drivers of microbial community composition in mesophilic ......drivers of microbial community...
Post on 16-Mar-2020
4 Views
Preview:
TRANSCRIPT
ww.sciencedirect.com
wat e r r e s e a r c h x x x ( 2 0 1 3 ) 1e1 1
Available online at w
ScienceDirect
journal homepage: www.elsevier .com/locate/watres
Drivers of microbial community composition inmesophilic and thermophilic temperature-phasedanaerobic digestion pre-treatment reactors
Hasina M. Pervin a, Paul G. Dennis a,b, Hui J. Lim a, Gene W. Tyson a,b,Damien J. Batstone a, Philip L. Bond a,*aAdvanced Water Management Centre, The University of Queensland, Brisbane, Queensland 4072, AustraliabAustralian Centre for Ecogenomics, School of Chemistry and Molecular Biosciences, The University of Queensland,
Brisbane, Queensland 4072, Australia
a r t i c l e i n f o
Article history:
Received 8 April 2013
Received in revised form
2 July 2013
Accepted 4 July 2013
Available online xxx
Keywords:
Temperature-phased anaerobic
digestion
Molecular microbial ecology
Thermophilic pre-treatment
Hydrolysisefermentation
Abbreviations: AD, Anaerobic Digestion;Hydraulic Retention Time; MP, Mesophilic Pmorphism; TP, Thermophilic Pre-treatment;RFLP, Terminal Restriction Fragment Length* Corresponding author. Advanced Water Ma
Research Rd., St. Lucia, Queensland 4072, AuE-mail address: phil.bond@awmc.uq.edu
Please cite this article in press as: Pervinmophilic temperature-phased anaerobicj.watres.2013.07.053
0043-1354/$ e see front matter ª 2013 Elsevhttp://dx.doi.org/10.1016/j.watres.2013.07.053
a b s t r a c t
Temperature-phased anaerobic digestion (TPAD) is an emerging technology that facilitates
improved performance and pathogen destruction in anaerobic sewage sludge digestion by
optimising conditions for 1) hydrolytic and acidogenic organisms in a first-stage/pre-
treatment reactor and then 2) methogenic populations in a second stage reactor. Pre-
treatment reactors are typically operated at 55e65 �C and as such select for thermophilic
bacterial communities. However, details of key microbial populations in hydrolytic com-
munities and links to functionality are very limited. In this study, experimental thermophilic
pre-treatment (TP) andcontrolmesophilic pre-treatment (MP) reactorswereoperatedasfirst-
stages of TPAD systems treating activated sludge for 340 days. The TP system was operated
sequentially at 50, 60 and65 �C,while theMP rectorwasheld at 35 �C for the entireperiod. The
composition ofmicrobial communities associatedwith theMPandTPpre-treatment reactors
was characterised weekly using terminal-restriction fragment length polymorphism (T-
RFLP) supported by clone library sequencing of 16S rRNA gene amplicons. The outcomes of
this approachwere confirmedusing 454 pyrosequencing of gene amplicons andfluorescence
in-situ hybridisation (FISH). TP associated bacterial communities were dominated by pop-
ulations affiliated to the Firmicutes, Thermotogae, Proteobacteria and Chloroflexi. In particular
there was a progression from Thermotogae to Lutispora and Coprothermobacter and diversity
decreased as temperature and hydrolysis performance increased. While change in the
composition of TP associated bacterial communitieswas attributable to temperature, that of
MP associated bacterial communities was related to the composition of the incoming feed.
This study determined processes driving the dynamics of keymicrobial populations that are
correlated with an enhanced hydrolytic functionality of the TPAD system.
ª 2013 Elsevier Ltd. All rights reserved.
BLAST, Basic Local Alignment Search Tool; FISH, Fluorescent In situ Hybridization; HRT,re-treatment; OTU, Operational Taxonomic Unit; RFLP, Restriction Fragment Length Poly-TPAD, Temperature-Phased Anaerobic Digestion; T-RF, Terminal Restriction Fragment; T-Polymorphism.nagement Centre (AWMC), The University of Queensland, Level 6 Gehrmann Building (60),stralia. Tel.: þ61 (0)7 3446 3226; fax: þ61 (0)7 3365 4726.
.au (P.L. Bond).
, H.M., et al., Drivers of microbial community composition in mesophilic and ther-digestion pre-treatment reactors, Water Research (2013), http://dx.doi.org/10.1016/
ier Ltd. All rights reserved.
wat e r r e s e a r c h x x x ( 2 0 1 3 ) 1e1 12
1. Introduction
observed to be both stable (Weiss et al., 2008) and variableAnaerobic digestion (AD) is an economically and environ-
mental attractive microbially driven process that can be used
to generatemethane from biosolids. AD comprises hydrolysis,
fermentation, acetogenesis and methanogenesis (Weiland,
2010). Bacteria generally dominate the first three stages;
however, archaea drive methanogenesis and this latter stage
is generally well characterised (Amani et al., 2010). In com-
parison, detailed knowledge of the populations responsible for
hydrolysis and fermentation is lacking. Hydrolysis is a key
rateelimiting step as the products are rapidly consumed by
methanogens (Li and Noike, 1992; Rittmann, 2008). Greater
insight into the key microorganisms involved, their dynamics
and details of their activities can provide opportunities for
manipulation of populations and functions for enhancing
process performance, reactor efficiency and troubleshooting
management of AD.
Temperature-phased anaerobic digestion (TPAD) is an
emerging process, in which enhanced hydrolysis, facilitated
by a pre-treatment reactor operated at 50e70 �C, can be
combined with enhanced stability of the overall process (Paul
et al., 2012). A TPAD system may typically comprise of a
thermophilic pre-treatment reactor with a short (2e4 days)
hydraulic retention time (HRT) followed by the main reactor
operating at mesophilic temperatures with a 10e15 day HRT
(Ge et al., 2011). The functionality of the pre-treatment stage is
mainly associated with hydrolysis and acidogenesis, which
are mediated by bacteria. The second stage function is pri-
marily acetogenesis and methanogenesis, and this will
comprise a mix of bacteria and archaea. TPAD is particularly
applicable to AD of activated sludge, as it allows increased
performance regarding hydrolysis of organic solids and
methane production at a moderate energy input, as well as
full pathogen removal (Paul et al., 2012).
There have been limited molecular-based studies of mi-
crobial communities in AD systems. These studies largely
focus on the methanogenic communities (Kobayashi et al.,
2009) although those that include analyses of bacterial com-
munities reveal mostly novel phylotypes (Chouari et al., 2005).
