gene feature recognition

NUS-KI Course on Bioinformatics, Nov 2005

For written notes on this lecture, please read Chapters 4 and 7 of The Practical Bioinformatician

Gene Feature Recognition

Limsoon Wong

Recognition of Splice Sites

A simple example to start the day

Splice Sites

AcceptorDonor

Acceptor Site (Human Genome)

• If we align all known acceptor sites (with their splice junction site aligned), we have the following nucleotide distribution

• Acceptor site: CAG | TAG | coding regionImage credit: Xu

Donor Site (Human Genome)

• If we align all known donor sites (with their splice junction site aligned), we have the following nucleotide distribution

• Donor site: coding region | GTImage credit: Xu

What Positions Have “High” Information Content?

• For a weight matrix, information content of each column is calculated as

– X{A,C,G,T} Prob(X)*log (Prob(X)/0.25)

• When a column has evenly distributed nucleotides, its information content is lowest

• Only need to look at positions having high information content

Information Content Around Donor Sites in Human Genome

• Information content column –3 = – .34*log (.34/.25) – .363*log

(.363/.25) – .183* log (.183/.25) – .114* log (.114/.25) = 0.04

column –1 = – .092*log (.92/.25) – .03*log (.033/.25) – .803* log (.803/.25) – .073* log (.73/.25) = 0.30

Image credit: Xu

Weight Matrix Model for Splice Sites

• Weight matrix model – build a weight matrix for donor, acceptor,

translation start site, respectively– use positions of high information content

Image credit: Xu

Splice Site Prediction: A Procedure

• Add up freq of corr letter in corr positions:

• Make prediction on splice site based on some threshold

AAGGTAAGT: .34 + .60 + .80 +1.0 + 1.0 + .52 + .71 + .81 + .46 = 6.24

TGTGTCTCA: .11 + .12 + .03 +1.0 + 1.0 + .02 + .07 + .05 + .16 = 2.56

Image credit: Xu

Recognition of Translation Initiation Sites

An introduction to the World’s simplest TIS recognition system

A simple approach to accuracy and understandability

Translation Initiation Site

A Sample cDNA

• What makes the second ATG the TIS?

299 HSU27655.1 CAT U27655 Homo sapiensCGTGTGTGCAGCAGCCTGCAGCTGCCCCAAGCCATGGCTGAACACTGACTCCCAGCTGTG 80CCCAGGGCTTCAAAGACTTCTCAGCTTCGAGCATGGCTTTTGGCTGTCAGGGCAGCTGTA 160GGAGGCAGATGAGAAGAGGGAGATGGCCTTGGAGGAAGGGAAGGGGCCTGGTGCCGAGGA 240CCTCTCCTGGCCAGGAGCTTCCTCCAGGACAAGACCTTCCACCCAACAAGGACTCCCCT............................................................ 80................................iEEEEEEEEEEEEEEEEEEEEEEEEEEE 160EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE 240EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE

Approach

• Training data gathering• Signal generation

– k-grams, distance, domain know-how, ...• Signal selection

– Entropy, 2, CFS, t-test, domain know-how...• Signal integration

– SVM, ANN, PCL, CART, C4.5, kNN, ...

Training & Testing Data

• Vertebrate dataset of Pedersen & Nielsen [ISMB’97]

• 3312 sequences• 13503 ATG sites• 3312 (24.5%) are TIS• 10191 (75.5%) are non-TIS• Use for 3-fold x-validation expts

Signal Generation

• K-grams (ie., k consecutive letters)– K = 1, 2, 3, 4, 5, …– Window size vs. fixed position– Up-stream, downstream vs. any where in window– In-frame vs. any frame

A C G T

Signal Generation: An Example

• Window = 100 bases• In-frame, downstream

– GCT = 1, TTT = 1, ATG = 1…• Any-frame, downstream

– GCT = 3, TTT = 2, ATG = 2…• In-frame, upstream

– GCT = 2, TTT = 0, ATG = 0, ...

299 HSU27655.1 CAT U27655 Homo sapiensCGTGTGTGCAGCAGCCTGCAGCTGCCCCAAGCCATGGCTGAACACTGACTCCCAGCTGTG 80CCCAGGGCTTCAAAGACTTCTCAGCTTCGAGCATGGCTTTTGGCTGTCAGGGCAGCTGTA 160GGAGGCAGATGAGAAGAGGGAGATGGCCTTGGAGGAAGGGAAGGGGCCTGGTGCCGAGGA 240CCTCTCCTGGCCAGGAGCTTCCTCCAGGACAAGACCTTCCACCCAACAAGGACTCCCCT

An Example File Resulting From Feature

Generation

Too Many Signals

• For each value of k, there are 4k * 3 * 2 k-grams

• If we use k = 1, 2, 3, 4, 5, we have 24 + 96 + 384 + 1536 + 6144 = 8184 features!

• This is too many for most machine learning algorithms

Signal Selection (Basic Idea)

• Choose a signal w/ low intra-class distance• Choose a signal w/ high inter-class distance

Signal Selection (eg., t-statistics)

Signal Selection (eg., 2)

Signal Selection (eg., CFS)

• Instead of scoring individual signals, how about scoring a group of signals as a whole?

