future medical laboratories and their roles in ... · pdf filefor down syndrome association...
Post on 27-Feb-2018
216 Views
Preview:
TRANSCRIPT
SCREENINGSCREENING
Methods of prenatal diagnosisMethods of prenatal diagnosis
Invasive:Amniocentesis
Non-invasiveMaternal serum AFP Amniocentesis
Chorionic villus sampling
Maternal serum AFPMaternal serum screenUltrasonography sampling
CordocentesisFetoscopy
UltrasonographyIsolation of fetal cells /DNA from maternal Fetoscopy
Preimplatation genetic diagnosis
/DNA from maternal circulation
genetic diagnosis
Prenatal diagnosis ofScreening milestones
First chromosomal analyses from amniotic fluid
Prenatal diagnosis of Down syndrome
Trisomy 21 identified as
amniotic fluidRaised AF-AFP associated with open Neural tube defectsy
cause of Down Syndrome
Maternal serum marker
Neural tube defects
Triple test
Maternal serum markerfor Down syndrome
Association between maternal
Triple test introduced
Nuchal translucency introducedbetween maternal
age and Down syndrome
d
introduced
UltrasoundUltrasound
90 Hydrops <17 weeksCystic hygroma
607080
Cystic hygromaA-V canalHoloprosencephalyO h l l
405060 Omphalocele
Hydrops >24 weeksCardiac defect
203040 Duodenal atresia
Bladder outlet obstructionDiaphragmatic hernia
010
p gLimb reductionHydrocephalusClubbed footAneuploidy Risk Clubbed footFacial cleft
Markers for fetal aneuploidies
•• Biochemical markersBiochemical markersH h i i d i (hCG)–Human chorionic gonadotropin (hCG)
–Free b‐subunit of hCG (Fb‐hCG)–Alpha‐fetoprotein (AFP)–Un‐conjugated estriol (uE3)–Pregnancy associated plasma protein A (PAPP‐A)– Inhibin‐A
•• Ultrasound markersUltrasound markers–Nuchal translucency (NT)y ( )
Biochemical profiles for other l idi i th 2 d t i taneuploidies in the 2nd trimester
A l idiAneuploidiesMarker T21 T18 T13 Turner
AFP LL - Inc Dec
hCG HH VV-- LL N VV--HH
uE3 LL LL N Dec
I hibi A HH N VV HHInhibin A HH - N VV--HH
M. Houshmand
Integrated screeningstrategies (1st and 2nd trim)strategies (1st and 2nd trim)
1st trimester:NT, PAPPNT, PAPP--AA
1st trimester: NT, PAPPNT, PAPP--AA, Fb, Fb--hCGhCG
1st trimester:NT PAPPNT PAPP AA FbFb hCGhCGMain strategies:
• F ll IntegratedNo risk estimate
,, ,,
Risk estimate CVSHigh risk
NT, PAPPNT, PAPP--AA, Fb, Fb--hCGhCG
Risk estimate CVSHRNo further screening LR
• Fully Integrated
• Step‐wise sequential2nd trimester:
FbFb--hCG, AFP, uEhCG, AFP, uE33,, ((±± InhibinInhibin))
Low risk
2nd trimester:
Borderline risk
g
Step wise sequential
• Contingent screening
, ,, , ,, (( ))
Final risk estimate:
2nd trimester:FbFb--hCG, AFP, uEhCG, AFP, uE33,, ((±± InhibinInhibin))
FbFb--hCG, AFP, uEhCG, AFP, uE33,, ((±± InhibinInhibin))
g g Final risk estimate:All markersAll markersFinal risk estimate:
All markersAll markersFinal risk estimate:
All markersAll markers
Weeks Prenatal TestsUltrasound, basic prenatal tests, Iron count(anemia), infections, blood
6 - 8Ultrasound, basic prenatal tests, Iron count(anemia), infections, blood platelet, blood type, RH type, Hepatitis B (antigen, antibody), STDs (syphilis, AIDS), Rubella
8 15 Ultrasound amniocentesis Chorionic villi sampling (if needed)8 - 15 Ultrasound, amniocentesis, Chorionic villi sampling (if needed)
11 - 13 Measurement of nuchal fold thickness (3D ultrasound): Early detection of Down's Syndrome
15 - 20 Triple marker test, Genetic abnormalities (Screening for Down's Syndrome 60%, neural tube defect 80%)
20 24 L l II Ult d (3D 4D lt d) G t ti l Di b t20 - 24 Level II Ultrasound (3D, 4D ultrasound), Gestational Diabetes
26 - 28 Gestational diabetes screening
28 Iron count(anemia) re-test, urine test for level of protein and sugar(test repeated as needed)
