functional analysis of the p53 pathway in neuroblastoma...
Post on 27-May-2018
219 Views
Preview:
TRANSCRIPT
1
Functional analysis of the p53 pathway in neuroblastoma cells using the
small-molecule MDM2 antagonist nutlin-3∗
Tom Van Maerken,1,2 Ali Rihani,1 Daniel Dreidax,3 Sarah De Clercq,4 Nurten Yigit,1 Jean-
Christophe Marine,4 Frank Westermann,3 Anne De Paepe,1 Jo Vandesompele,1 Frank
Speleman1
1Center for Medical Genetics, Ghent University Hospital, Ghent, Belgium
2Department of Clinical Chemistry, Microbiology and Immunology, Ghent University
Hospital, Ghent, Belgium
3Department of Tumor Genetics, German Cancer Research Center, Heidelberg, Germany
4Laboratory for Molecular Cancer Biology, VIB-UGent, Ghent, Belgium
Running title: Analysis of the p53 pathway in neuroblastoma
Keywords: neuroblastoma, p53, nutlin-3, p14ARF
Abbreviations: CI, confidence interval; qPCR, quantitative real-time PCR; qRT-PCR,
quantitative real-time reverse transcription PCR
∗Grants: Research Foundation – Flanders (FWO), Concerted Research Actions – UGent (GOA), Interuniversity Attraction Poles – Belgium (IUAP), and Emmanuel van der Schueren Foundation. T. Van Maerken has conducted the study as Ph.D. fellow of the FWO. Correspondence: Tom Van Maerken, Center for Medical Genetics, Ghent University Hospital, De Pintelaan 185, B-9000 Ghent, Belgium. Phone: 32-9-332-0352; Fax: 32-9-332-6549. E-mail: Tom.VanMaerken@UGent.be Conflict-of-interest disclosure: None.
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
2
Abstract
Suppression of p53 activity is essential for proliferation and survival of tumor cells. A direct
p53-activating compound, nutlin-3, was used in this study, together with p53 mutation
analysis, to characterize p53 pathway defects in a set of 34 human neuroblastoma cell lines.
We identified 9 cell lines (26%) with a p53 loss-of-function mutation, including 6 missense
mutations, 1 nonsense mutation, 1 in-frame deletion, and 1 homozygous deletion of the 3′ end
of the p53 gene. Sensitivity to nutlin-3 was highly predictive of absence of p53 mutation.
Signaling pathways downstream of p53 were functionally intact in 23 out of 25 cell lines with
wild-type p53. Knockdown and overexpression experiments revealed a potentiating effect of
p14ARF expression on the response of neuroblastoma cells to nutlin-3. Our findings shed light
on the spectrum of p53 pathway lesions in neuroblastoma cells, indicate that defects in
effector molecules downstream of p53 are remarkably rare in neuroblastoma, and identify
p14ARF as a determinant of the outcome of the response to MDM2 inhibition. These insights
may prove useful for the clinical translation of evolving strategies aimed at p53 reactivation
and for the development of new therapeutic approaches.
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
3
Introduction
The p53 transcription factor plays a critical role in the cellular defense against malignant
transformation by promoting cell cycle arrest, DNA damage repair, apoptosis, and senescence
in response to stress signals (1). Tumor cells therefore invariably acquire aberrations that
permit them to escape from p53-mediated growth control. It is estimated that approximately
50% of all human cancers harbor inactivating mutations in the TP53 (p53) gene, whereas
defects in upstream or downstream components of the p53 pathway are believed to account
for loss of p53 activity in the other half of malignancies. Dissection of the p53 pathway
defects in individual tumor types is important, since improved understanding of the
mechanisms behind p53 inactivation may guide the development of targeted therapeutic
strategies.
Neuroblastoma is an aggressive childhood tumor of neural crest origin, that has a lethal
outcome in the majority of high-risk patients (2). A remarkable feature is that p53 is rarely
mutated at diagnosis and only in a minority of neuroblastoma tumors at relapse, as
demonstrated by a recent study that found mutation rates of 2% and 15%, respectively (3).
Conflicting data exist regarding p53 pathway signaling in neuroblastoma cells. The DNA
damage-induced G1 checkpoint function and apoptotic activity of p53 have been reported to
be impaired by cytoplasmic p53 sequestration (4-6), which may be caused by p53
hyperubiquitination (7). Furthermore, wild-type p53 in neuroblastoma cells may be in a
conformation refractory to integration into transcriptional complexes, resulting in reduced
transcriptional activity (8). In contrast, others have demonstrated a normal DNA-binding and
transactivation capacity of the p53 protein and an intact p53 signal transduction pathway in
neuroblastoma cells with wild-type p53 (9-11). No study has yet systematically investigated
the functional integrity of the p53 pathway in neuroblastoma cells on a larger scale, as the
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
4
reports mentioned above relied on the use of only one to five neuroblastoma cell lines to
judge on p53 functionality.
We have previously reported that a small-molecule MDM2 antagonist, nutlin-3, is capable of
inducing potent antitumor effects against neuroblastoma cells and xenografts with wild-type
p53, which may provide a new opportunity for targeted therapeutic intervention (12, 13).
Nutlin-3 is designed to compete with p53 for binding into a hydrophobic pocket on the
surface of MDM2 (14). The resulting disruption of the interaction between both proteins
releases p53 from negative control by MDM2, which functions as an E3 ubiquitin ligase to
promote p53 proteasomal degradation and as an inhibitor of p53 transcriptional activity.
Treatment with nutlin-3 thus leads to stabilization and activation of p53 and, if downstream
effectors are functionally intact, to a robust p53 response.
The availability of a direct and selective p53 activator makes it possible to systematically
search for defects in p53 and its downstream signaling components. Here, we set out to
examine the nature of p53 pathway defects in a large panel of neuroblastoma cell lines using
nutlin-3 as a tool for interrogating the functionality of the p53 pathway.
