K. D. Plunket, N. L. Bodkin, M. C.
Lewis, D. A. Winegar, M. L. Sznaidman, M. H. Lambert, H. E. Xu, D. D.
Sternbach, S. A. Kliewer, B. C. Hansen, and T. M. Willson. 2001. A selective
peroxisome proliferator-activated receptor δ agonist promotes reverse
cholesterol transport. Proc. Natl. Acad. Sci. USA 98:5306-5311.
Ou, J. F., H. Tu, B. Shan, A. Luk, R. A. DeBose-Boyd, Y. Bashmakov, J. L. Goldstein,
and M. S. Brown. 2001. Unsaturated fatty acids inhibit transcription of the sterol
regulatory element-binding protein-1c (SREBP-1c) gene by antagonizing ligand-
dependent activation of the LXR. Proc. Natl. Acad. Sci. USA 98:6027-6032.
112
Palmquist, D. L., C. Davis, R. Brown, and D. Sachan. 1969. Availability and metabolism
of various substrates in ruminants. Entry rate into the body and incorporation into
milk fat of D(-)β-hydroxybutyrate. J. Dairy Sci. 52:633-638.
Palmquist, D. L., A. D. Beaulieu, and D. M. Barbano. 1993. Feed and animal factors
influencing milk-fat composition. J. Dairy Sci. 76:1753-1771.
Palmquist, D. L. 2006. Milk fat: Origin of fatty acids and influence of nutritional factors
thereon. Pages 43–91 in Advanced Dairy Chemistry Vol. 2: Lipids. P. F. Fox and
P. L. H. McSweeney, ed. Springer, New York, NY.
Pande, S. V. and J. F. Mead. 1968. Inhibition of enzyme activities by free fatty acids. J.
Biol. Chem. 243:6180-6185.
Park, H., V. K. Kaushik, S. Constant, M. Prentki, E. Przybytkowski, N. B. Ruderman,
and A. K. Saha. 2002a. Coordinate regulation of malonyl-CoA decarboxylase, sn-
glycerol-3-phosphate acyltransferase, and acetyl-CoA carboxylase by AMP-
activated protein kinase in rat tissues in response to exercise. J. Biol. Chem.
277:32571-32577.
Park, S. H., S. R. Gammon, J. D. Knippers, S. R. Paulsen, D. S. Rubink, and W. W.
Winder. 2002b. Phosphorylation-activity relationships of AMPK and acetyl-CoA
carboxylase in muscle. J. Appl. Physiol. 92:2475-2482.
Parodi, P. W. 1997. Cows' milk fat components as potential anticarcinogenic agents. J.
Nutr. 127:1055-1060.
Peet, D. J., B. A. Janowski, and D. J. Mangelsdorf. 1998a. The LXRs: A new class of
oxysterol receptors. Curr. Opin. Genet. Dev. 8:571-575.
Peet, D. J., S. D. Turley, W. Ma, B. A. Janowski, J. M. Lobaccaro, R. E. Hammer, and
D. J. Mangelsdorf. 1998b. Cholesterol and bile acid metabolism are impaired in
mice lacking the nuclear oxysterol receptor LXRα. Cell 93:693-704.
Perfield, J. W., A. L. Lock, J. M. Griinari, A. Saebo, P. Delmonte, D. A. Dwyer, and D. E.
Bauman. 2007. Trans-9, cis-11 conjugated linoleic acid reduces milk fat
synthesis in lactating dairy cows. J. Dairy Sci. 90:2211-2218.
Peterson, D. G., E. A. Matitashvili, and D. E. Bauman. 2004. The inhibitory effect of
trans-10, cis-12 CLA on lipid synthesis in bovine mammary epithelial cells
involves reduced proteolytic activation of the transcription factor SREBP-1. J.
Nutr. 134:2523-2527.
113
Piperova, L. S., J. Sampugna, B. B. Teter, K. F. Kalscheur, M. P. Yurawecz, Y. Ku, K.
M. Morehouse, and R. A. Erdman. 2002. Duodenal and milk trans octadecenoic
acid and conjugated linoleic acid (CLA) isomers indicate that postabsorptive
synthesis is the predominant source of cis-9-containing CLA in lactating dairy
cows. J. Nutr. 132:1235-1241.
Rasmussen, J. T., T. Borchers, and J. Knudsen. 1990. Comparison of the binding
affinities of acyl-CoA-binding protein and fatty-acid-binding protein for long-chain
acyl-CoA esters. Biochem. J. 265:849-855.