Pre delivery examination and testing
M. Houshmand36 - 38
y gIron count(anemia), infections, blood platelet, syphilis, liver function, kidney function, blood coagulation test, ECG, chest X-ray, fetal movement
NIPT
NON – INVASIVE PRENATAL TEST
Testing of cff DNA (cell free fetal DNA)
from maternal blood during pregnancy
for trisomy 21, 18 and 13
Percent of Reported Chromosome Abnormalities
5
16 T21
T18
8
5 T18
T13Major fetal
535
45,X
Sex trisomy
Major fetalaneuploidies
13y
Other rare
Trisomy 21, 18, 13 screening
Trisomy 21 (Down syndrome)Trisomy 21 (Down syndrome)
Trisomy 18 (Edwards syndrome)
Trisomy 13 (Patau syndrome)
Current Diagnostic Options ‐K tKaryotype
Trimester ‐ Test Sensitivity Specificity
1st – CVS 99.25% 98.65%1 CVS 99.25% 98.65%
2nd Amniocentesis 99 4%2 99 5%
Definitive answers, but are invasive and come with risk to the
2nd ‐ Amniocentesis 99.4%2 99.5%
,patient Most are unnecessary due to the high rate of false positives in screening**screening**
.
Spectrum of Prenatal Testing*p g
SCREENING DIAGNOSTICRisk scores are generated and modified based on biochemical analysis and population statistics
Results are based entirely on genetic factors
Serum Screening CVS
AmnioNIPTCombined Serum
Screens, NT, Ultra-sound
SCREENING DIAGNOSTIC
.
*Not meant to represent percentage of accuracy
What Are the Goals of NIPT?
Reduce exposure of Reduce false
positivespfetus to risk positives
Testing thatEnable a
high detection
rate
Testing that can easily be offered
to all t ratepregnant
women
.
Two Sources of Fetal DNA in Maternal BloodBlood
F l ll• Fetal cells– 1 in a billion of total cell population
– Require isolation via mechanical and/or biochemical means
• Cell‐free DNA (cfDNA) – Maternal blood contains both maternal and fetal cfDNA
– 2–20% of total cfDNA is fetal
.
Fetal Cell‐free DNA in Maternal Blood
A Reliable Analyte During Pregnancy
– Released through apoptosis
• Fetal cfDNA likely arises from ycytotrophoblastic cells of placenta
– Released into bloodstream as small DNA fragments (150‐200bp)
– Reliably detected after 7+ weeks– Reliably detected after 7+ weeks gestation
U d bl i hi h– Undetectable within hours postpartum.
Which Patients Should Be Offered NIPT?
Patients Wanting Early, Accurate Test And Are At High RiskPatients Wanting Early, Accurate Test And Are At High Risk Of Aneuploidy Due To:
Maternal age-related risksPositive results on maternal serum screeningPositive results on maternal serum screeningAbnormal ultrasound finding(s)Prior pregnancy with aneuploidyParental Robertsonian translocation involving gone of the tested chromosomes
1
NO NIPT for sex aneuploidies
Phenotype for sex aneuploidies is highly variableyp p g y
Mosaicism in the fetus is a problem
Mosaicism in the mother is a problem
NIPT for sex aneuploidies is less accurate
2
NIPT for sex aneuploidies is less accurate
NIPT is NOT the test of choice when there NIPT is NOT the test of choice when thereis :
F l li l d• Fetal anomalies on ultrasound
• A triplet pregnancy
• Vanishing twin
• Known genetic anomalies that cannot be diagnosed by NIPT
NIPT Advantages versus combi test with AC / CVSCVS
• High sensitivity (few false‐negatives)
• High specificity (few false‐positives)
• More than T21• More than T21
• Non‐invasive : no fetal risk• CVS : Risk of miscarriage : 1‐2 %• AC : Risk of miscarriage : 0.5 %
NIPTresults
1. Normal result : no specific follow up necessary, unless ultrasound examination of the fetus reveals anomalies
2 Test failure : in < 2 % pregnancies not enough fetal2. Test failure : in < 2 % pregnancies not enough fetal DNA : NIPT repeated at no extra cost.