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
5
Materials and Methods
Cell culture and nutlin-3 treatment
Human neuroblastoma cell lines were obtained between 1993 and 2010 from Peter Ambros
(STA-NB-1.2, STA-NB-3, STA-NB-8, STA-NB-9, STA-NB-10), Garrett Brodeur (NGP,
NLF, NMB), Susan Cohn (NBL-S, SHEP), Valérie Combaret (CLB-GA), Thomas Look
(SJNB-1, SJNB-8, SJNB-10), John Lunec [SK-N-BE(1n), SK-N-BE(2c)], Sven Påhlman
(SH-SY5Y), Patrick Reynolds (CHP-134, CHP-901, CHP-902R, SMS-KAN, SMS-KCNR),
and Rogier Versteeg (GICIN-1, IMR-32, LA-N-1, LA-N-2, LA-N-5, LA-N-6, N-206, SK-N-
AS, SK-N-FI, SK-N-SH, TR-14), or established in our laboratory (UHG-NP). The
authenticity of the cell lines was verified during this study by array comparative genomic
hybridization and short tandem repeat genotyping. Cell culturing and treatment with nutlin-3
(Cayman Chemical, Ann Arbor, MI) were performed as previously described (12).
p53 mutation analysis
Sequencing of the p53 coding region was performed as previously described (12).
Cell viability analysis
Cells were seeded in duplicate or triplicate wells of a 96-well plate (104 cells per well) and
incubated for 6 h before treatment was initiated. Treatment typically consisted of exposure to
0, 2, 4, 8, 16, and 32 µM nutlin-3 for 24, 48, and 72 h, except for experiments with inducible
model systems, in which the inducing agent or a negative control was applied for 16 h prior to
incubation with nutlin-3. Cell viability was measured using a luminescent ATP-based assay
(CellTiter-Glo, Promega, Madison, WI).
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
6
Analysis of caspase-3 and caspase-7 activity
Cells were plated in duplicate or triplicate wells of a 96-well plate (104 cells per well) and
incubated for 6 h prior to treatment, which was performed in a similar way as described for
the cell viability experiments. The combined activity of caspase-3 and caspase-7 was
determined using the Caspase-Glo 3/7 assay (Promega).
Cell cycle and hypodiploidy analysis
Measurements of cell cycle phase distribution and hypodiploid (sub-G1) DNA content were
performed as previously described (13).
Quantitative real-time reverse transcription PCR (qRT-PCR)
Cells were treated with 0 or 8 µM nutlin-3 for 24 h (or, in the case of an inducible model
system, with the inducing agent or a negative control for 16 h and then with 0 or 8 µM nutlin-
3 for an additional 24 h). Total RNA extraction, DNase treatment, cDNA synthesis, and
SYBR Green I qRT-PCR were performed as previously described (13). Primer sequences are
available in the RTPrimerDB database (15): BAX (RTPrimerDB ID #814), BBC3 (PUMA;
#3500), CDKN1A (p21WAF1/CIP1; #631), GAPDH (#3), SDHA (#7), and UBC (#8). Expression
levels of the p53 target genes BAX, PUMA, and p21WAF1/CIP1 were calculated using qbasePLUS
software version 1.5 (Biogazelle, Ghent, Belgium) (16). Levels of GAPDH, SDHA, and UBC
were used for normalization.
Western blot analysis
Western blotting was performed as previously described (12) using primary antibodies against
p53 (mouse clone DO-1; Calbiochem, San Diego, CA), p21WAF1/CIP1 (mouse clone SX118;
BD Biosciences, San Jose, CA), and BAX (rabbit monoclonal antibody; Upstate,
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
7
Charlottesville, VA). An anti-β-actin antibody (mouse clone AC-74; Sigma, St. Louis, MO)
was used to confirm equal loading.
Knockdown and overexpression of CDKN2A (p16INK4a/p14ARF)
See Supplementary Data.
Statistical analysis
See Supplementary Data.
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
8
Results
p53 mutation analysis
The 34 human neuroblastoma cell lines used in this study were first characterized for
mutations in the p53 gene. Sequencing of the entire coding region in two overlapping
fragments demonstrated wild-type p53 in 25 cell lines (74%) and various genetic defects in
the other 9 cell lines (26%) (Table 1). The most frequent aberrations were missense
mutations, which were located in exon 5 [N-206, SK-N-BE(2c)], exon 6 (NLF), exon 7
(NMB, SK-N-FI), and exon 10 (LA-N-2) of p53. One cell line, LA-N-1, was characterized by
a nonsense mutation, resulting in a stop codon at amino acid residue 182. SJNB-8 cells were
found to possess an in-frame deletion that removes the coding sequence for amino acids 105-
125. The PCR step prior to the sequencing did not produce an amplicon for the second part of
the p53 coding region in SK-N-AS cells. It could be shown by quantitative real-time PCR
(qPCR) that this was due to a homozygous deletion of the 3′ end of p53 (Supplementary Fig.
S1), in line with previously published findings (17, 18).
Sensitivity to nutlin-3
We next used the selective MDM2 antagonist nutlin-3 to test whether the p53 pathway was
functional in our series of neuroblastoma cell lines. As illustrated in Fig. 1A, determination of
the nutlin-3 concentration that causes 50% reduction in cell viability (IC50 value) provides a
quantitative measure of the functional integrity of the p53 pathway. IC50 values were
established at 24, 48, and 72 h of nutlin-3 treatment and correlated with the mutation status of
p53 (Fig. 1B). Cell lines with wild-type p53 displayed highly significantly lower IC50 values
than lines harboring mutant p53 (P=0.004 at 24 h, P<0.001 at 48 and 72 h). All 9 cell lines
with p53 mutation were characterized by high IC50 values, indicating that the genetic
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
9
aberration effectively impaired the function of the p53 protein. Pronounced reductions in cell
viability after nutlin-3 treatment and corresponding low IC50 values were observed in 23 out
of the 25 cell lines with wild-type p53. This suggests that p53 downstream signaling pathways
are not a major target for p53-inactivating lesions in neuroblastoma and lends support to the
development of therapeutic strategies aimed at p53 reactivation.