For example, in a survey of publically available 16S rRNA gene
amplicon sequences associated with anaerobic digesters,
Nelson et al. (2011) found that ca. 60% of bacteria could not be
assigned to any established genus (Nelson et al., 2011). Mi-
crobial communities of seven mesophilic full scale digesters
have been examined and, bacteria of the Chloroflexi, Betapro-
teobacteria, Bacteridetes and Synergistetes were observed as core
groups (Riviere et al., 2009). However, details of the bacterial
populations within those phyla and the ecological role of
those are yet to be determined. The compositions of AD-
associated bacterial communities are seen to be influenced
by reactor parameters. For example, pH fluctuations have
been observed to correlate with changes in bacterial com-
munitieswithin a thermophilic AD over time (Hori et al., 2006),
and similarly, pH changes in a mesophilic multistage AD
system were implicated in bacterial community differences
between phases of the reactor (Supaphol et al., 2011). In AD
systems run with the same operational conditions over time,
however, the composition of bacterial communities has been
Please cite this article in press as: Pervin, H.M., et al., Drivers omophilic temperature-phased anaerobic digestion pre-treatmenj.watres.2013.07.053
(Fernandez et al., 1999; Pycke et al., 2011). A recent study
compared bacterial communities of seven full scale anaerobic
reactors having a temperature range of 35e52 �C (Lee et al.,
2012). It was found that temperature was a major factor
affectingmicrobial community compositions, and some of the
phylotypes could be weakly linked with some process per-
formance parameters (Lee et al., 2012). In a recent study of a
TPAD pre-treatment stage treating primary sludge, over 90%
of the sequences were from previously undetected bacteria
(Pervin et al., 2013). This study identified specific thermophilic
populations, but could not link performance to community
changes. Additionally, the treated waste was primary sludge,
and although feed communities were not determined, the
variable nature of the feed was implied to influence the pre-
treatment bacterial communities. It is evident that studies of
these bacterial communities are limited and knowledge of the
ecology and how that may be related to the system operation
is just beginning to develop. In particular, the pre-treatment
stage in a temperature-phased anaerobic process is
appealing from a microbial perspective, since it is novel in
temperature and performance, and studies comparing ther-
mophilic and mesophilic systems would be revealing.
Consequently, there are limitations with previous studies
with respect to determining hydrolytic communities, aswell as
with identification of dynamics of key microbial populations.
Additionally, insight is required as towhether functionality is a
general community characteristic, or whether it can be linked
to key populations. It is very difficult to address this fully, but
examination of TPAD operating at different temperatures, and
on a feed more consistent than primary sludge, such as acti-
vated sludge, offers the opportunity to associate microorgan-
isms with reactor performance. In this study we attempt to
address this gap through multiple molecular approaches
including high analytical frequency through T-RFLP, objective
identification through 16S rRNA gene clone-libraries and
pyrotag sequencing, as well as PCR-independent analysis
through fluorescence in-situ hybridisation. The overall objec-
tive was to identify community populations thatmay be linked
to increased temperature and performance.
2. Materials and methods
2.1. Reactor operation and performance
Two TPAD systems, each consisting of two stages: 1) a 0.6 L
pre-treatment reactor with a hydraulic retention time (HRT) of
two days and 2) a 4 L main reactor (methanogenic) with a 14
day HRT, were operated for 340 days. In one system, the pre-
treatment was performed under mesophilic conditions at
35 �C (MP), while the other was operated under thermophilic
conditions at 50 �C for 186 days, 60 �C for 100 days and 65 �C for
60 days (TP). In both systems the second-stage reactor was
operated at 35 �C. Details of the reactor operations are
described in Ge et al. (2011). The reactors were inoculated with
sludge from another lab-scale mesophilic TPAD system, this
provided a relevant and common starting point for both re-
actors. The TPADs were fed 0.3 L per day of activated sludge
f microbial community composition in mesophilic and ther-t reactors, Water Research (2013), http://dx.doi.org/10.1016/
wat e r r e s e a r c h x x x ( 2 0 1 3 ) 1e1 1 3
collected from a wastewater treatment plant in Gold Coast
city, Australia. The activated sludge feed was collected
monthly and stored at below 4 �C. The reactors were mixed
usingmagnetic stirrer bars. The performance of each reactor was
characterised by measuring quantities of total solids (TS),
volatile solids (VS), volatile fatty acid (VFA), chemical oxygen
demand (COD), total Kjeldahl nitrogen (TKN), ammo-
niumenitrogen (NH4þ �N) and methane gas as described in
Ge et al. (2011).
2.2. Characterisation of microbial communities
2.2.1. Sample collection and DNA extractionEffluent sludge samples were collected at regular intervals
from both pre-treatment reactors during the operation of the
TPAD systems (Figure S1), these samples were immediately
frozen at �20 �C for DNA extraction. Additional sludge sam-
ples were collected from the feed reservoir, which was
replenished daily with waste activated sludge (WAS), and are
denoted as ‘Feed’ in this study. Genomic DNA was extracted
using the Fast DNA SPIN Kit for soil according to the manu-
facturers instructions (Q-Bio gene, Australia).
2.2.2. Microbial community fingerprinting by T-RFLPBacterial community structure was assessed using terminal
restriction fragment length polymorphism fingerprinting (T-
RFLP; Supplementary information). Briefly, PCR was per-
formed using the 63F (50-AGTTTGATCCTGGCTCAG-30) and
1389R (50-ACGGGCGGTGTRC-30) primers (Marchesi et al., 1998)
followed by purification and restriction enzyme digestion in
duplicates usingMSPI andHaeIII (Fermentas Inc., Hanover,MD,
USA). Terminal restriction fragments (T-RFs) were analysed
using an automated DNA sequencer (ABI Prism TM 3730). T-RF
sizes and their corresponding areas were measured using
GeneMarker� (version 1.75; SoftGenetics, LLC., State College,
PA, USA). Data were standardised by expressing each T-RF
peak area as a percentage of the total population for that
profile and normalised using a constant percentage threshold
method as previously described (Sait et al., 2003).