3. Abnormal NIPT result : confirmation by amniocentesis or chorionic biopsy
Screening OptionsTest When Done Detection Rates
1st trimester 10-14 weeks T21 -- 83%(NT + 2 serum) T18 – 80%Ultrasound 18-20 weeks T21 -- 60%; T18 -- 85%
NTD -- 70-98%
Quadruple screen 15-21 weeks T21 -- 75-80%; T18 --(4 serum analytes) 60%
NTD -- 80-90%*Integrated screen 10 14 weeks T21 92%*Integrated screen(1st trimester screen + quadruple screen)
10-14 weeks15-21 weeks
T21 -- 92%T18 -- 90%NTD -- 80%q p ) NTD 80%
Maternal serum >7 weeks T21 - >99%Other aneuploidy?
Dosage of chromosome 21(RNA‐SNP allelic ratio method)( )
• Quantitative analysis of SNPs in PLAC4mRNA
Trisomy 21 pregnancyEuploid pregnancy
TTT
C CC
T : CT : C T : C2 : 1
T : C1 : 1 Allele Ratio
What’s New in Newborn Screening
Purpose of Newborn Screening
• Program to screen for congenital and heritableProgram to screen for congenital and heritable disorders
• These disorders may cause severe mental• These disorders may cause severe mental retardation, illness, or death if not treated early in lifein life
• If treated, infants may live relatively normal lives• Results in savings in medical costs over time
Results from Lab
• Normal Screen • Abnormal results• Normal Screen Results
• Abnormal results–Results are
t d t C–Results are sent to submitter when all
reported to Case Management as
il bltest are final soon as available for that disorder
Tandem Mass Spectrometer ( S/ S)(MS/MS)
• Molecules are sorted & weighed by mass• Molecules are sorted & weighed by mass• Compounds analyzed are amino acids & acylcarnitines–Amino acids: building blocks for proteinsg p–Acylcarnitine= Carnitine (vehicle) +fatty acid
• Identified by size of fatty acid: short medium long• Identified by size of fatty acid: short, medium, long and designated by initials & numbers
Specimen Collection to Treatment
Mass Spectrometry-based Di tiDiagnostics
• MALDI‐TOF MS:matrix‐assisted laserMALDI TOF MS:matrix assisted laser desorption/ionization‐time of flight mass spectrometryspectrometry
• SELDI ‐TOF MS: surface‐enhanced laser desorption/ionization time of flight massdesorption/ionization‐ time of flight mass spectrometry
M. Houshmand
Sansom, Molecular Medicine Today, March 1999
M. Houshmand
Organic Acid Metabolism Disorders
• IVA ‐ Isovaleric acidemiaGA I Gl i id i I• GA I – Glutaric acidemia type I
• HMG – 3‐OH 3‐CH3 glutaric aciduria• MCD – Multiple carboxylase deficiency• MUT – Methylmalonic acidemia (mutase def)• 3MCC – 3‐Methylcrotonyl‐CoA carboxylase deficiency
• Cbl A,B – Methylmalonic acidemia• PROP – Propionic acidemia
M. Houshmand
p• BKT – Beta‐ketothiolase deficiency
Fatty Acid Oxidation Disorders
• MCAD – Medium‐chain acyl‐CoAMCAD Medium chain acyl CoA dehydrogenase deficiency
• VLCAD – Very long‐chain acyl‐CoAVLCAD Very long chain acyl CoA dehydrogenase deficiency
• LCHAD – Long‐chain L‐3‐OH acyl‐CoALCHAD Long chain L 3 OH acyl CoA dehydrogenase deficiency
• TFP – Trifunctional protein deficiencyTFP Trifunctional protein deficiency• CUD – Carnitine uptake defect
Amino Acid Metabolism Disorders
• PKU – PhenylketonuriaPKU Phenylketonuria• MSUD – Maple syrup urine disease
C i i• HCY – Homocystinuria• CIT – Citrullinemia• ASA – Argininosuccinic acidemia• TYR I – Tyrosinemia type ITYR I Tyrosinemia type I
Hemoglobinopathies
• SCA – Sickle cell anemiaSCA Sickle cell anemia• Hb S/Th – Hb S/ Beta‐thalassemia
b S/C b S/C di• Hb S/C – Hb S/C disease
Others
• HYPOTH – Congenital hypothyroidismHYPOTH Congenital hypothyroidism• BIOT – Biotinidase deficiencyC C i l d l h l i• CAH – Congenital adrenal hyperplasia
• GALT – Galactosemia• HEAR – Hearing deficiency
New Screen will not require additional blood spotsadditional blood spots
The Heel Test
M. Houshmand
44
M. Houshmand
M. Houshmand
What makesWhat makes a good spot?