Two cell lines, LA-N-6 and SHEP, were relatively resistant to nutlin-3 despite the presence of
wild-type p53 (IC50 values comparable to those observed in neuroblastoma lines with mutant
p53, i.e., IC50 values >32 µM, >30 µM, and >20 µM nutlin-3 at 24, 48, and 72 h of treatment,
respectively) (Fig. 1B). Of particular interest were SHEP cells, because their response to
nutlin-3 was strikingly different from that of two closely related cell lines, SK-N-SH and SH-
SY5Y. Cell line SK-N-SH was originally derived from bone marrow metastases of a patient
with stage 4 neuroblastoma, and subcloning of these cells has generated several
morphologically distinct sublines, including SHEP and SH-SY5Y (19). Fig. 2A demonstrates
that nutlin-3 profoundly suppressed the viability of SK-N-SH and SH-SY5Y cells, whereas
only mild effects were noted in SHEP cells. Further experiments were performed to determine
whether the poor nutlin-3 response of SHEP cells was due to failure to enter apoptosis or to
defective cell cycle arrest. Analysis of caspase-3 and caspase-7 activity indicated that a 24-h
exposure to nutlin-3 induced a dose-dependent apoptotic response in SK-N-SH and SH-SY5Y
cells (Fig. 2B). In contrast, no increase in caspase-3 and caspase-7 activity was observed in
nutlin-3-treated SHEP cells. This was confirmed by flow cytometric analysis of sub-G1 DNA
content after treatment with vehicle control or 8 µM nutlin-3 for 24 h, which showed a nutlin-
3-induced increase in the apoptotic sub-G1 fraction in SK-N-SH and SH-SY5Y cells, but not
in SHEP cells (Fig. 2C). Flow cytometric cell cycle profiling further demonstrated a reduction
in the percentage of cells in S phase 24 h after treatment of SK-N-SH, SH-SY5Y, and SHEP
cells with 8 µM nutlin-3, indicative of cell cycle arrest in all three cell lines (Fig. 2D). The
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
10
phenotypic effects of nutlin-3 on apoptosis and cell cycle progression were paralleled by
similar changes in expression levels of p53 target genes. As shown in Fig. 2E, a 24-h
treatment of SK-N-SH and SH-SY5Y cells with 8 µM nutlin-3 induced an increase in the
mRNA levels of p53 target genes involved in apoptosis (BAX, PUMA) and cell cycle arrest
(p21WAF1/CIP1). A large increase in p21WAF1/CIP1 expression was also present in SHEP cells
treated with 8 µM nutlin-3 for 24 h, but expression levels of the proapoptotic target genes
BAX and PUMA remained considerably lower in nutlin-3-treated SHEP cells than in nutlin-3-
treated SK-N-SH and SH-SY5Y cells. Similar findings were observed by Western blot
analysis. Treatment with 8 µM nutlin-3 for 24 h induced p53 accumulation and increased
expression of p21WAF1/CIP1 in all three cell lines, whereas induction of BAX expression was
observed only in nutlin-3-treated SK-N-SH and SH-SY5Y cells (Fig. 2F). Taken together,
these data indicate that SHEP cells have an intact cell cycle checkpoint control mechanism,
but fail to undergo apoptosis in response to treatment with nutlin-3.
Interestingly, SHEP cells have previously been reported to contain a homozygous deletion of
the CDKN2A gene on chromosome 9p21, in contrast to SK-N-SH and SH-SY5Y cells (20).
We confirmed the copy number status of CDKN2A in these three cell lines by qPCR
(Supplementary Fig. S2). The CDKN2A gene encodes two structurally distinct growth-
inhibitory proteins, p16INK4a and p14ARF, that are important regulators of the pRb and p53
tumor suppressor pathways, respectively (21). This raised the possibility that the homozygous
CDKN2A deletion may underlie the nutlin-3-resistant phenotype of SHEP cells. Analysis of
the entire panel of 25 neuroblastoma cell lines with wild-type p53 further revealed that the
presence of homozygous CDKN2A deletion was strongly associated with a higher IC50 value
at 48 and 72 h of nutlin-3 treatment (P=0.009 and P<0.001, respectively) (Supplementary
Table S1). Amplification of MDM2 did not have an impact on the IC50 values of
neuroblastoma cell lines with wild-type p53 (P>0.05) (Supplementary Table S1). MYCN-
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
11
amplified neuroblastoma cell lines with wild-type p53 were characterized by a lower IC50
value at 72 h of nutlin-3 treatment than wild-type p53 neuroblastoma cell lines without MYCN
amplification (P=0.023), but this difference was not observed anymore after exclusion of cell
lines with homozygous CDKN2A deletion (P>0.05) (Supplementary Table S1). No significant
difference in p53 mutation status nor in MDM2 and CDKN2A copy number status was found
between MYCN-amplified and MYCN-nonamplified neuroblastoma cell lines (P>0.05)
(Supplementary Table S2).
Effect of CDKN2A knockdown on the response to nutlin-3
A possible involvement of p14ARF and p16INK4a in the nutlin-3 response was first tested by
transient knockdown of the CDKN2A gene in IMR-32 and NGP cells, two easy-to-transfect
neuroblastoma cell lines that have a good and previously well-characterized nutlin-3 response
(12), using a pool of siRNAs directed against sequences common to both p14ARF and p16INK4a
transcripts. The efficiency of CDKN2A knockdown, measured by qRT-PCR 24 h
posttransfection, is shown in Fig. 3A. Silencing of CDKN2A resulted in a moderate reduction
in the sensitivity of IMR-32 and NGP cells to nutlin-3, as demonstrated by cell viability
assays performed after 24, 48, and 72 h of exposure to nutlin-3 (Fig. 3B and C).