The likely origin of T-RF peaks was identified by producing
in-silico profiles of cloned genes (see Section 2.2.3) using the T-
RFLPMAP software (NERC environmental bioinformatics
centre, UK). Although the T-RFs identities are putative, the
confidence of the suggested identifications was increased by
using two enzyme digestions and coinciding T-RFLP abun-
dance patterns of the two digestions during the reactor
operation (Figure S3). The TAP t-RFLP tool (Marsh et al., 2000)
of the Ribosomal Database Project was used to verify the
affiliation of peaks and to infer matches when those were not
available from the clone library database. Both the MSPI and
HaeIII digest results were used for identifications, and the T-
RFLP profiles of the different digestions were in good agree-
ment (Fig. S3). However, as MSPI generated the more detailed
T-RFLP profiles, further analysis and results presented in this
study are based on those.
2.2.3. 16S rRNA gene amplicon cloning and sequencingBacterial and archaeal 16S rRNA genes of the communities
were determined by PCR, cloning and sequencing at 100 days
operation for MP and TP, and also at 240 days operation for TP.
Please cite this article in press as: Pervin, H.M., et al., Drivers ofmophilic temperature-phased anaerobic digestion pre-treatmenj.watres.2013.07.053
Amplicons were generated by PCR, as described previously
(Bond et al., 1995), using the primer pairs 27F (50eTTTGATCCTGGCTCAGe30) and 1492R (50eGGTTACCTTGTACGACTTe30) forbacteria, and Arc8F (50eTCCGGTTGATCCTGCCe30) and
Arc927R (50e CCCGCCAATTCCTTTAAGTTTCe30) for archaea
(Singh et al., 2006). Clone librarieswere constructed based on a
total of 187 positive clones (Supplementary information). The
full length clone sequences were phylogenetically analysed
using representative bacterial sequences (ARB database,
greengenes.lbl.gov) and evolutionary distance analysis in
the ARB software package (Ludwig et al., 2004). The topology of
the phylogenetic tree was used to aid probe design (Section
2.2.5).
2.2.4. 16S rRNA gene amplicon pyrosequencingBacterial and archaeal 16S rRNA gene amplicons were exam-
ined by pyrosequencing from MP and TP reactor samples at
days 240 and 324, this was when TP was operated at 60 �C and
65 �C respectively. Gene amplicons were generated by PCR with
primers 926F and 1392R (Engelbrektson et al., 2010) that were
modified on the 50 end to contain the 454 FLX Titanium Lib L
adapters B and A, respectively. The reverse primers also
contained a 5-6 base barcode sequence positioned between
the primer sequence and the adapter. A unique barcode was
used for each sample. Following amplification (see Supple-
mentary Information) purified and normalised amplicons
were submitted to Macrogen (South Korea) for 454 pyrose-
quencing (Supplementary information). Sequence analysis
was performed as described previously (Dennis et al., 2013)
using QIIME (Caporaso et al., 2010) and UCHIME (Edgar et al.,
2011).
2.2.5. Fluorescence in situ hybridization (FISH)Probes for FISH for each of the three major OTUs in the clone
library were designed as previously described using ARB
(Hugenholtz et al., 2002), and then checked for specificity
using BLAST (http://www.ncbi.nlm.nih.gov/BLAST/) and
probeCheck (Loy et al., 2008). Probes were synthesised and
labelled at the 50 end with either Cy3, Cy5 or FITC (Gene-
Works, Australia). FISH was performed using previously re-
ported phylogenetic group specific probes and newly
designed species specific probes (Table S1) on reactor sam-
ples fixed in either 4% paraformaldehyde (Gram negatives) or
ethanol (Gram positives) according to established procedures
(Amann et al., 1995). To assess probe specificities FISH was
performed on fixed reactor samples with those probes at
different stringencies by increasing the formamide concen-
tration in the hybridization buffer in 5% intervals and
decreasing the NaCl concentration in the respective wash
buffers accordingly. The most stringent conditions that gave
the brightest signal with the presumed target cells were
considered as optimal for subsequent quantification. Micro-
bial cells hybridising to the fluorescently labelled probes were
observed with a Zeiss Axioplan LSM510 confocal laser-
scanning microscope (CLSM) using standard excitation and
emission wavelengths. FISH images were used for quanti-
fying the population of target microbe using the DAIME
version 1.3.1 software (Daims et al., 2006). The images were
optimised by adjusting the pixel level to reduce background
noise and to achieve a good contrast of the target organism
microbial community composition in mesophilic and ther-t reactors, Water Research (2013), http://dx.doi.org/10.1016/
Table 1 e Reactor performance parameters as determined by Ge et al. (2011).
Parameter 35 �Ca 50 �Cb 60 �Cb 65 �Cb
Hydrolysis speed khyd (d�1) 0.2 � 0.1 0.12 � 0.06 0.5 � 0.1 0.7 � 0.2
Hydrolysis extent fd 0.4 � 0.1 0.4 � 0.1 0.41 � 0.04 0.51 � 0.04
a Measured in MP system.b Measured in TP system.
wat e r r e s e a r c h x x x ( 2 0 1 3 ) 1e1 14
over the general population. At least 25 images were used to
obtain an accurate biovolume fraction of the target microbe.
All biovolume fractions obtained have a minimum congru-
ency level of 90% to ensure that the quantification values
obtained were reliable.
2.3. Statistical analyses
Turnover in the composition of T-RFs between samples was
visualised using Principle Component Analysis (PCA). Data
were Hellinger transformed prior to analysis. The effect of
treatment parameters on the composition of microbial com-
munities was determined using permutational multivariate
analysis of variance (PERMANOVA). Statistical analyses were
conducted using R statistical package (R Development Core
Team, 2004).
3. Results
3.1. Reactor operation and performance
A detailed report and comparison of the performance of the
TPADs is presented in Ge et al. (2011). Briefly, both TPAD sys-
tems successfully produced methane throughout the 340 day
operation and the thermophilic pre-treatment (TP) reactor
demonstrated significantly enhanced AD performance.
Increased volatile solids destruction, solubilisation and pro-
duction of volatile fatty acids was evident in the TP reactor in
Table 2 e Putative identification of the most abundant T-RFs iphylogenetic analysis of cloned sequences. TP 50, TP 60, TP 65microorganisms during the periods of the TP reactor operationreactor operation (at 35 �C throughout the experiment).