M. Houshmand
Looking into the future Looking into the future
Carrier Status DNACarrier Status DNA•Screens patients for more than 70 recessive genetic didiseases•Supported by rigorous science using clinically-
l t ll lid t d k drelevant, well-validated markers and assays•Enables physicians to offer calculated guidance on
d t t l h lthpre- and postnatal health
Ashkenazi Jewish Conditions
ACOG-Recommended Conditions*Beta-thalassemia
Ashkenazi Jewish ConditionsBloom syndromeCanavan diseaseBeta thalassemia
Canavan diseaseCystic fibrosisF ili l d t i
Cystic fibrosisFactor XI deficiencyFamilial dysautonomiaFamilial dysautonomia
Sickle cell diseaseTay-Sachs disease
yFanconi anemiaGaucher diseaseGlycogen storage diseaseAlpha-thalassemia
Fragile X syndromeSpinal muscular atrophy (SMA)
Glycogen storage disease, type 1AMaple syrup urine diseaseSpinal muscular atrophy (SMA) Mucolipidosis IVNiemann-Pick diseaseTay-Sachs diseaseyTyrosinemia
Additional Conditions3-Methylcrotonyl-CoA carboxylase deficiencyAcrodermatitis enteropathica
Dubin-Johnson syndromeFamilial Mediterranean feverGalactokinase deficiencyAlpha-1 antitrypsin deficiency
Amyotrophic lateral sclerosisArgininosuccinate lyase deficiencyA t i l l d l d t I
Galactokinase deficiencyGalactosemiaGlutaric acidemia, type 1GM1-gangliosidosisAutoimmune polyglandular syndrome, type I
Bartter syndrome, type 4ABeta-ketothiolase deficiencyBiotinidase deficiency
g gHemochromatosisHemoglobin CHemoglobin EBiotinidase deficiency
Carnitine deficiency, primary systemicCerebrotendinous xanthomatosisCitrullinemia, type I
HMG-CoA lyase deficiencyHomocystinuria, cblE typeHomocystinuria, classicH l dCitrullinemia, type I
Crigler-Najjar syndromeDiabetes, permanent neonatalDihydropyrimidine dehydrogenase deficiency
Hurler syndromeMethylmalonic acidemiaMucolipidosis IIMucolipidosis IIIy py y g y
Ehlers-Danlos syndrome, hypermobilityHearing loss, DFNB1 and DFNB9 nonsyndromicHearing loss, DFNB59 nonsyndromic
Mucolipidosis IIIMultiple carboxylase deficiency
PhenylketonuriaPolycystic kidney diseasePompe diseasePompe diseasePrekallikrein deficiencyPropionic acidemiaProthrombin deficiencyyRh-null syndromeRickets, pseudovitamin D-deficiencySandhoff diseaseSick sinus syndromeSpherocytosis, hereditaryTay-Sachs pseudodeficiency
h b i i l k iThrombocytopenia, congenital amegakaryocyticLipoprotein lipase deficiency, familialMedium-chain acyl-CoA dehydrogenase deficiencyEhlers Danlos syndrome dermatosparaxisEhlers-Danlos syndrome, dermatosparaxisEhlers-Danlos syndrome, kyphoscolioticNephrotic syndrome, steroid-resistantShort-chain acyl-CoA dehydrogenase deficiencyShort chain acyl CoA dehydrogenase deficiencyVery long-chain acyl-CoA dehydrogenase deficiencyVon Willebrand disease, type 2 NormandyVon Willebrand disease, type 3
Cardiac DNA provides information that allows the pphysician to:•Better monitor a patient’s specific health condition.
•Prescribe a more optimal medication and dosage for a patient.
•Suggest early lifestyle and diet interventions to help combat or prevent certain health conditions.
Cardiac DNA Insight analyzes a patient’s uniqueCardiac DNA Insight analyzes a patient s unique genetic markers, which influence a broad range of heart-related conditions, including ApoE, HDL andheart related conditions, including ApoE, HDL and LDL cholesterol levels, and risks for hypertension and myocardial infarction. This simple saliva or blood-myocardial infarction. This simple saliva or bloodbased test is supported by scientifically validated genetic testing technologies using clinically relevantgenetic testing technologies using clinically relevant markers and assays.