To unravel whether this potentiating effect of CDKN2A expression on the response to nutlin-3
was mediated by p14ARF or p16INK4a, NGP cells were infected with lentiviruses encoding a
p14ARF-specific shRNA, a p16INK4a-specific shRNA, an shRNA directed simultaneously
against both transcripts, or a negative control shRNA targeting firefly luciferase, and
subsequently selected with puromycin to eliminate uninfected cells. qRT-PCR analysis of
p14ARF and p16INK4a expression in the established sublines, termed NGP-LV-p14, NGP-LV-
p16, NGP-LV-p14/p16, and NGP-LV-luc, respectively, demonstrated successful transcript-
specific knockdown (Fig. 4A). Treatment of these stable knockdown cell lines with nutlin-3
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
12
followed by cell viability assays indicated that the influence of CDKN2A expression on the
nutlin-3 response was primarily attributable to p14ARF (Fig. 4B). These findings were
confirmed by analysis of caspase-3 and caspase-7 activity, which showed that silencing of
p14ARF decreased the susceptibility of NGP cells to undergo apoptosis upon nutlin-3 treatment
(Fig. 4C). Quantification of p53 target gene expression demonstrated that knockdown of
p14ARF, but not p16INK4a, attenuated the p53 transcriptional response induced by a 24-h
exposure to 8 µM nutlin-3 (Fig. 4D). This was accompanied by a marked p14ARF shRNA-
induced decrease in the basal mRNA levels of PUMA and p21WAF1/CIP1 in vehicle-treated cells,
whereas BAX expression was upregulated to a lesser extent by nutlin-3, rather than basically
suppressed, when p14ARF was silenced.
Effect of CDKN2A overexpression on the response to nutlin-3
We next examined whether overexpression of CDKN2A could enhance the response of
neuroblastoma cells to nutlin-3. We therefore generated stable transfectants of an IMR-32
subclone, IMR-5/75, in which transgenic expression of either p14ARF or p16INK4a or, as a
negative control, lacZ was inducible by addition of tetracycline. Fig. 5A shows the relative
mRNA expression levels of p14ARF and p16INK4a in these sublines, designated as IMR-Tet-
p14, IMR-Tet-p16, and IMR-Tet-lacZ, respectively, 24 h after treatment with tetracycline or
vehicle control. Overexpression of p14ARF resulted in a more pronounced reduction in cell
viability and stronger caspase-3 and caspase-7 activation following nutlin-3 treatment,
whereas overexpression of p16INK4a or lacZ had no appreciable effect on the nutlin-3 response
(Fig. 5B and C). In line with these observations, incubation of IMR-Tet-p14 cells with 8 µM
nutlin-3 for 24 h induced a more potent p53 transcriptional response when the cells had been
exposed to tetracycline compared to vehicle control (Fig. 5D). The expression of PUMA and
p21WAF1/CIP1 in these cells in the absence of nutlin-3 was also considerably increased by the
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
13
addition of tetracycline. In contrast, switching on transgene expression in IMR-Tet-p16 and
IMR-Tet-lacZ cells did not affect basal nor nutlin-3-induced expression levels of p53-
responsive genes.
Finally, similar CDKN2A overexpression experiments were undertaken in SHEP cells to
investigate whether this manipulation could restore the sensitivity to nutlin-3. Despite
successful generation of several sublines with tetracycline-inducible expression of p14ARF and
p16INK4a, we did not observe a reversal or improvement of the nutlin-3-resistant phenotype of
SHEP cells (Supplementary Fig. S3).
Taken together, our data provide evidence for a dosage effect of p14ARF expression on the
response of neuroblastoma cells to nutlin-3, but they also indicate that the homozygous
CDKN2A deletion in SHEP cells is not responsible for the poor response of these cells to
nutlin-3.
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
14
Discussion
The p53 tumor suppressor protein is at the crossroads of cellular stress response pathways that
control decisions between life and death. We used here the selective MDM2 antagonist nutlin-
3 as a tool to gain insight into the mechanisms by which neuroblastoma cells escape from
p53-mediated growth control. Mutation analysis demonstrated a p53 gene alteration in 9 out
of 34 neuroblastoma cell lines, which rendered the p53 pathway nonfunctional in all cases.
Three mutations were located outside the classic hot-spot region (exons 5-9), indicating that
p53 mutations are best identified by sequencing the entire coding region. The observed
mutation frequency in our cell line panel (26%) is considerably higher than the p53 mutation
rate of approximately 1% that was found in early studies of neuroblastoma tumors (22-27).
This may reflect the fact that cell lines are frequently derived from progressive or relapsed
tumors, as p53 mutations can develop during chemotherapy and malignant progression of
neuroblastoma (28). Additionally, older studies may have underestimated to some extent the
p53 mutation frequency in neuroblastoma tumors, since analysis was often confined to the
mutational hot-spot region.
Treatment with nutlin-3 was capable of inducing potent antiproliferative and cytotoxic effects
in 23 out of 25 neuroblastoma cell lines with wild-type p53. These findings are particularly
relevant in the light of an ongoing debate whether p53 is functional in neuroblastoma or not
(4-11). Discrepancies between previous studies may be in part attributed to different treatment
regimens (11) and to whether the p53-inducing stimulus directly interferes with potential
restraints on p53 activity, such as p53 hyperubiquitination (7). Our data provide good
evidence of almost uniform functionality of the p53 protein and its downstream effectors in
neuroblastoma cells with wild-type p53 when the interaction between p53 and MDM2 is
disrupted by nutlin-3. As a consequence, selective MDM2 inhibitors may prove beneficial for
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
15
treating neuroblastoma patients, provided that wild-type p53 is present. Our findings of
functional p53 effector pathways also suggest that circumvention of the p53-driven antitumor
barrier in neuroblastoma cells relies primarily on defects upstream of p53. Cumulating
evidence indicates that it is precisely an increased activity of MDM2 which serves as the
predominant mode of p53 inactivation in neuroblastoma (28), but further study is warranted to
identify the full spectrum of aberrations in regulators of p53 activity.
