future developments in plant-based foods
Post on 01-Jan-2022
1 Views
Preview:
TRANSCRIPT
Michael J. Leonard, PhDChief Technology Officermleonard@motiffoodworks.com@mikeleonardmadewithmotif.com
Future Developments in Plant-Based Foods
Ingredient Innovation
Our Ambition:
To unleash the promise of plant-based foods
Plant-Based Marketplaces are Getting Bigger
$29 Billion
27% Meat-alt
73% Dairy-alt
Sources: 2020 Euromonitor, 2020 Statista, 2020 Market Watch Plant Based Meats
Plant-Based Segments are Outpacing their Animal-Based Counterparts
One Year Global Growth Rates(Y/Y Average)
15%
12%
7%
2%
Meat Dairy
Sources: 2020 Euromonitor, 2020 Statista, 2020 Market Watch Plant Based Meats
Today, plant-based foods are NOT living up to expectations…there are still significant gaps in the
performance of…
plant-based foods
animal counterpartsvs.
The Reason is Taste
Plant-based consumers are making big compromises
44% 67% 31% 34%
Consumers who don’t like how plant-based
foods taste
Yale Climate Change report
Would eat plant-based over meat if products
tasted better
Yale Climate Change report
Not interested in alternatives to animal products
due to taste
Health Focus International
Name taste as a top reason for not wanting to eat
plant-based foods
Good Food Institute
Nielsen Homescan Panel, June 2020
And therefore, velocity and repeat purchasing behavior significantly lags animal-based foods
Dairy and Meat Alternative Sensory Focus Groups
Plant-based milk
Plant-based yogurt
Plant-based cheese
Plant-based ice cream
Plant-based meat
Taste is Very Much in the Mouth of the Beholder
Taste
Color
Moisture
“Taste”
Texture
Smell
Most Plant Substitutes are Limited in their Ability to Replace or Replicate Animal-Based Foods
AlmondNutty off-notes
Watery mouth coating
Grainy and powdery texture
Off-white/gray color
Low protein digestibility (PDCAAS)
Common Challenges:
CashewAllergen
Nutty off-notes
Off-notes from oxidation
SoybeanAllergen
Green, beany off-notes
Chalky and powdery texture
Gray/brown color (alt. dairy)
Wheat Gluten
Common allergen
Limited application space
Low solubility
Low protein digestibility (PDCAAS)
Pea
Green, beany off-notes
Chalky and powdery texture
Limited gelling
Gray/green color (alt. dairy)
Low protein digestibility (PDCAAS)
Mycoprotein
Limited application space
Off-flavors
Spongy texture
Success = Great Tasting, More Nutritious, Plant-Based Foods that People Crave
Target Applications for Novel Protein Sources
Whole Muscle
Ground applications Milk
Cheese
Yogurt
Ice Cream
Infant & Toddler Nutrition
Sports & Adult Nutrition
Snacks & Spreads Vegan Baking
Snacks & Jerky
Meat AlternativesDairy Alternatives Plant-Based Performance & Nutrition
Modify & Mask
Flavor Strategies
Process Strategies Soft Matter Physics & Material Science
Oral Processing Physics
Fundamental Understanding
Standard New
Formulation Strategies Gums Stabilizers
Sensory Testing QDA
Synthetic Biology
Cognitive Metrics
Novel Proteins and Ingredients Must Address Many Key Attributes
TasteRich, satisfying flavors and aromas
AppearanceTempting, mouth-watering color
TextureMeaty texture and juiciness
NutritionEnhanced fat, salt and protein quality
Meat Alternatives Dairy Alternatives Plant-Based Performance & NutritionTexture
Rich and creamy with smooth mouthfeel
StretchStringy, stretchy options
MeltConsistent bubble and meltiness
ProteinEnhanced nutrition
TextureSmooth and consistent mouthfeel
AppearanceColor and surface attributes
It is Critical to Look at Food Design Through the Lens of Physics, Chemistry, and Materials Science
Proteins
Fat performanceTexture
Rheological properties
Applying New Sciences to Food that Drive Breakthrough Discoveries
Oral processing physics Rheology Neurobiology
ShearThermalBiochemicalDilution Etc.
(saliva)
Oral Processing is Dynamic
Oral Processing
Structure
Property
Transport properties Sensory
Food transforms
Dynamic
oral processing time
Capturing the Physics in the “Stages” of Oral Processing
(i)
Rheology, tribology, interfacial techniques
Temporal Dominance Profiling
Multiple deformation scales & food-transformation
Oral process‘stages’
Partnership with Ginkgo Bioworks
Ginkgo can:
– To engineer strains at scale using rational and unbiased approaches simultaneously
– With gigabase-scale DNA synthesis capacity.
And they have significant physical and digital economies of scale.
TTGTTTAGTCGAGAGAGTTGCACACTTCACTGAAGTTCTGCAAATTATACATGAGCTGTACCCTGATTTGCAACTTCCAGAGAAATGTTCGGATGATAAACCTTTTGTGCCAACATATCAGGTGTCCAAAGAAAAGGCAAAGAGCTTGGGAATTGAGTTTATTCCATTAGACATTAGCCTCAAGGAAACAATTGAAAGCTTGAAGGAAAAGAGTATCGTCAGCTTCTGAATGAGCAACAAGGTGGTCTGCGTCACGGGTGCCTCCGGCTACATTGCTTCATGGCTCGTCAAGCTCCTCCTCCAACGCGGCTACACTGTCAAGGCCTCTGTTCGCAACCCAAATGATCCAACAAAGACGGAGCACTTGCTCGCACTTGATGGAGCTAAGGAGAGACTTCAACTTTTCAAAGCAGATCTATTAGAAGAAGGTTCTTTTGACTCTGCTGTTGAGGGCTGTGAGGGTGTTTTCCACACTGCATC
Biology is fundamentally programmable
22
Using Synthetic Biology to Produce Animal-Free Food Ingredients
Desired animal protein genes
DNA sequencer
Searchablesequencedatabases
Sequencing
Millions of gene sequences
1
Isolated genes
Programming and Gene Assembly
Nucleobases chemically synthesized from cane sugar derivatives
DNA Synthesizer “prints” small fragments of target sequence
Enzymes Enzymes
Target gene is assembled and prepared for host
Yeastvecto
r
2 Ingredient production
Animal proteins produced without animals
Fermentation process optimized for target
Energy source
Engineered metabolic pathways
New DNA incorporated
into yeast cells
3
The Cost of DNA Sequencing (Reading) and Synthesis (Writing) is Falling Dramatically
Gingko’s Foundry Produces Results
Synbio Case Study: Biodiversity for Better, More Functional Ovalbumin
Rapidly searching and screening thousands of potential ovalbumin proteins in bird eggs across the animal kingdom
Screening for Proteins that Express Well in P. Pastoris
Entirely New Food Forms that Create New Categories
Entirely New Food Forms that Create New Categories
Thank You
mleonard@motiffoodworks.com@mikeleonard
madewithmotif.com
top related