Repa, J. J., G. Liang, J. Ou, Y. Bashmakov, J. M. Lobaccaro, I. Shimomura, B. Shan,
M. S. Brown, J. L. Goldstein, and D. J. Mangelsdorf. 2000. Regulation of mouse
sterol regulatory element-binding protein-1c gene (SREBP-1c) by oxysterol
receptors, LXRα and LXRβ. Genes Dev. 14:2819-2830.
Rudolph, M. C., J. L. McManaman, T. Phang, T. Russell, D. J. Kominsky, N. J. Serkova,
T. Stein, S. M. Anderson, and M. C. Neville. 2007. Metabolic regulation in the
lactating mammary gland: A lipid synthesizing machine. Physiol. Genomics
28:323-336.
Saebo, A., P. C. Saebo, J. M. Griinari, and K. J. Shingfield. 2005. Effect of abomasal
infusions of geometric isomers of 10,12 conjugated synthesis linoleic acid on milk
fat in dairy cows. Lipids 40:823-832.
Sakamoto, K., A. McCarthy, D. Smith, K. A. Green, D. G. Hardie, A. Ashworth, and D.
R. Alessi. 2005. Deficiency of LKB1 in skeletal muscle prevents AMPK activation
and glucose uptake during contraction. EMBO J. 24:1810-1820.
Salt, I. P., G. Johnson, S. J. H. Ashcroft, and D. G. Hardie. 1998. AMP-activated protein
kinase is activated by low glucose in cell lines derived from pancreatic β cells,
and may regulate insulin release. Biochem. J. 335:533-539.
Schoonjans, K., J. Peinado-Onsurbe, A. M. Lefebvre, R. A. Heyman, M. Briggs, S.
Deeb, B. Staels, and J. Auwerx. 1996a. PPARα and PPARγ activators direct a
distinct tissue-specific transcriptional response via a PPRE in the lipoprotein
lipase gene. EMBO J. 15:5336-5348.
Schoonjans, K., B. Staels, and J. Auwerx. 1996b. Role of the peroxisome proliferator-
activated receptor (PPAR) in mediating the effects of fibrates and fatty acids on
gene expression. J. Lipid Res. 37:907-925.
114
Schultz, J. R., H. Tu, A. Luk, J. J. Repa, J. C. Medina, L. Li, S. Schwendner, S. Wang,
M. Thoolen, D. J. Mangelsdorf, K. D. Lustig, and B. Shan. 2000. Role of LXRs in
control of lipogenesis. Genes Dev. 14:2831-2838.
Sfeir, Z., A. Ibrahimi, E. Amri, P. Grimaldi, and N. Abumrad. 1997. Regulation of
FAT/CD36 gene expression: Further evidence in support of a role of the protein
in fatty acid binding/transport. Prostaglandins Leukot. Essent. Fatty Acids 57:17-
21.
Shaw, R. J., M. Kosmatka, N. Bardeesy, R. L. Hurley, L. A. Witters, R. A. DePinho, and
L. C. Cantley. 2004. The tumor suppressor LKB1 kinase directly activates AMP-
activated kinase and regulates apoptosis in response to energy stress. Proc. Nat.
Acad. Sci. USA 101:3329-3335..
Shen, Q. W. W., M. J. Zhu, J. F. Tong, J. Ren, and M. Du. 2007b. Ca(2+)/calmodulin-
dependent protein kinase kinase is involved in AMP-activated protein kinase
activation by α-lipoic acid in C2C12 myotubes. Am. J. Physiol. Cell Physiol.
293:C1395-C1403.
Shimano, H., J. D. Horton, I. Shimomura, R. E. Hammer, M. S. Brown, and J. L.
Goldstein. 1997. Isoform 1c of sterol regulatory element binding protein is less
active than isoform 1a in livers of transgenic mice and in cultured cells. J. Clin.
Invest. 99:846-854.
Shimomura, I., H. Shimano, J. D. Horton, J. L. Goldstein, and M. S. Brown. 1997.
Differential expression of exons 1a and 1c in mRNAs for sterol regulatory
element binding protein-1 in human and mouse organs and cultured cells. J. Clin.
Invest. 99:838-845.
Shirley, J. E., R. S. Emery, E. M. Convey, and W. D. Oxender. 1973. Enzymic changes
in bovine adipose and mammary tissue, serum and mammary tissue hormonal
changes with initiation of lactation. J. Dairy Sci. 56:569-574.
Song, C., J. M. Kokontis, R. A. Hiipakka, and S. S. Liao. 1994. Ubiquitous receptor: A
receptor that modulates gene activation by retinoic acid and thyroid-hormone
receptors. Proc. Nat. Acad. Sci. USA 91:10809-10813.