The presence of a homozygous CDKN2A deletion in the nutlin-3-refractory SHEP cells but
not in the nutlin-3-sensitive SK-N-SH and SH-SY5Y cells prompted us to investigate the role
of p14ARF and p16INK4a in the response to nutlin-3. The nutlin-3-resistant phenotype of SHEP
cells could not be reversed by reintroduction of p14ARF or p16INK4a, but knockdown and
overexpression experiments in other neuroblastoma cell lines pointed to a stimulatory effect
of p14ARF expression on the nutlin-3 response. Our data suggest that a p14ARF-driven increase
in basal expression levels of p53-responsive genes, such as PUMA and p21WAF1/CIP1,
contributes to this potentiating effect of p14ARF, although other mechanisms cannot be
excluded. High levels of the MDM2-inhibitory protein p14ARF may result in a larger fraction
of the nuclear pool of MDM2 molecules being inhibited after nutlin-3 treatment and thus in
stronger activation of the p53 pathway. Alternatively, p14ARF may provide a costimulatory
signal for the p53 response independently of MDM2. For instance, p14ARF may increase p53
protein synthesis (29), inhibit p53 turnover by repressing other components of the p53
degradation pathway than MDM2 (30), enhance p53 transcriptional activity (31), or regulate
pathways that crosstalk with p53 signaling (32). We did not aim to identify the molecular
basis of the cooperation between p14ARF and nutlin-3 in this study, but rather wish to
comment on the potential clinical implications. Previous studies using mouse models have
demonstrated that Cdkn2a mutations induce chemoresistance by disabling p53 (33) and that
loss of p19ARF, the murine homolog of p14ARF, limits the therapeutic response to the tyrosine
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
16
kinase inhibitor imatinib (34). Based on our findings, it can be expected that tumor cells may
also gain resistance to nutlin-3 treatment by suppressing p14ARF. The likelihood of this
scenario is corroborated by data from a switchable p53 knock-in mouse model of lymphoma
showing that p53 reactivation strongly selects for the emergence of p53-resistant tumors
through inactivation of either p53 or p19ARF (35). Several early-phase clinical studies with
selective MDM2 inhibitors and other p53-reactivating compounds have recently been initiated
(36). Our data indicate that the occurrence of aberrations in p14ARF should be monitored in
these studies and provide an incentive for the development of strategies to counter p14ARF
lesions.
The lack of improvement in nutlin-3 sensitivity after reintroduction of p14ARF into SHEP cells
leaves us with the question of how to explain the resistant phenotype of these cells. We
provided evidence of intact cell cycle arrest but defective apoptosis following nutlin-3
treatment of SHEP cells. This cell line is also resistant to other apoptosis-inducing stimuli,
including irradiation (37, 38) and adenoviral gene therapy (39). The poor sensitivity to death-
inducing triggers might be related to the S-type (substrate-
adherent/Schwannian/melanoblastic) morphology of SHEP cells, as S-type neuroblastoma
cells seem to be more resistant to apoptosis than N-type (neuroblastic/neuroendocrine)
neuroblastoma cells (40). Another notable feature is that SHEP cells have lost the capacity to
form colonies in soft agar and tumors in nude mice (41). One could therefore wonder whether
the loss of oncogenic signals – which often have a collateral proapoptotic effect – may result
in desensitization to apoptosis. For instance, SHEP cells lack expression of the MYCN
oncoprotein, and artificial induction of MYCN expression in these cells has been shown to
slightly increase the sensitivity to nutlin-3 (42). Alternatively, SHEP cells may contain high
levels of antiapoptotic proteins, as has been previously proposed (37). Further study is needed
to pinpoint the exact mechanism underlying the nutlin-3-resistant phenotype of SHEP cells.
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
17
In conclusion, this study provides several insights into the spectrum of p53 pathway defects in
neuroblastoma cells that may prove useful for designing new therapeutic approaches. The
rarity of signaling defects downstream of p53 indicates that p53-reactivating strategies may
represent an excellent therapeutic tool for treating neuroblastoma tumors with wild-type p53.
Resistance to nutlin-3 is mostly attributable to the presence of p53 mutation, which is not
uncommon in neuroblastoma cell lines. This highlights the need to search for effective p53-
independent anticancer agents or mutant p53-targeting compounds as a complementary
therapeutic modality. Finally, the finding that p14ARF expression levels modulate the
sensitivity of neuroblastoma cells to nutlin-3 raises the possibility that p14ARF may contribute
to the outcome of p53 activation in patients treated with selective MDM2 inhibitors. It
remains to be determined whether clinical treatment failure with this new class of anticancer
drugs may result from loss or suppression of p14ARF.
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
18
Acknowledgments
We thank Griet Van Lancker and Xiaoyang Zhang for technical assistance.