T-Rf length asper MspI (bp)
Putative identification determinedfrom clone sequence affiliation
56 Comamonas sp.
102 Uncultured Betaproteobacterium
103 Uncultured Gammaproteobacterium
112 Novosphingobium mathurense
236 Uncultured Thermotogae sp.
256 Coprothermobacter sp.a
271 Lutispora thermophila
450 Pseudomonas meridian
451 Zoogloea resiniphila
454 Thauera sp.
480 Clostridium cellulovorans
482 Uncultured Chloroflexi
489 Clostridium sp.
a Obtained from 100% matching fullelength representative sequence to
Please cite this article in press as: Pervin, H.M., et al., Drivers omophilic temperature-phased anaerobic digestion pre-treatmenj.watres.2013.07.053
comparison to the mesophilic pre-treatment (MP) reactor (Ge
et al., 2011). The solubilisation of organic solids during the
operationof theTP reactor increased from15%at50 �C to27%at
60 �C and 65 �C. In comparison, solubilisation of organic solids
in the MP reactor was only 7% (based on the chemical oxygen
demandbalance).Additionally, theammoniaenitrogen release
in the TP reactor was constantly higher than that in the MP
reactor (Ge et al., 2011). Model based analysis determined key
kinetic parameters related to the extent (fd) and speed (khyd) of
organic solid degradation (Table 1). Both the speed and amount
of hydrolysis increased with increasing temperature in the TP
reactor, but these parameters did not differ between the MP
reactor at 35 �C and the TP reactor at 50 �C.
3.2. Identification of key populations
Sequencing of 16S rRNA amplicons from the clone library
revealed a range of organisms that were associated with the
pre-treatment reactors (Table 2 and Fig. 1). These sequences
were subjected to in-silico restriction enzyme digests which
facilitated their association with peaks from the T-RFLP anal-
ysis (Fig. 2). The composition of microbial communities asso-
ciated with the MP and TP reactors differed significantly
(PERMANOVA, P < 0.001), with the TP reactor (50e65 �C) beingassociated with members of the Thermotogae, Lutispora and
Coprothermobacter (Fig. 3). The TP reactor communities were
dominated by these key populations, particularly at the higher
temperatures of 60 �C and 65 �C (Fig. 2). In comparison, the MP
reactor (35 �C) communities were not dominated by particular
n the pre-treatment reactors as determined from theand MP 35 indicate average abundance of particularat 50 �C, 60 �C, and 65 �C respectively, and during the MP
Average abundance (%) as per MSPI
TP 50 TP 60 TP 65 MP 35
0.28 0.02 0.06 1.06
1.40 5.79 2.60 2.21
3.58 1.65 2.33 5.21
3.67 1.63 1.35 4.20
12.18 28.58 3.77 0.73
0.15 3.92 10.45 0.35
3.94 17.23 21.46 0.68
5.15 2.64 3.42 2.14
0.41 3.33 2.02 3.67
4.37 1.85 1.81 6.58
3.30 0.33 0.81 1.79
4.91 1.91 2.79 2.01
0.00 0.03 0.02 3.57
respective pyrotag sequence analysis.
f microbial community composition in mesophilic and ther-t reactors, Water Research (2013), http://dx.doi.org/10.1016/
Fig. 1 eMicrobial community analysis of TP samples by FISH, T-RFLP, and 16S rRNA gene pyrotag sequencing, including; (A)
organisms identified by the THERMO846 probe as Thermotogae sp. at day 240 (60 �C) (magenta) against other bacteria in blue
(EUB338), (B) organisms identified by the LUTI1250 probe as Lutispora thermophile at day 294 (65 �C) (magenta) against other
bacteria in blue; (C)Methanosarcina thermophila as identified by the SARC1645 (orange) with other Archaea (ARC915) in green
and bacteria in blue; and (D) comparison of community analyses by pyrotag sequencing (Pyro 240, Pyro 325) and T-RFLP at
days 240 (60 �C) and 325 (65 �C). Abundant populations detected are highlighted by arrows. (For interpretation of the
references to colour in this figure legend, the reader is referred to the web version of this article.)
wat e r r e s e a r c h x x x ( 2 0 1 3 ) 1e1 1 5
bacterial populations, but were associated with representa-
tives ofGammaproteobacteria,Clostridium andZoogloea.Archaeal
populations related to the Methanosarcinaceae represented
approximately 10% of the total population in the TP reactor at
60 �C (Figure S4). This findingwas in agreementwith the results
of FISH analyses using the probe SARC1645 which specifically
targetsMethanosarcina thermophila (Fig. 1). Only low numbers of
archaea were detected by FISH (<1%) in the MP reactor.
3.3. The effect of temperature of bacterial communitycomposition
Within the TP reactor, 36% of variation in microbial commu-
nity composition was attributable to reactor temperature
(PERMANOVA, P < 0.001) with: 1) Thermotogae being more
abundant at 50 �C and 60 �C, 2) Lutispora thermophila being
more abundant at 60 �C and 65 �C, and 3) Coprothermobacter
Please cite this article in press as: Pervin, H.M., et al., Drivers ofmophilic temperature-phased anaerobic digestion pre-treatmenj.watres.2013.07.053
being more abundant at 65 �C (Fig. 3). To confirm these find-
ings two oligonucleotide FISH probes, THERMO846 and
LUTI1250, were designed to target Thermotogae and Lutispora
thermophila, respectively. Thermotogae populations and Lutis-
pora thermophila were detected by FISH at 13.3 � 4.7% and
3.8 � 1% of the bacteria in TP (60 �C) at day 240 (Fig. 1A and
Figure S5). At the highest temperature (65 �C, day 294) Lutispora
thermophila was more abundant at 8.4 � 2.8% and Thermotogae
sp. had decreased to 2.6 � 1.6% (Fig. 1B and Figure S5). These
trends were in agreement with the results obtained using T-
RFLP and pyrosequencing at 60 and 65 �C; however, the overall
values were slightly lower by FISH. This discrepancy may be
explained by the FISH probe not capturing the full diversity of
the populations detected by sequencing and T-RFLP. For
example, 43% of the clone sequences affiliated with Clostridia
did not completely match the LGC354 mix probes used for
detection of the Firmicutes.
microbial community composition in mesophilic and ther-t reactors, Water Research (2013), http://dx.doi.org/10.1016/
Fig. 2 e Abundance patterns of bacteria in (A) TP and (B) MP as revealed by T-RFLP with MspI enzyme; T-RFs having
abundance <5% of the total community were pooled into a group called ‘others’. Different T-RFs are indicated by the
colours and the taxonomic affiliation of those with a corresponding taxonomic affiliation from in-silico restriction enzyme
digests of 16S rRNA gene amplicon sequences (Table 2) is shown. The temperature in the thermophilic reactor was 50 �C on
days 35e186, 60 �C on days 187e287, and 65 �C on days 288e340. The temperature in the mesophilic reactor was 35 �Cthroughout the experiment. (For interpretation of the references to colour in this figure legend, the reader is referred to the
web version of this article.)