• CFS– Correlation-based Feature Selection– A good group contains signals that are highly

correlated with the class, and yet uncorrelated with each other

Sample k-grams Selected by CFS

• Position –3• in-frame upstream ATG• in-frame downstream

– TAA, TAG, TGA, – CTG, GAC, GAG, and GCC

Kozak consensusLeaky scanning

Stop codon

Codon bias?

Signal Integration

• kNN– Given a test sample, find the k training samples

that are most similar to it. Let the majority class win

• SVM– Given a group of training samples from two

classes, determine a separating plane that maximises the margin of error

• Naïve Bayes, ANN, C4.5, ...

Neighborhood

5 of class

3 of class

Illustration of kNN (k=8)

Image credit: ZakiTypical “distance” measure =

Using WEKA for TIS Prediction

Results (3-fold x-validation)

TP/(TP + FN) TN/(TN + FP) TP/(TP + FP) Accuracy

Naïve Bayes 84.3% 86.1% 66.3% 85.7%

SVM 73.9% 93.2% 77.9% 88.5%

Neural Network 77.6% 93.2% 78.8% 89.4%

Decision Tree 74.0% 94.4% 81.1% 89.4%

3-NN* 73.2% 92.9% 77.2% 88.0%

* Using top 20 2-selected features from amino-acid features

Validation Results (on Chr X and Chr 21)

• Using top 100 features selected by entropy and trained on Pedersen & Nielsen’s

Ourmethod

Technique Comparisons

• Pedersen&Nielsen [ISMB’97]

– 85% accuracy– Neural network– No explicit features

• Zien [Bioinformatics’00]

– 88% accuracy– SVM+kernel engineering– No explicit features

• Hatzigeorgiou [Bioinformatics’02]

– 94% accuracy (with scanning rule)

– Multiple neural networks– No explicit features

• Our approach– 89% accuracy (94% with

scanning rule)– Explicit feature

generation– Explicit feature selection– Use any machine

learning method w/o any form of complicated tuning

Recognition of Transcription Start Sites

An introduction to the World’s best TSS recognition system

A heavy tuning approach

Transcription Start Site

Structure of Dragon Promoter Finder

-200 to +50window size

Model selected based on desired sensitivity

Each model has two submodels based on GC content

GC-rich submodel

GC-poor submodel

(C+G) =#C + #GWindow Size

Data Analysis Within Submodel

K-gram (k = 5) positional weight matrix

Promoter, Exon, Intron Sensors

• These sensors are positional weight matrices of k-grams, k = 5 (aka pentamers)

• They are calculated as s below using promoter, exon, intron data respectively Pentamer at ith

position in input

jth pentamer atith position in training window

Frequency of jthpentamer at ith positionin training window

Window size

Data Preprocessing & ANNTuning parameters

tanh(x) =ex e-x

ex e-x

sEtanh(net)

Simple feedforward ANN trained by the Bayesian regularisation method

net = si * wi

Tunedthreshold

Accuracy Comparisons

without C+G submodels

with C+G submodels

References (TIS Recognition)

• A. G. Pedersen, H. Nielsen, “Neural network prediction of translation initiation sites in eukaryotes”, ISMB 5:226--233, 1997

• H.Liu, L. Wong, “Data Mining Tools for Biological Sequences”, Journal of Bioinformatics and Computational Biology, 1(1):139--168, 2003

• A. Zien et al., “Engineering support vector machine kernels that recognize translation initiation sites”, Bioinformatics 16:799--807, 2000

• A. G. Hatzigeorgiou, “Translation initiation start prediction in human cDNAs with high accuracy”, Bioinformatics 18:343--350, 2002

References (TSS Recognition)

• V. B. Bajic et al., “Computer model for recognition of functional transcription start sites in RNA polymerase II promoters of vertebrates”, J. Mol. Graph. & Mod. 21:323--332, 2003

• J. W. Fickett, A. G. Hatzigeorgiou, “Eukaryotic promoter recognition”, Gen. Res. 7:861--878, 1997

• A. G. Pedersen et al., “The biology of eukaryotic promoter prediction---a review”, Computer & Chemistry 23:191--207, 1999

• M. Scherf et al., “Highly specific localisation of promoter regions in large genome sequences by PromoterInspector”, JMB 297:599--606, 2000

gene feature recognition

Documents

emotion recognition using facial feature extraction

lecture: face recognition and feature...

face recognition and feature subspaces

feature selection from gene expression...

dual feature extraction techniques for iris recognition...

discriminative feature optimization for speech recognition

pattern recognition with slow feature analysis

feature segmentation for object recognition using robot...

feature recognition article

feature-based machining what’s new · 2008-06-10 ·...

fingerprint recognition using minutiae based feature

statistical feature recognition for multidimensional solar

feature selection pattern recognition

feature recognition berbasis corner detection …

recognition memory-induced gene expression in the

fingerprint recognition using feature extraction izni

using ecognition to improve feature recognition

part design feature recognition -...

location recognition using prioritized feature...

gene recognition