Heart Disease/Atrial FibrillationAtrial fibrillationBeta-blockers, LVEF responseCaffeine metabolismCoronary artery diseaseMyocardial infarctionSimvastatin-induced myopathyVerapamil and QTc interval
Peripheral Arterial Disease/Venous ThrombosisCl id l b li (Pl i )Clopidogrel metabolism (Plavix)Estrogen supplementation (risk of venous thrombosis)P i h l i l diPeripheral arterial diseaseVenous thrombosisW f iWarfarin
HypertensionBeta blockersBeta-blockersHypertensionMetoprolol metabolismMetoprolol metabolismPerindopril (ACE inhibitor-therapeutic benefit)Verapamil vs atenolol (benefit of)Verapamil vs. atenolol (benefit of)
Cardiovascular HealthApoE and cardiovascular diseaseApoE and cardiovascular diseaseGenetic risk for decreased folateGenetic risk for decreased HDL cholesterolGenetic risk for decreased HDL cholesterolGenetic risk for elevated LDL cholesterolGenetic risk for elevated triglyceridesGenetic risk for elevated triglyceridesSickle cell anemia
Mental Health DNA analyzes a patient’s DNA to identify genetic variants that affect the metabolism and efficacy of psychiatric medications. Genetic research suggests that categorizing individuals based on genotypes will make the pharmacologic treatment of psychiatric illnesses more predictable and effective. Mental Health DNA can help a physician predict a patient’s response to more than 40 common antidepressants, mood stabilizers and antipsychotic medications. The report provides outcomes in a clear color-coded chart.
This test can enable a physician to choose an appropriate medication with less trial and error as well as minimizing a patient’s risk of adverse side effects. Mental Health DNA Insight is supported by scientifically validated genetic testing technologies using clinically relevant markers and assays.
AntidepressantsAmitryptylineBuspirone
Mood StabilizersCarbamazepineGabapentin
AntipsychoticsAripiprazoleAsenapinep
CitalopramClomipramineDesipramine
pLamotrigineOxcarbazepineTopiramate
ChlorpromazineClozapineFluphenazineH l id lDoxepin
DuloxetineEscitalopramFl ti
Valproic acid HaloperidolIloperidoneLoxapineLurasidoneFluoxetine
FluvoxamineMirtazapineNortriptyline
LurasidoneOlanzapinePaliperidonePerphenazineNortriptyline
ParoxetineSertralineTrazodone
PerphenazineQuetiapineRisperidoneThioridazineTrazodone
TrimipramineVenlafaxine
ThiothixeneTrifluoperazineZiprasidoneZuclopenthixol
Healthy Weight DNA may help with:Weight managementDisease preventionMaximizing energyImprovement to overall health
Understanding a person’s genetic propensity to specific diets, eating behaviors, nutritional needs,specific diets, eating behaviors, nutritional needs, exercise activity and health conditions is important to true, long-term success in weight management.to true, long term success in weight management.
Eating BehaviorsEating disinhibitionFood desire
Weight and DietGenetic risk for decreased adiponectinGenetic risk for decreased omega 6 andFood desire
Satiety – feeling fullSnacking
h
Genetic risk for decreased omega-6 and omega-3Matching diet type
Sweet toothHealth ConditionsDiabetes, type 2
MetabolismObesityResponse to monounsaturated fats, yp
OsteoarthritisVenous thrombosisMedication Response
pResponse to polyunsaturated fatsWeight loss – regain
M t b li H lth F tMedication ResponseClopidogrel metabolism (Plavix)Simvastatin-induced myopathyW f i
Metabolic Health FactorsGenetic risk for decreased HDL cholesterol
WarfarinExercise ResponseEndurance training
Genetic risk for elevated LDL cholesterolGenetic risk for elevated triglycerides
HDL (good) cholesterol response to exerciseInsulin sensitivity response to exercise
Genetic risk for elevated triglycerides
Nutritional NeedsGenetic risk for decreased vitamin AGenetic risk due to decreased vitamin B2Genetic risk for decreased vitamin B6Genetic risk for decreased vitamin B6Genetic risk for decreased vitamin B12Genetic risk for decreased vitamin CG ti i k f d d it i DGenetic risk for decreased vitamin DGenetic risk for increased vitamin EGenetic risk for decreased folate
Looking into the futureLooking into the future
Immunculus (Immunologic ( gHomunculus) and prognosticand prognostic
medicine
Would you like to know the future of your health
Is it possible ?