wat e r r e s e a r c h x x x ( 2 0 1 3 ) 1e1 16
3.4. Changes in bacterial community composition overtime
The largest changes in community composition in the TP
reactor were associated with changes in operating
Please cite this article in press as: Pervin, H.M., et al., Drivers omophilic temperature-phased anaerobic digestion pre-treatmenj.watres.2013.07.053
temperature (Figs. 2 and 3). However, approximately, 6% and
19% of variation in bacterial community composition was
attributable to changes that occurred over time within a
temperature level in the TP and MP pre-treatment reactors,
respectively (PERMANOVA, P < 0.05; Fig. 3). The changes that
f microbial community composition in mesophilic and ther-t reactors, Water Research (2013), http://dx.doi.org/10.1016/
Fig. 3 e PCA ordination representing variation in the composition of bacterial communities detected using T-RFLP
fingerprinting of 16S rRNA gene amplicons. Samples are represented by circles; the size of which represents the number of
weeks since the start of the experiment and the colour represents the temperature of the reactor at any given time. Samples
from the same reactor are joined by arrows that indicate the progression of time. The crosses represent T-RFs, of which the
most discriminating are labelled. T-RF labelled in bold font represent those with a corresponding taxonomic affiliation from
in-silico restriction enzyme digests of 16S rRNA gene amplicon sequences (Table 2). The red text highlights the time periods
of samples that are discussed in the main text. (For interpretation of the references to colour in this figure legend, the reader
is referred to the web version of this article.)
wat e r r e s e a r c h x x x ( 2 0 1 3 ) 1e1 1 7
occurred in the TP pre-treatment reactor during operation at
50 �C, 60 �C and 65 �C were related to populations that were
influenced by the temperature changes. For example, at 50 �Cthe community differed over time due to a gradual increase in
the abundance of the Thermotogae population (T-RF 236),
whereas at 65 �C the community differed over time due to the
same population gradually decreasing (Fig. 3).
Changes that occurred in the MP pre-treatment reactor,
however, appear to have been related to changes in the
composition of the microbial communities associated with
the feed (Fig. 3). Feed-associated microbial communities
differed significantly over time, with feed samples becoming
more enrichedwith three populations (T-RFs 396, 450 and 489)
as the experiment progressed. These populations included
Pseudomonas meridiana and a representative of the Clostridium
(PERMANOVA, P < 0.001; Fig. 4). The largest change in the
composition of the MP reactor associated bacteria community
was apparent after 208 days andwas related to an enrichment
of the P. meridiana and Clostridium populations (T-RFs 450 and
489) also observed to vary in the feed. Another obvious change
in the composition of the MP reactor associated bacteria
community was apparent after 255 days (Figs. 3 and 4). The
change was related to an enrichment of the P. meridiana pop-
ulation which was also more abundant in feed from days
250e280 relative to previous feed-stocks (Fig. 4). Feed com-
munity composition is further implicated as a driver of MP
Please cite this article in press as: Pervin, H.M., et al., Drivers ofmophilic temperature-phased anaerobic digestion pre-treatmenj.watres.2013.07.053
pre-treatment reactor associated microbial community
composition by a PERMANOVA analysis, which demonstrated
that the primary axis scores from the PCA of the feed associ-
atedmicrobial communities (Fig. 4) were significant predictors
of variation in the composition of the MP pre-treatment
reactor associated communities (P ¼ 0.016).
4. Discussion
4.1. Dynamic nature of microbial communities andcorrelation to reactor conditions
We were interested to detect differences in the communities
of the two pre-treatment reactors and correlate those to the
operating conditions and performance of the reactors. The
importance of temperature for methanogenic archaeal spe-
cies composition has been shown previously (Karakashev
et al., 2005), however, the influence of temperature driving
bacterial species composition is yet to be established in AD.
The communities in both TP and MP were dynamic as
revealed by T-RFLP, FISH and pyrosequencing. The thermo-
philic system was clearly dynamic in response to operating
temperature. The largest variations in the TP reactor bacterial
communities coincided with the changes in operation tem-
perature (Fig. 3). Consequently this study successfully
microbial community composition in mesophilic and ther-t reactors, Water Research (2013), http://dx.doi.org/10.1016/
Fig. 4 e PCA ordination representing variation in the composition of feed-associated bacterial communities. Samples are
represented by circles. The size of the circles is proportional to the number of weeks since the start of the experiment.
Arrows indicate the progression of time. The crosses represent T-RFs of which the most discriminating are labelled. T-RF
labelled in bold font represents those with a corresponding taxonomic affiliation from in-silico restriction enzyme digests of
16S rRNA gene amplicon sequences (Table 2). The first feed sample was characterised 100 days into the experiment after
that each new batch of feed was subjected to T-RFLP fingerprinting. The temperature in the thermophilic reactor was 50 �Con days 35e186, 60 �C on days 187e287, and 65 �C on days 288e340. The temperature in the mesophilic reactor was 35 �Cthroughout the experiment.
wat e r r e s e a r c h x x x ( 2 0 1 3 ) 1e1 18
correlated microbial community changes, particularly those
of the bacteria, to operating conditions of increased temper-
ature in anaerobic digestion.
The TP reactor communities were dominated by particular
bacteria at the different stages of temperature operation. This
is likely to be related to the different temperature optimums of
the bacteria. For example, at 65 �C Thermotogae sp. was out
competed in the TP reactor by Lutispora thermophila and other
thermophiles; possibly this temperature being above the or-
ganisms optimal range. Another possibility was the Thermo-
togae sp. abundance was not favoured by the high
concentrations of ammonium or organic acids, since the total
VFA concentration increased three fold when the temperature
increased from 60 to 65 �C in the TP reactor (Ge et al., 2011).
Thus, reactor conditions influenced the presence and domi-
nance of specific populations resulting in the community dy-
namics at various temperatures.
The Feed community was seen to significantly affect the
bacterial community structure in the MP reactor. Correla-
tion of variation of Feed communities with that in MP
reactor communities was evident by PCA ordination (Fig. 3).