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
19
References
1. Levine AJ, Oren M. The first 30 years of p53: growing ever more complex. Nat Rev Cancer 2009;9:749–58. 2. Maris JM, Hogarty MD, Bagatell R, Cohn SL. Neuroblastoma. Lancet 2007;369:2106–20. 3. Carr-Wilkinson J, O'Toole K, Wood KM, Challen CC, Baker AG, Board JR, et al. High frequency of p53/MDM2/p14ARF pathway abnormalities in relapsed neuroblastoma. Clin Cancer Res 2010;16:1108–18. 4. Moll UM, Ostermeyer AG, Haladay R, Winkfield B, Frazier M, Zambetti G. Cytoplasmic sequestration of wild-type p53 protein impairs the G1 checkpoint after DNA damage. Mol Cell Biol 1996;16:1126–37. 5. Rodriguez-Lopez AM, Xenaki D, Eden TO, Hickman JA, Chresta CM. MDM2 mediated nuclear exclusion of p53 attenuates etoposide-induced apoptosis in neuroblastoma cells. Mol Pharmacol 2001;59:135–43. 6. Wang X, Zalcenstein A, Oren M. Nitric oxide promotes p53 nuclear retention and sensitizes neuroblastoma cells to apoptosis by ionizing radiation. Cell Death Differ 2003;10:468–76. 7. Becker K, Marchenko ND, Maurice M, Moll UM. Hyperubiquitylation of wild-type p53 contributes to cytoplasmic sequestration in neuroblastoma. Cell Death Differ 2007;14:1350–60. 8. Wolff A, Technau A, Ihling C, Technau-Ihling K, Erber R, Bosch FX, et al. Evidence that wild-type p53 in neuroblastoma cells is in a conformation refractory to integration into the transcriptional complex. Oncogene 2001;20:1307–17. 9. Goldman SC, Chen CY, Lansing TJ, Gilmer TM, Kastan MB. The p53 signal transduction pathway is intact in human neuroblastoma despite cytoplasmic localization. Am J Pathol 1996;148:1381–5. 10. Chen L, Malcolm AJ, Wood KM, Cole M, Variend S, Cullinane C, et al. p53 is nuclear and functional in both undifferentiated and differentiated neuroblastoma. Cell Cycle 2007;6:2685–96. 11. Xue C, Haber M, Flemming C, Marshall GM, Lock RB, MacKenzie KL, et al. p53 determines multidrug sensitivity of childhood neuroblastoma. Cancer Res 2007;67:10351–60. 12. Van Maerken T, Speleman F, Vermeulen J, Lambertz I, De Clercq S, De Smet E, et al. Small-molecule MDM2 antagonists as a new therapy concept for neuroblastoma. Cancer Res 2006;66:9646–55. 13. Van Maerken T, Ferdinande L, Taildeman J, Lambertz I, Yigit N, Vercruysse L, et al. Antitumor activity of the selective MDM2 antagonist nutlin-3 against chemoresistant neuroblastoma with wild-type p53. J Natl Cancer Inst 2009;101:1562–74. 14. Vassilev LT, Vu BT, Graves B, Carvajal D, Podlaski F, Filipovic Z, et al. In vivo activation of the p53 pathway by small-molecule antagonists of MDM2. Science 2004;303:844–8. 15. Lefever S, Vandesompele J, Speleman F, Pattyn F. RTPrimerDB: the portal for real-time PCR primers and probes. Nucleic Acids Res 2009;37:D942–5. 16. Hellemans J, Mortier G, De Paepe A, Speleman F, Vandesompele J. qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol 2007;8:R19.
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
20
17. Goldschneider D, Horvilleur E, Plassa LF, Guillaud-Bataille M, Million K, Wittmer-Dupret E, et al. Expression of C-terminal deleted p53 isoforms in neuroblastoma. Nucleic Acids Res 2006;34:5603–12. 18. Nakamura Y, Ozaki T, Niizuma H, Ohira M, Kamijo T, Nakagawara A. Functional characterization of a new p53 mutant generated by homozygous deletion in a neuroblastoma cell line. Biochem Biophys Res Commun 2007;354:892–8. 19. Biedler JL, Roffler-Tarlov S, Schachner M, Freedman LS. Multiple neurotransmitter synthesis by human neuroblastoma cell lines and clones. Cancer Res 1978;38:3751–7. 20. Carr J, Bell E, Pearson AD, Kees UR, Beris H, Lunec J, et al. Increased frequency of aberrations in the p53/MDM2/p14ARF pathway in neuroblastoma cell lines established at relapse. Cancer Res 2006;66:2138–45. 21. Lowe SW, Sherr CJ. Tumor suppression by Ink4a–Arf: progress and puzzles. Curr Opin Genet Dev 2003;13:77–83. 22. Imamura J, Bartram CR, Berthold F, Harms D, Nakamura H, Koeffler HP. Mutation of the p53 gene in neuroblastoma and its relationship with N-myc amplification. Cancer Res 1993;53:4053–8. 23. Komuro H, Hayashi Y, Kawamura M, Hayashi K, Kaneko Y, Kamoshita S, et al. Mutations of the p53 gene are involved in Ewing's sarcomas but not in neuroblastomas. Cancer Res 1993;53:5284–8. 24. Ohgaki H, Eibl RH, Schwab M, Reichel MB, Mariani L, Gehring M, et al. Mutations of the p53 tumor suppressor gene in neoplasms of the human nervous system. Mol Carcinog 1993;8:74–80. 25. Vogan K, Bernstein M, Leclerc JM, Brisson L, Brossard J, Brodeur GM, et al. Absence of p53 gene mutations in primary neuroblastomas. Cancer Res 1993;53:5269–73. 26. Castresana JS, Bello MJ, Rey JA, Nebreda P, Queizan A, Garcia-Miguel P, et al. No TP53 mutations in neuroblastomas detected by PCR-SSCP analysis. Genes Chromosomes Cancer 1994;10:136–8. 27. Hosoi G, Hara J, Okamura T, Osugi Y, Ishihara S, Fukuzawa M, et al. Low frequency of the p53 gene mutations in neuroblastoma. Cancer 1994;73:3087–93. 28. Van Maerken T, Vandesompele J, Rihani A, De Paepe A, Speleman F. Escape from p53-mediated tumor surveillance in neuroblastoma: switching off the p14ARF-MDM2-p53 axis. Cell Death Differ 2009;16:1563–72. 29. Huang Y, Tyler T, Saadatmandi N, Lee C, Borgstrom P, Gjerset RA. Enhanced tumor suppression by a p14ARF/p53 bicistronic adenovirus through increased p53 protein translation and stability. Cancer Res 2003;63:3646–53. 30. Chen D, Kon N, Li M, Zhang W, Qin J, Gu W. ARF-BP1/Mule is a critical mediator of the ARF tumor suppressor. Cell 2005;121:1071–83. 31. Miao L, Song Z, Jin L, Zhu YM, Wen LP, Wu M. ARF antagonizes the ability of Miz-1 to inhibit p53-mediated transactivation. Oncogene 2010;29:711–22. 32. Rocha S, Garrett MD, Campbell KJ, Schumm K, Perkins ND. Regulation of NF-κB and p53 through activation of ATR and Chk1 by the ARF tumour suppressor. Embo J 2005;24:1157–69. 33. Schmitt CA, McCurrach ME, de Stanchina E, Wallace-Brodeur RR, Lowe SW. INK4a/ARF mutations accelerate lymphomagenesis and promote chemoresistance by disabling p53. Genes Dev 1999;13:2670–7. 34. Williams RT, Roussel MF, Sherr CJ. Arf gene loss enhances oncogenicity and limits imatinib response in mouse models of Bcr-Abl-induced acute lymphoblastic leukemia. Proc Natl Acad Sci U S A 2006;103:6688–93. 35. Martins CP, Brown-Swigart L, Evan GI. Modeling the therapeutic efficacy of p53 restoration in tumors. Cell 2006;127:1323–34.