Stapleton, D., K. I. Mitchelhill, G. Gao, J. Widmer, B. J. Michell, T. Teh, T. Cox, L. A.
Witters, and B. E. Kemp. 1996. Mammalian AMP-activated protein kinase
subfamily. J. Biol. Chem. 271:611-614.
Steel, W. R. C. Noble, and J. H. Moore. 1971. The effects of dietary soybean oil on milk-
fat composition in the cow. J. Dairy. Res. 38:49-56.
115
Stephens, T. J., Z. P. Chen, B. J. Canny, B. J. Michelle, B. E. Kemp, and G. K.
McConell. 2002. Progressive increase in human skeletal muscle AMPKα2 activity
and ACC phosphorylation during exercise. Am. J. Physiol. Endocrinol. Metab.
282:E688-E694.
Stoeckman, A. K. and H. C. Towle. 2002. The role of SREBP-1c in nutritional regulation
of lipogenic enzyme gene expression. J. Biol. Chem. 277:27029-27035.
Storry, J. E. and J. A. F. Rook. 1965. The effects of a diet low in hay and high in flaked
maize on milk-fat secretion and on the concentration of certain constituents in
blood plasma. Br. J. Nutr. 19:101-109.
Talukdar, S. and F. B. Hillgartner. 2006. The mechanism mediating the activation of
acetyl-Coenzyme A carboxylase-α gene transcription by the liver x receptor
agonist T0-901317. J. Lipid Res. 47:2451-2461.
Tamas, P., S. A. Hawley, R. G. Clarke, K. J. Mustard, K. Green, D. G. Hardie, and D. A.
Cantrell. 2006. Regulation of the energy sensor amp-activated protein kinase by
antigen receptor and Ca(2+) in T lymphocytes. J. Exp. Med. 203:1665-1670.
Tanaka, T., J. Yamamoto, S. Iwasaki, H. Asaba, H. Hamura, Y. Ikeda, M. Watanabe, K.
Magoori, R. X. Ioka, K. Tachibana, Y. Watanabe, Y. Uchiyama, K. Sumi, H.
Iguchi, S. Ito, T. Doi, T. Hamakubo, M. Naito, J. Auwerx, M. Yanagisawa, T.
Kodama, and J. Sakai. 2003. Activation of peroxisome proliferator-activated
receptor δ induces fatty acid β-oxidation in skeletal muscle and attenuates
metabolic syndrome. Proc. Nat. Acad. Sci. USA 100:15924-15929.
Thampy, T. G. and S. J. Wakil. 1986. The role of protein phosphorylation in the
regulation of acetyl-CoA carboxylase. Adv. Prot. Phosphatases 3:257-270.
Thornton, C., M. A. Snowden, and D. Carling. 1998. Identification of a novel AMP-
activated protein kinase β subunit isoform that is highly expressed in skeletal
muscle. J. Biol. Chem. 273:12443-12450.
Verhoeven, A. J. M., A. Woods, C. H. Brennan, S. A. Hawley, D. G. Hardie, J. Scott, R.
K. Beri, and D. Carling. 1995. The AMP-activated protein kinase gene is highly
expressed in rat skeletal muscle. Eur. J. Biochem. 228:236-243.
Vo, N. and R. H. Goodman. 2001. CREB-binding protein and p300 in transcriptional
regulation. J. Biol. Chem. 276:13505-13508.
Wakil, S., J. K. Stroops, and V. C. Joshi. 1983. Fatty acid synthesis and its regulation.
Annu. Rev. Biochem. 52:537-579.
116
Wang, N., D. Lan, W. Chen, F. Matsuura, and A. R. Tall. 2004. ATP-binding cassette
transporters G1 and G4 mediate cellular cholesterol efflux to high-density
lipoproteins. Proc. Natl. Acad. Sci. USA 101:9774-9779.
Westerink, W. M. and W. G. Schoonen. 2007. Cytochrome P450 enzyme levels in
HepG2 cells and cryopreserved primary human hepatocytes and their induction
in HepG2 cells. Toxicol. In Vitro 21:1581-1591.
Wilde, C. J., A. J. Henderson, and C. H. Knight. 1986. Metabolic adaptations in goat
mammary tissue during pregnancy and lactation. J. Reprod. Fert. 76:289-298.
Willy, P. J., K. Umesono, E. S. Ong, R. M. Evans, R. A. Heyman, and D. J.
Mangelsdorf. 1995. LXR, a nuclear receptor that defines a distinct retinoid
response pathway. Genes Dev. 9:1033-1045.
Winder, W. W. and D. G. Hardie. 1996. Inactivation of acetyl-CoA carboxylase and
activation of AMP-activated protein kinase in muscle during exercise. Am. J.