Likely, contributing to the MP communities were: survival of
facultative anaerobic Feed populations due to the similar
temperature conditions of the MP reactor and WAS, changes
in the batches of Feed community composition and dead
Please cite this article in press as: Pervin, H.M., et al., Drivers omophilic temperature-phased anaerobic digestion pre-treatmenj.watres.2013.07.053
cell DNA from the Feed. Contributions of the Feed commu-
nities were not so evident in the TP reactor communities
and this could be explained by the selection pressure of
temperature in TP having a stronger influence on microbial
community composition in comparison with the feed
material.
Some variation in the TP reactor bacterial communities
were detected within periods of constant operating tempera-
ture. Variation in bacterial communities has been detected
during the stable operation of AD reactors (Fernandez et al.,
1999; Pycke et al., 2011). However, this variation in TP could
be attributed to adjustment of population abundance
following reactor temperature changes and consequential
performance changes, such as changing VFA levels, occurring
through the periods of constant temperature operation.
4.2. Microbial community composition and reactorperformance
The principal parameters for performance of anaerobic
digestion are stated in Section 3.1. However, it is important
that hydrolysis in TP at 50 �C was similar to that in MP, and
only increased once temperature increased to 60 �C, and the
key dominating populations shifted frommixed communities
and Thermotogae to Lutispora thermophila and Coprothermobacter
f microbial community composition in mesophilic and ther-t reactors, Water Research (2013), http://dx.doi.org/10.1016/
wat e r r e s e a r c h x x x ( 2 0 1 3 ) 1e1 1 9
as the temperature increased to 65 �C. This indicates that
while at 50 �C the community was strongly directed by tem-
perature (to Thermotogae), it was only once temperature
increased and caused a population shift particularly to Lutis-
pora thermophila and Coprothermobacter that performance in
terms of hydrolysis increased substantially. While the com-
munity changes could be related to increased hydrolysis,
these changes also coincided with other changes, including
increases in ammonia and organic acid concentrations (Ge
et al., 2011). It should be noted also that these increases in
digestion performance were related to increased protein hy-
drolysis, a particularly important feature for WAS digestion.
In the TP reactor methane production was significantly
higher than in the MP reactor. This coincided with the pres-
ence ofMethanosarcina thermophila which was abundant in TP.
In contrast, FISH (results not shown) and pyrosequencing
indicated that archaea were in very low abundance in MP.
4.3. Possible functions of key organisms in thepre-treatment reactors
We assume the abundant organisms in the pre-treatment
reactors were playing important roles in the AD perfor-
mance. While detection of particular 16S rRNA genes is not
proof of phenotype activity, it is possible to suggest potential
functions of the abundant microorganisms in the pre-
treatment reactors. Thermotogae has been previously detec-
ted in thermophilic anaerobic digesters (Chen et al., 2004;
Leven et al., 2007), and in mesophilic AD (Nesbo et al., 2006),
however, on this occasion they were not detected in the MP
reactor. Members of the Thermotogae are thermophilic anaer-
obes that excrete hydrolytic enzymes to catalyse a wide range
of polysaccharides to acetate, carbon dioxide and hydrogen as
the main fermentation products (Huber and Hanning, 2007).
Thermotogae are also implicated with interspecies hydrogen
transfer (Johnson et al., 2006), and the presence of Meth-
anosarcina thermophila, implicates a possible syntrophy
contributing to the methane production in TP.
Lutispora thermophila were originally isolated from an
anaerobic bioreactor operating at 55 �C (Shiratori et al., 2008),
and is a fermentater that strictly utilises amino acids for
growth. Coprothermobacter, like Lutispora are within the Clos-
trida subphylum of the Firmicutes. Also, similar to Lutispora,
Coprothermobacter are detected in thermophilic andmesophilic
anaerobicdigestionand theyhavepreference for fermentation
of protein and amino acids as opposed to carbohydrate
fermentation (Etchebehere et al., 1998). This function of these
organisms coincides with the abundance of these sequences
detected with the higher levels of NH4þ and VFA in the TP
reactor at higher temperatures. Additionally, it highlights the
importance of protein degradation and fermentation for the
performance of AD systems.Coprothermobacter also produceH2
and improved growth of these is detected in the presence of H2
utilising methanogens (Sasaki et al., 2011).
Methanosarcina thermophila, the primary archaeon in the TP
reactor, are detected in previous studies of thermophilic
anaerobic digestion systems (Kobayashi et al., 2008; Leven
et al., 2007). In general, Methanosarcina are thought respon-
sible for methane production in anaerobic digestion systems
when acetate concentrations are high (Jetten et al., 1990;
Please cite this article in press as: Pervin, H.M., et al., Drivers ofmophilic temperature-phased anaerobic digestion pre-treatmenj.watres.2013.07.053
McMahon et al., 2001). However, Methanosarcina thermophila
is capable of H2/CO2 conversion tomethane (Mladenovska and
Ahring, 2000), and consequently the nature of this methano-
genesis is of interest in terms of the metabolic pathway uti-
lised. Additionally, the growth rates of organisms in the TP
reactor (HRT of 2 days) would be faster than typically expected
for methanogens. However, high growth rates, such as a 12 h
doubling time on acetate, are reported for various Meth-
anosarcina spp. (Mladenovska and Ahring, 2000).
5. Conclusion
The mesophilic pre-treatment reactor bacterial communities
were heavily influenced by the feed, while the thermophilic
reactor was less diverse, and had dominant populations of
Thermotogae sp., Lutispora thermophila, and Coprothermobacter,
shifting progressively from the first to the last as temperature
was increased from 50 �C to 65 �C. Functionality was higher at
60 �C and 65 �C, when the process wasmore dominated by the
latter two organisms, indicating that while temperature can
direct community, there will be optimums related to the
emergence of key populations that we suggest are implicated
for the enhanced hydrolytic ability. A particularly important
outcome was the consistency in outputs from the multiple
methods applied, with key populations being quantified
consistently by FISH, T-RFLP (full 16S rRNA gene sequence)
and 454 pyrosequencing (partial 16S rRNA gene sequence).
Acknowledgements
We thank the Queensland Government and Environmental
Biotechnology Cooperative Research Centre (EBCRC),
Australia for supporting this work as a sub-project of “Small-
medium scale organic solids stabilization”. The authors
gratefully acknowledge the contributions of Dr. Frances
Slater, Dr. Huoqing Ge, and Dr. Paul Jensen.