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
21
36. Brown CJ, Lain S, Verma CS, Fersht AR, Lane DP. Awakening guardian angels: drugging the p53 pathway. Nat Rev Cancer 2009;9:862–73. 37. Jasty R, Lu J, Irwin T, Suchard S, Clarke MF, Castle VP. Role of p53 in the regulation of irradiation-induced apoptosis in neuroblastoma cells. Mol Genet Metab 1998;65:155–64. 38. Tweddle DA, Malcolm AJ, Cole M, Pearson AD, Lunec J. p53 cellular localization and function in neuroblastoma: evidence for defective G1 arrest despite WAF1 induction in MYCN-amplified cells. Am J Pathol 2001;158:2067–77. 39. Van Maerken T, Sarkar D, Speleman F, Dent P, Weiss WA, Fisher PB. Adenovirus-mediated hPNPaseold-35 gene transfer as a therapeutic strategy for neuroblastoma. J Cell Physiol 2009;219:707–15. 40. Mergui X, Leteurtre F, Lipinski M, Benard J, Amor-Gueret M. Two distinctly altered cellular responses to DNA double-strand breaks in human neuroblastoma. Biochimie 2008;90:1656–66. 41. Ross RA, Spengler BA. Human neuroblastoma stem cells. Semin Cancer Biol 2007;17:241–7. 42. Barbieri E, Mehta P, Chen Z, Zhang L, Slack A, Berg S, et al. MDM2 inhibition sensitizes neuroblastoma to chemotherapy-induced apoptotic cell death. Mol Cancer Ther 2006;5:2358–65. 43. Davidoff AM, Pence JC, Shorter NA, Iglehart JD, Marks JR. Expression of p53 in human neuroblastoma- and neuroepithelioma-derived cell lines. Oncogene 1992;7:127–33. 44. Teitz T, Wei T, Liu D, Valentine V, Valentine M, Grenet J, et al. Caspase-9 and Apaf-1 are expressed and functionally active in human neuroblastoma tumor cell lines with 1p36 LOH and amplified MYCN. Oncogene 2002;21:1848–58. 45. Tweddle DA, Malcolm AJ, Bown N, Pearson AD, Lunec J. Evidence for the development of p53 mutations after cytotoxic therapy in a neuroblastoma cell line. Cancer Res 2001;61:8–13.
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
22
Table 1. Neuroblastoma cell lines with p53 mutation
Cell line p53 mutation* Previous report
LA-N-1 546C>A (C182X)† Yes (43) LA-N-2 1009C>T (R337C) No N-206 529C>A (P177T) No NLF 607G>A (V203M) No NMB 733G>A (G245S) Yes (9) SJNB-8 313-375delGGCAGCTACGGTTTCC
GTCTGGGCTTCTTGCATTCTGGGA CAGCCAAGTCTGTGACTTGCACG
(GSYGFRLGFLHSGTAKSVTCT105-125del)
Yes (44)
SK-N-AS Homozygous deletion of exons 10-11‡ Yes (17, 18) SK-N-BE(2c) 404G>T (C135F) Yes (45) SK-N-FI 737T>G (M246R) Yes (12)
*The other neuroblastoma cell lines in this study were wild-type for p53. †X, termination codon. ‡See Supplementary Fig. S1.
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
23
Figure legends
Figure 1. Sensitivity of neuroblastoma cells to nutlin-3. A, principle of p53 pathway probing
by determination of the IC50 value of nutlin-3. B, distribution of IC50 values of nutlin-3 in 34
neuroblastoma cell lines according to p53 mutation status. Calculated IC50 values above 32
µM fall outside the range of tested nutlin-3 concentrations and are denoted by dots at 32 µM.
Bars, median IC50 value; solid arrow, SHEP cells; dashed arrow, LA-N-6 cells.
Figure 2. Impairment of the apoptotic response to nutlin-3 in SHEP cells, but not in SK-N-
SH and SH-SY5Y cells. A, effect of nutlin-3 treatment for 24, 48, and 72 h on cell viability.