Yes, certainly!by using multiple auto-Abs evaluations
Immune system
The maintenance of l l h t i fsystem
Each 10th
molecular homeostasis of the body by different ways
d h i
Including clearance of organism from
cell of the body (!) is lymphocyte
and mechanisms
g gwaste products of apoptotically died
cells
lymphocyteIs it main function
(anti-microbe struggle is only small part of the main homeostatic
?part of the main homeostatic function of the immune system)
Struggle against microbes
The main points:The main points:Indi id al differences in apoptosis in cells of Li er Kidne s Heart orIndividual differences in apoptosis in cells of Liver, Kidneys, Heart, or other organs is minimal in health state
Therefore: Individual variability in productions of antigenic wastage is minimal
Antigen-dependent regulation of Ab production (by feedback principle)production (by feedback principle)
Therefore: Nearly the same levels of production of auto-Abs – scavengers in each healthy person
Abnormal elevation of apoptosis in organ (because any form of pathology) leads to quantitative(because any form of pathology) leads to quantitative deviations in contents of according auto-Abs
Preparative Isoelectrofocusing / ELISA:
An illustrative example:
Minimal individual differences in content of different “cardiotropic” auto-Abs may be seen in serum of healthy persons (black lines).
Heart pathology has accompanied by quantitative changes in pattern ofHeart pathology has accompanied by quantitative changes in pattern of auto-Abs (cardiomyopathy – red dotted line)
The health state of the Body has been mirrored by the General The health state of the Body has been mirrored by the General system of autosystem of auto--Abs or Abs or ««ImmunculusImmunculus»»
Because:Because:11. . Serum level of autoSerum level of auto--Abs of any specificity Abs of any specificity
is nearly the same in each healthy personis nearly the same in each healthy person..22 Q tit ti d i ti i t t fQ tit ti d i ti i t t f22. . Quantitative deviations in contents of Quantitative deviations in contents of
some autosome auto--Abs are marker signs of Abs are marker signs of pathology (abnormal elevation of pathology (abnormal elevation of apoptosis) in according organapoptosis) in according organ
Each form of pathology: cancer and hepatic problems neurodegeneration and cardialproblems, neurodegeneration and cardial pathology etc., has been reflected by “Magic Mirror of Immunculus”
Stages of Pathology Development:
1. Most early eventsActivation of apoptosis which reflects by auto‐Abs
Weeks or months later
2 Biochemical (laboratory detected) and/or functional
Weeks or months later
2. Biochemical (laboratory detected) and/or functional changes in organ
3. Clinical manifestation of the disease Months or years later
(March 2007) Sci. Amer. Dr.
Abner Notkins write:
During the next 10 or 20 years evalu-ation a lot of auto-Abs willa lot of auto Abs will became habitual di ti ddiagnostic procedure (for prediction of the future changes in patient’s health)patient s health)
Not after 10 or 20 years, but now
We used evaluation of some dozens of auto Abs for
EliEli VisceroViscero TestTest
We used evaluation of some dozens of auto-Abs for diagnostic and prognostic purposes
EliEli--VisceroViscero--TestTest((evaluation of the health state of heartevaluation of the health state of heart, , vesselsvessels, , lungslungs, , liverliver, , kidneyskidneys, , stomachstomach, , gutgut, , vesselsvessels, , lungslungs, , liverliver, , kidneyskidneys, , stomachstomach, , gutgut, , pancreaspancreas, , thyroidthyroid, , prostateprostate, , adrenalsadrenals))
ELIELI--NN--TestTest((Nervous system health stateNervous system health state))
ELIELI--PP--ComplexComplexpp((Reproductive health evaluationReproductive health evaluation))
What is “Personalized Medicine”?
The Goal of Personalized M di iMedicine
• The Right Dose ofTh Ri ht D f• The Right Drug for
• The Right Indication for• The Right Patient at• The Right Time.The Right Time.
• Pharmacokinetics (PK): the study of the time course of substances and their
Pharmacology
relationship with an organism or system (Journey of drugs)
Absorption– Absorption– Distribution– Metabolism
• Pharmacodynamics (PD): the study of
– Excretion
the biochemical and physiological effects of drugs and the mechanisms of drug action and the relationshipof drug action and the relationship between drug concentration and effect (Drug effect on the body)
Every aspect may affect the final drug effect
Pharmacogenetics & Ph iPharmacogenomics
• Pharmacogenetics: study of individual gene-Pharmacogenetics: study of individual genedrug interactions, usually one or two genes that have dominant effect on a drug responsehave dominant effect on a drug response (SIMPLE relationship)
• Pharmacogenomics: study of genomic i fl d ft i hi hinfluence on drug response, often using high-throughput data (sequencing, SNP chip,
i t i COMPLEXexpression, proteomics - COMPLEX interactions)
What Disciplines are Involved?