Physiol. 270:E299-E304.
Winder, W. W., H. A. Wilson, D. G. Hardie, B. B. Rasmussen, C. A. Hutber, G. B. Call,
R. D. Clayton, L. M. Conley, S. Yoon, and B. Zhou. 1997. Phosphorylation of rat
muscle acetyl-CoA carboxylase by AMP-activated protein kinase and protein
kinase A. J. Appl. Physiol. 82:219-225.
Woods, A., P. C. F. Cheung, F. C. Smith, M. D. Davison, J. Scott, R. K. Beri, and D.
Carling. 1996. Characterization of AMP-activated protein kinase β and γ
subunits. J. Biol. Chem. 271:10282-10290.
Woods, A., S. R. Johnstone, K. Dickerson, F. C. Leiper, L. G. D. Fryer, D. Neumann, U.
Schlattner, T. Wallimann, M. Carlson, and D. Carling. 2003. LKB1 is the
upstream kinase in the AMP-activated protein kinase cascade. Curr. Biol.
13:2004-2008.
Woods, A., K. Dickerson, R. Heath, S. P. Hong, M. Momcilovic, S. R. Johnstone, M.
Carlson, and D. Carling. 2005. Ca(2+)/calmodulin-dependent protein kinase
kinase-β acts upstream of AMP-activated protein kinase in mammalian cells. Cell
Metab. 2:21-33.
Wright, T. C., J. P. Cant, and B. W. McBride. 2002. Inhibition of fatty acid synthesis in
bovine mammary homogenate by palmitic acid is not a detergent effect. J. Dairy
Sci. 85:642-647.
117
Xu, J., M. Teran-Garcia, J. H. Park, M. T. Nakamura, and S. D. Clarke. 2001.
Polyunsaturated fatty acids suppress hepatic sterol regulatory element-binding
protein-1 expression by accelerating transcript decay. J. Biol. Chem. 276:9800-
9807.
Yang, W., Y. H. Hong, X. Q. Shen, C. Frankowski, H. S. Camp, and T. Leff. 2001.
Regulation of transcription by AMP-activated protein kinase. Phosphorylation of
p300 blocks its interaction with nuclear receptors. J. Biol. Chem. 276:38341-
38344.
Yoshikawa, T., H. Shimano, M. Amemiya-Kudo, N. Yahagi, A. H. Hasty, T. Matsuzaka,
K. Okazaki, Y. Tamura, Y. Iizuka, K. Ohashi, J. I. Osuga, K. Harada, T. Gotoda,
S. Kimura, S. Ishibashi, and N. Yamada. 2001. Identification of liver x receptor-
retinoid x receptor as an activator of the sterol regulatory element-binding protein
1c gene promoter. Mol. Cell. Biol. 21:2991-3000.
Yoshikawa, T., H. Shimano, N. Yahagi, T. Ide, M. Amemiya-Kudo, T. Matsuzaka, M.
Nakakuki, S. Tomita, H. Okazaki, Y. Tamura, Y. Iizuka, K. Ohashi, A. Takahashi,
H. Sone, J. Osuga, T. Gotoda, S. Ishibashi, and N. Yamada. 2002.
Polyunsaturated fatty acids suppress sterol regulatory element-binding protein 1c
promoter activity by inhibition of liver x receptor (LXR) binding to LXR response
elements. J. Biol. Chem. 277:1705-1711.
You, M., M. Matsumoto, C. M. Pacold, W. K. Cho, and D. W. Crabb. 2004. The role of
AMP-activated protein kinase in the action of ethanol in the liver.
Gastroenterology 127:1798-1808.
Zavizion, B., M. van Duffelen, W. Schaeffer, and I. Politis. 1996. Establishment and
characterization of a bovine mammary epithelial cell line with unique properties.
In Vitro Cell Dev. Biol. Anim. 32:138-148.
Zhou, G., R. Myers, L. Ying, Y. Chen, X. Shen, J. Fenyk-Melody, M. Wu, J. Ventre, T.
Doebber, N. Fujii, N. Musi, M. F. Hirshman, L. J. Goodyear, and D. E. Moller.
2001. Role of AMP-acitvated protein kinase in mechanism of metformin action. J.
Clin. Invest. 108:1167-1174.
Zou, M. H., X. Y. Hou, C. M. Shi, S. Kirkpatick, F. Liu, M. H. Goldman, and R. A. Cohen.
2003. Activation of 5'-AMP-activated kinase is mediated through c-Src and
phosphoinositide 3-kinase activity during hypoxia-reoxygenation of bovine aortic
endothelial cells. J. Biol. Chem. 278:34003-34010.
top related