Appendix A. Supplementary data
Supplementary data related to this article can be found at
http://dx.doi.org/10.1016/j.watres.2013.07.053.
r e f e r e n c e s
Amani, T., Nosrati, M., Sreekrishnan, T.R., 2010. Anaerobicdigestion from the viewpoint of microbiological, chemical,and operational aspects e a review. Environ. Rev. 18, 255e278.
Amann, R.I., Ludwig, W., Schleifer, K.H., 1995. Phylogeneticidentification and in-situ detection of individual microbial-cells without cultivation. Microbiol. Rev. 59 (1), 143e169.
Bond, P.L., Hugenholtz, P., Keller, J., Blackall, L.L., 1995. Bacterialcommunity structures of phosphate-removing and non-phosphate-removing activated sludges from sequencing batchreactors. Appl. Environ. Microbiol. 61 (5), 1910e1916.
Caporaso, J.G., Kuczynski, J., Stombaugh, J., Bittinger, K.,Bushman, F.D., Costello, E.K., Fierer, N., Pena, A.G.,Goodrich, J.K., Gordon, J.I., Huttley, G.A., Kelley, S.T.,
microbial community composition in mesophilic and ther-t reactors, Water Research (2013), http://dx.doi.org/10.1016/
wat e r r e s e a r c h x x x ( 2 0 1 3 ) 1e1 110
Knights, D., Koenig, J.E., Ley, R.E., Lozupone, C.A.,McDonald, D., Muegge, B.D., Pirrung, M., Reeder, J.,Sevinsky, J.R., Tumbaugh, P.J., Walters, W.A., Widmann, J.,Yatsunenko, T., Zaneveld, J., Knight, R., 2010. QIIME allowsanalysis of high-throughput community sequencing data. Nat.Methods 7 (5), 335e336.
Chen, C.L., Macarie, H., Ramirez, I., Olmos, A., Ong, S.L.,Monroy, O., Liu, W.T., 2004. Microbial community structure ina thermophilic anaerobic hybrid reactor degradingterephthalate. Microbiology-Sgm 150, 3429e3440.
Chouari, R., Le Paslier, D., Daegelen, P., Ginestet, P.,Weissenbach, J., Sghir, A., 2005. Novel predominant archaealand bacterial groups revealed by molecular analysis of ananaerobic sludge digester. Environ. Microbiol. 7 (8), 1104e1115.
Daims, H., Lucker, S., Wagner, M., 2006. daime, a novel imageanalysis program for microbial ecology and biofilm research.Environ. Microbiol. 8 (2), 200e213.
Dennis, P.G., Guo, K., Imelfort, M., Jensen, P., Tyson, G.W.,Rabaey, K., 2013. Spatial uniformity of microbial diversity in acontinuous bioelectrochemical system. Bioresour. Technol.129, 599e605.
Edgar, R.C., Haas, B.J., Clemente, J.C., Quince, C., Knight, R., 2011.UCHIME improves sensitivity and speed of chimera detection.Bioinformatics 27 (16), 2194e2200.
Engelbrektson, A., Kunin, V., Wrighton, K.C., Zvenigorodsky, N.,Chen, F., Ochman, H., Hugenholtz, P., 2010. Experimentalfactors affecting PCR-based estimates of microbial speciesrichness and evenness. ISME J. 4 (5), 642e647.
Etchebehere, C., Pavan, M.E., Zorzopulos, J., Soubes, M., Muxi, L.,1998. Coprothermobacter platensis sp. nov., a new anaerobicproteolytic thermophilic bacterium isolated from an anaerobicmesophilic sludge. Int. J. Syst. Bacteriol. 48, 1297e1304.
Fernandez, A., Huang, S.Y., Seston, S., Xing, J., Hickey, R.,Criddle, C., Tiedje, J., 1999. How stable is stable? Functionversus community composition. Appl. Environ. Microbiol. 65(8), 3697e3704.
Ge, H., Jensen, P.D., Batstone, D.J., 2011. Temperature phasedanaerobic digestion increases apparent hydrolysis rate forwaste activated sludge. Water Res. 45 (4), 1597e1606.
Hori, T., Haruta, S., Ueno, Y., Ishii, M., Igarashi, Y., 2006. Dynamictransition of a methanogenic population in response to theconcentration of volatile fatty acids in a thermophilicanaerobic digester. Appl. Environ. Microbiol. 72 (2), 1623e1630.
Huber, R., Hanning, M., 2007. The Prokaryotes. Springer NewYork, New York, NY, pp. 899e922.
Hugenholtz, P., Tyson, G.W., Blackall, L.L., 2002. Design andevaluation of 16S rRNA-targeted oligonucleotide probes forfluorescence in situ hybridization. Methods Mol. Biol. 179,29e42.
Jetten, M.S.M., Stams, A.J.M., Zehnder, A.J.B., 1990. Acetatethreshold values and acetate activating enzymes inmethanogenic bacteria. Fems Microbiol. Ecol. 73 (4), 339e344.
Johnson, M.R., Conners, S.B., Montero, C.I., Chou, C.J.,Shockley, K.R., Kelly, R.M., 2006. The Thermotoga maritimaphenotype is impacted by syntrophic interaction withMethanococcus jannaschii in hyperthermophilic coculture. Appl.Environ. Microbiol. 72 (1), 811e818.
Karakashev, D., Batstone, D.J., Angelidaki, I., 2005. Influence ofenvironmental conditions onmethanogenic compositions inanaerobic biogas reactors. Appl. Environ. Microbiol. 71 (1),331e338.
Kobayashi, T., Li, Y.Y., Harada, H., 2008. Analysis of microbialcommunity structure and diversity in the thermophilicanaerobic digestion of waste activated sludge. Water Sci.Technol. 57 (8), 1199e1205.
Kobayashi, T., Yasuda, D., Li, Y.-Y., Kubota, K., Harada, H., Yu, H.-Q., 2009. Characterization of start-up performance andarchaeal community shifts during anaerobic self-degradation
Please cite this article in press as: Pervin, H.M., et al., Drivers omophilic temperature-phased anaerobic digestion pre-treatmenj.watres.2013.07.053
of waste-activated sludge. Bioresour. Technol. 100 (21),4981e4988.
Lee, S.-H., Kang, H.-J., Lee, Y.H., Lee, T.J., Han, K., Choi, Y.,Park, H.-D., 2012. Monitoring bacterial community structureand variability in time scale in full-scale anaerobic digesters. J.Environ. Monit. 14 (7), 1893e1905.