PharmacologyGenomics
Pharmacology
Pharmaco-epidemiology
Personalized/Stratified/
P di i M di i
Molecularbi l
epidemiology
Predictive Medicine
Bioinformatics
biology
BioethicsBioStatistics
Cancer Pharmacogenomics (PGx)
• The study of how variation in an individual’s germline and/or tumor genome are related to their metabolism and physiological response to drugs used in cancer treatment– Single Nucleotide Polymorphisms (substitutions)– Insertions and deletions– Copy number Variations– Methylation patternsMethylation patterns– Molecular biomarkers– Gene expression
Cancer Pharmacogenetics
GERMLINE
Cancer Pharmacogenomics
GERMLINE
SOMATIC TUMOURg
Biomarkers Predictive f D O t
SOMATIC or TUMOUR
PROTEINS IMAGINGfor Drug Outcomes
Biomarkers Predictive
PROTEINS, IMAGING
RADIATION THERAPYfor Treatment Outcomes
RADIATION THERAPY
Gene Mutations — Inherited or A i dAcquired
• Hereditary (germline) mutationsHereditary (germline) mutations
– alterations in DNA inherited from a parent and pare found in the DNA of virtually all of your cells.
• Acquired (somatic) mutations
lt ti i DNA th t d l th h t– alterations in DNA that develop throughout a person’s life
Pharmacogenetics: A Case St dStudy
Pharmacogenetics: A Case St dStudy
Pharmacogenetics: A Case St dStudy
Personalized Drugs
• Herceptin (breast cancer, target: Her2/neu)b ( l l )• Erbitux (colorectal cancer, target: EGFR)
• Tarceva (lung cancer, target: EGFR)• Strattera (attention‐deficit/hyperactivity
disorder Metabolism: P4502D6)disorder, Metabolism: P4502D6)• 6‐MP (leukemia, Metabolism: TPMT)
i i l (i i b d f f• Antivirals (i.e. resistance based on form of HIV)
• etc. and the list is growing rapidly ...
FDA Requires Genetic Testsfor Certain Therapiesfor Certain Therapies
• We are all 99 9% similar in our DNA• We are all 99.9% similar in our DNA.
• Individuals vary by only 0.1%.
• Individual variations may correla with
different responses to medicines and
magnitude of disease riskmagnitude of disease risk.
Potential of Pharmacogenomics
All patients with same diagnosis
1 Non-respondersand toxic
responders
2Responders and patients
Treat with alternativedrug or dose
Responders and patientsnot predisposed to toxicity
Treat withconventionaldrug or dose
Personalized or Predictive Medicine
Patients with same diagnosis Respond to treatment
No response to treatment
Experience adverse events
Human Genome has 3 billion DNA base pairsbase-pairs
…G G T A A C T G…
Polymorphic
G G C G
…G G C A A C T G...…G G C A A C T G...