Bars, SD (n=3). B, caspase-3 and caspase-7 activity after a 24-h exposure to nutlin-3, relative
to a similar amount of viable vehicle-treated cells. Bars, SD (n=3). C, flow cytometric
analysis of the apoptotic sub-G1 fraction after 0 or 8 µM nutlin-3 for 24 h. Bars, SD (n=3). D,
flow cytometric analysis of cell cycle phase distribution after 0 or 8 µM nutlin-3 for 24 h.
Results are derived from the same three experiments as those used for sub-G1 quantification.
E, qRT-PCR analysis of p53 target gene expression after 0 or 8 µM nutlin-3 for 24 h. Bars,
SEM of duplicate wells. F, Western blot analysis of p53, p21WAF1/CIP1, and BAX expression
after 0 or 8 µM nutlin-3 for 24 h. β-actin is shown as loading control.
Figure 3. Transient silencing of CDKN2A decreases the sensitivity of IMR-32 and NGP cells
to nutlin-3. A, qRT-PCR assessment of siRNA-mediated CDKN2A knockdown 24 h
posttransfection, using a primer pair that measures both p14ARF and p16INK4a. Bars, SEM of
duplicate wells. B and C, effect of CDKN2A knockdown on the nutlin-3 response. Cells were
transfected with negative control siRNA or CDKN2A siRNA and subsequently treated with
nutlin-3 for 24, 48, and 72 h, followed by cell viability analysis. Three independent
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
24
experiments were performed. Dose-response curves at 24 h, derived from a representative
experiment, are shown as an example in B. Bars, SD of duplicate wells. RLU, relative
luminescence units. IC50 ratios at 24, 48, and 72 h, defined as the fold change in the IC50 value
of nutlin-3 after CDKN2A knockdown relative to control transfection and derived from the
three experiments, are shown in C. All IC50 ratios were >1, indicating that CDKN2A silencing
suppresses the response to nutlin-3. Bars, 95% confidence interval (CI).
Figure 4. Stable knockdown of p14ARF attenuates the response of NGP cells to nutlin-3. A,
qRT-PCR analysis of p14ARF and p16INK4a expression in NGP cells transduced with
lentiviruses carrying a negative control shRNA (NGP-LV-luc), an shRNA targeting
simultaneously p14ARF and p16INK4a (NGP-LV-p14/p16), a p14ARF-specific shRNA (NGP-LV-
p14), or a p16INK4a-specific shRNA (NGP-LV-p16). Bars, SEM of duplicate wells. B, IC50
values as determined by cell viability assays at 24, 48, and 72 h of nutlin-3 treatment. Three
independent experiments were performed. Bars, 95% CI. C, EC50 values as determined by
caspase-3 and caspase-7 assays at 24, 48, and 72 h of nutlin-3 treatment. The EC50 value is the
half-maximal effective concentration of nutlin-3 for caspase activation, as defined in the
“Statistical analysis” section. Two independent experiments were performed. Bars, 95% CI.
D, qRT-PCR analysis of p53 target gene expression after 0 or 8 µM nutlin-3 for 24 h. Bars,
SEM of duplicate wells.
Figure 5. Overexpression of p14ARF increases the sensitivity of IMR-5/75 cells to nutlin-3. A,
qRT-PCR measurement of p14ARF and p16INK4a expression in IMR-5/75 cells stably
transfected with a tetracycline-inducible expression vector for a negative control construct
(IMR-Tet-lacZ), p14ARF (IMR-Tet-p14), or p16INK4a (IMR-Tet-p16). Cells were treated with 1
µg/mL tetracycline or vehicle control for 24 h. Bars, SEM of duplicate wells. B, effect of
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
25
p14ARF and p16INK4a overexpression on the cell viability response to nutlin-3. Cells were
treated with 1 µg/mL tetracycline or vehicle control and subsequently exposed to nutlin-3 for
24, 48, and 72 h, followed by cell viability analysis. IC50 ratios were determined as the fold
change in the IC50 value of nutlin-3 after tetracycline pretreatment compared to vehicle
control. IC50 ratios in IMR-Tet-p14 cells were <1 at all time points, indicating that p14ARF
overexpression increases the sensitivity to nutlin-3. Three independent experiments were
performed. Bars, 95% CI. C, effect of p14ARF and p16INK4a overexpression on the apoptotic
response to nutlin-3. Cells were treated with 1 µg/mL tetracycline or vehicle control and then
exposed to nutlin-3 for 24 h, followed by caspase-3 and caspase-7 analysis. Ratios of caspase-
3 and caspase-7 activity were calculated as the fold change in nutlin-3-induced caspase
activity after tetracycline administration compared to vehicle control. Ratios of caspase-3 and
caspase-7 activity in IMR-Tet-p14 cells were >1 at all nutlin-3 concentrations, indicating that
p14ARF overexpression enhances the apoptotic response to nutlin-3. Three independent
experiments were performed. Bars, 95% CI. D, qRT-PCR analysis of p53 target gene
expression after treatment with 1 µg/mL tetracycline or vehicle control and subsequent
exposure to 0 or 8 µM nutlin-3 for 24 h. Bars, SEM of duplicate wells.
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
Published OnlineFirst April 1, 2011.Mol Cancer Ther Tom Van Maerken, Ali Rihani, Daniel Dreidax, et al. using the small-molecule MDM2 antagonist nutlin-3Functional analysis of the p53 pathway in neuroblastoma cells
Updated version
10.1158/1535-7163.MCT-10-1090doi:
Access the most recent version of this article at:
Material
Supplementary
http://mct.aacrjournals.org/content/suppl/2011/04/07/1535-7163.MCT-10-1090.DC1
Access the most recent supplemental material at:
Manuscript
Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been
E-mail alerts related to this article or journal.Sign up to receive free email-alerts
Subscriptions
Reprints and
.pubs@aacr.orgDepartment at
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Permissions
Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)
.http://mct.aacrjournals.org/content/early/2011/04/01/1535-7163.MCT-10-1090To request permission to re-use all or part of this article, use this link
on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090
top related