environmental signal integration by a modular and gate

Environmental Signal Integration by a Modular AND

Gate

By J Christopher Anderson, Christopher A Voigt and Adam P Arkin

Presented by Alexandra Doolittle for 20.385

02.16.2010

Hypothesis

• AND Gates can be used to integrate environmental information

• The AND gate is modular since promoters comprise both the inputs and output of the system

The AND Gate

Input A- Promoter which controls the Transcription of T7 RNA Polymerase (mod - 2 amber STOP codons)

Input B- Promoter which controls the amber suppressor tRNA supD

Output - T7 RNA is synthesized and activates T7 promoter

AND Gate to Translate T7 RNA Polymerase Resulting in GFP Expression

QuickTime™ and a decompressor

are needed to see this picture.

Common Genetic Circuit Problem - Impedance Matching

Construct 1: GFP was produced in the absence of salicate. Rbs for PBAD was strong enough to produce T7 poly

Input T7 Poly

output GFP

Saturation Mutation Library for PBAD

• Parental GGAGGAATTAACCATG• Libraryb NNNGGAATTAACCRTG• B9 CTAGGAATTAACCGTG• F11 AAAGGAATTAACCGTG• MgrB AAAGGAATTAACCATG• Salc TCAGGAGTCATCATTATTTATG

B9 Characterization through Fluorimetry and Flow Cytommetry

A. Visualised 64 combinations of inducers through Fluorimetry

B. 1000 fold induction between on and off states.

QuickTime™ and a decompressor

are needed to see this picture.

Transfer Function

• steady state response of the system as a function of the activity of the input promoters– Can understand how the input promoters affect the function– Black Box Model: levels of input output

• I1 and I2 represent PBAD and Psal

Transfer Function Characterization for Each Promoter

• Currently - use mutation and screening to determine the best rbs strength

• Now- use the transfer function to determine the strength of rbs needed

QuickTime™ and a decompressor

are needed to see this picture.

B9 Transfer Function Data Fit to determine a and b

• a = 50

• b = 3000

QuickTime™ and a decompressor

are needed to see this picture.

Range of Output Possibilities

• B9 and F11 visualization of input strength to output

• Demonstrates the entire range of possibilities. – Movement of the

white box determined via rbs strength

QuickTime™ and a decompressor

are needed to see this picture.

AND Gate Modularity

QuickTime™ and a decompressor

are needed to see this picture.

Critique• Transfer Function - based on steady state.

Fails to take into account dynamic system responses.– Black Box model to simple.

• Cell characteristics could affect the response– Nutrient levels– Temperature– Phase of Growth

Why Do We Care?

• Integrating multiple signals from the environment can increase sensing specificity.

• Can identify new environments where there is not a strong recognizable single symbol.

• The modularity allows the circuit to be attached to multiple inputs and outputs.

Why Do We Care?

• Transfer function can be used to predict strength levels of the inputs to produce a functional system.

• Other potential Regulators:– Nonsense, missense and frameshift

regulators– riboregulators

Going Farther.

• Beijing iGEM 2009 - Used the and gate to create conditional memory in ecoli

• Biosensors - respond to changes in the environment.

• A stop growth switch in cells when certain nutrients are lacking