Some people have a different base at a given location:This is a Single Nucleotide Polymorphism
or SNP
102
or SNP
103
: : دارو در بدن جذبجذب توزيعتوزيع متابوليسممتابوليسم
حذفحذف
١١فازفازااکسيداسيونکسيداسيون
ا امتابوليسممتابوليسم
احيا١١فازفازھيدروليز
ن دا ن ک گل٢٢فاز فاز
گلوکورونيداسيونسولفاسيوناستيالسيون
104. . متابوليزه ميشودمتابوليزه ميشود CYPCYPتوسط توسط % % ٨۶٨۶و از اين مقدار و از اين مقدار ١١از داروھا توسط فاز از داروھا توسط فاز % % ۵۶۵۶متابوليسم متابوليسم
متيالسيون
Somatic vs. GermlineMutation TestingMutation Testing
Detection of HER2/neu Amplication in Breast Cancer by FISH
BRCA PEDIGREE
Sequence Analysis of BRCA1 and BRCA2C Fi d th N dl i th H t k
• BRCA1: 22 coding exons, > 5,500 bp
Can Find the Needle in the Haystack
AA
g , , p
GGCTTTAAGTATCCATGGCTTTAAGTATCCATGGCTTTAAGTATCCATGGCTTTAAGTATCCAT• BRCA2: 26 coding exons, > 11,000 bp
ناثر متقابل بين دارو وبدن ل ر
109
در ايران CYP2C9*4فراوانی ژنوتيپ
110
AzariAll l f Genotype frequencyAzari
Caspian Fars
Allele frequency Genotype frequency
Kurdp Fars
Allele frequency
Allele frequencyGenotype frequency
LureAllele frequency
Genotype frequency Genotype frequency
Allele frequencyGenotype frequency
BalochArab
Allele frequency
Allele frequency
Genotype frequency
ArabAllele frequency
Genotype frequency
111
North
Genotype frequencyAllele frequency
Allele frequency
West EastCenter Genotype frequencyWest EastCenterAllele frequency
Allele frequencyGenotype frequency
G f
Allele frequency
Genotype frequency
South
Genotype frequency
112
R521K Genotype Frequencies in Iran
Homozygous HomozygousAA, 7.7
Homozygous (Normal)
Homozygous (Mutant)
GA, 53.6
GG, 38.7
G t F l M l
HeterozygousGenotype Female Male
A/A 7.33 8
G/A 52 54 67G/A 52 54.67
G/G 40.67 37.33
113
ConclusionConclusion
Safe
Cetuximab
Safe Effective
A/A Genotype (in R521K EGFR polymorphism)
Cetuximab
ArabsGilaki – Mazandarani groups 114
ConclusionConclusion
Safe
G/G and G/A Genotypes Cetuximab
Safe not Effective
yp(in R521K EGFR polymorphism)
KurdsLuresFarsTurks 115
Ethnicity A/A (%) G/A (%) G/G (%)
Fars 8.3 51.5 40.2
Turk 6.5 58.44 35.06
K d 0 53 85 46 15Kurd 0 53.85 46.15
Lure 0 70.59 29.41
Arab 16.67 33.33 50
Caspian 16.67 50 33.33
R521K genotype distribution in different ethnic groups of Iranian PopulationIranian Population
The genotype A/A was not detected in Kurds and Lure groups
High frequencies of A/A genotype in Arabs and Caspian groups
116
117
Genetic
Biocurator
CounselorTreating Team
Analysis TeamMP/MG
Outside Faculty
Expert (prn)
Test RequestPatient and physician
Review by GeneticTest Consultation Service
Establish questions being posed bypatient and treating teamphysician
request genome
i
Service• Genetic Counselor• Molecular
P h l i
patient and treating team• Genetic?• Candidate variants and
sequencingfor heritable disease
Pathologist• Medical Geneticist
analysis approach• Clinical use
throughEMR
The Rare Disease Primer Kit
PharmacoGenetic Card
Name: SEYED MASSOUD Surname: HOUSHMAND
Date of birth: 22 JAN 62ID No: 093‐766781‐1
5‐FLUOROURACIL IRINOTECAN THIOPURINE HERCEPTIN GLEEVEC /
IMATINIBIRESSA /GEFITINIB
VARIOUS FLT3INHIBITORS
BETA2‐AGONISTS
ABACAVIR
Date of birth: 22 JAN 62
CYP2D6 CYP2C19 CYP2C9 CYP1A2 CYP2A6 CYP2B6 CYP2C8 CYP2C9 CYP2E1
CYP2J2 CYP3A4 CYP3A5 CYP3A7 CYP4B1 EPHX1 EPHX2 TPMT UGT1A1
HLA Typing Card
Name: SEYED MASSOUD Surname: HOUSHMAND
Date of birth: 22 JAN 62ID No: 093‐766781‐1
HLA‐/ /
Date of birth: 22 JAN 62
HLA‐A HLA‐B HLA‐C HLA B27 HLA‐DPA1 HLA‐DPB1 DRB3/B4/B5
G ti ID C dGenetic ID Card
Name: SEYED MASSOUD Surname: HOUSHMAND
Date of birth: 22 JAN 62ID No: 093‐766781‐1
D20S1082 D6S474 D12ATA63 D22S1045 D10S1248 D1S1677 D11S4463 D4S2364 D9S1122
Date of birth: 22 JAN 62
D2S1176 D10S1435 D3S3053 D5S2500 D1S1627 D2S4529 D2S441 D17S974 D6S1017
D4S2408 D9S2157 D17S1301 D1GATA113 D18S113 D18S8853 D20S482 D14S1434AMELOGENI
D4S2408 D9S2157 D17S1301 D1GATA113 D18S113 D18S8853 D20S482 D14S1434N
top related