Leven, L., Eriksson, A.R.B., Schnurer, A., 2007. Effect of processtemperature on bacterial and archaeal communities in twomethanogenic bioreactors treating organic household waste.Fems Microbiol. Ecol. 59 (3), 683e693.
Li, Y.Y., Noike, T., 1992. Upgrading of anaerobic-digestion ofwaste activated-sludge by thermal pretreatment. Water Sci.Technol. 26 (3e4), 857e866.
Loy, A., Arnold, R., Tischler, P., Rattei, T., Wagner, M., Horn, M.,2008. probeCheck e a central resource for evaluatingoligonucleotide probe coverage and specificity. Environ.Microbiol. 10 (10), 2894e2898.
Ludwig, W., Strunk, O., Westram, R., Richter, L., Meier, H.,Yadhukumar, Buchner A., Lai, T., Steppi, S., Jobb, G.,Forster, W., Brettske, I., Gerber, S., Ginhart, A.W., Gross, O.,Grumann, S., Hermann, S., Jost, R., Konig, A., Liss, T.,Lussmann, R., May, M., Nonhoff, B., Reichel, B., Strehlow, R.,Stamatakis, A., Stuckmann, N., Vilbig, A., Lenke, M., Ludwig, T.,Bode, A., Schleifer, K.H., 2004. ARB: a software environment forsequence data. Nucleic Acids Res. 32 (4), 1363e1371.
Marchesi, J.R., Sato, T., Weightman, A.J., Martin, T.A., Fry, J.C.,Hiom, S.J., Wade, W.G., 1998. Design and evaluation of usefulbacterium-specific PCR primers that amplify genes coding forbacterial 16S rRNA. Appl. Environ. Microbiol. 64 (2), 795e799.
Marsh, T.L., Saxman, P., Cole, J., Tiedje, J., 2000. Terminalrestriction fragment length polymorphism analysis program,a web-based research tool for microbial community analysis.Appl. Environ. Microbiol. 66 (8), 3616e3620.
McMahon, K.D., Stroot, P.G., Mackie, R.I., Raskin, L., 2001.Anaerobic codigestion of municipal solid waste and biosolidsunder various mixing conditions e II: microbial populationdynamics. Water Res. 35 (7), 1817e1827.
Mladenovska, Z., Ahring, B.K., 2000. Growth kinetics ofthermophilic Methanosarcina spp. isolated from full-scalebiogas plants treating animal manures. Fems Microbiol. Ecol.31 (3), 225e229.
Nelson, M.C., Morrison, M., Yu, Z.T., 2011. A meta-analysis of themicrobial diversity observed in anaerobic digesters. Bioresour.Technol. 102 (4), 3730e3739.
Nesbo, C.L., Dlutek, M., Zhwcybayeva, O., Doolittle, W.F., 2006.Evidence for existence of “mesotogas”, members of the orderthermotogales adapted to low-temperature environments.Appl. Environ. Microbiol. 72 (7), 5061e5068.
Paul, E., Carrere, H., Batstone, D.J., 2012. In: Paul, E., Liu, Y. (Eds.),Biological Sludge Minimization and Biomaterials/BioenergyRecovery Technologies. John Wiley & Sons, Inc., New Jersey,pp. 373e404.
Pervin, H.M., Batstone, D.J., Bond, P.L., 2013. Previouslyunclassified bacteria dominate during thermophilic andmesophilic anaerobic pre-treatment of primary sludge. Syst.Appl. Microbiol. 36 (4), 281e290.
Pycke, B.F.G., Etchebehere, C., Van de Caveye, P., Negroni, A.,Verstraete, W., Boon, N., 2011. A time-course analysis of fourfull-scale anaerobic digesters in relation to the dynamics ofchange of their microbial communities. Water Sci. Technol. 63(4), 769e775.
Rittmann, B.E., 2008. Opportunities for renewable bioenergy usingmicroorganisms. Biotechnol. Bioeng. 100 (2), 203e212.
Riviere, D., Desvignes, V., Pelletier, E., Chaussonnerie, S.,Guermazi, S., Weissenbach, J., Li, T., Camacho, P., Sghir, A.,2009. Towards the definition of a core of microorganismsinvolved in anaerobic digestion of sludge. ISME J. 3 (6),700e714.
f microbial community composition in mesophilic and ther-t reactors, Water Research (2013), http://dx.doi.org/10.1016/
wat e r r e s e a r c h x x x ( 2 0 1 3 ) 1e1 1 11
Sait, L., Galic, M., Strugnell, R.A., Janssen, P.H., 2003. Secretoryantibodies do not affect the composition of the bacterialmicrobiota in the terminal ileum of 10-week-old mice. Appl.Environ. Microbiol. 69 (4), 2100e2109.
Sasaki, K., Morita, M., Sasaki, D., Nagaoka, J., Matsumoto, N.,Ohmura, N., Shinozaki, H., 2011. Syntrophic degradation ofproteinaceous materials by the thermophilic strainsCoprothermobacter proteolyticus and Methanothermobacterthermautotrophicus. J. Biosci. Bioeng. 112 (5), 469e472.
Shiratori, H., Ohiwa, H., Ikeno, H., Ayame, S., Kataoka, N., Miya, A.,Beppu, T., Ueda, K., 2008. Lutispora thermophila gen. nov., spnov., a thermophilic, spore-forming bacterium isolated from athermophilic methanogenic bioreactor digesting municipalsolid wastes. Int. J. Syst. Evol. Microbiol. 58, 964e969.
Please cite this article in press as: Pervin, H.M., et al., Drivers ofmophilic temperature-phased anaerobic digestion pre-treatmenj.watres.2013.07.053
Singh, B.K., Nazaries, L., Munro, S., Anderson, I.C., Campbell, C.D.,2006. Use of multiplex terminal restriction fragment lengthpolymorphism for rapid and simultaneous analysis ofdifferent components of the soil microbial community. Appl.Environ. Microbiol. 72 (11), 7278e7285.
Supaphol, S., Jenkins, S.N., Intomo, P., Waite, I.S., O’Donnell, A.G.,2011. Microbial community dynamics in mesophilic anaerobicco-digestion of mixed waste. Bioresour. Technol. 102 (5),4021e4027.
Weiland, P., 2010. Biogas production: current state andperspectives. Appl. Microbiol. Biotechnol. 85 (4), 849e860.
Weiss, A., Jerome, V., Freitag, R., Mayer, H.K., 2008. Diversity ofthe resident microbiota in a thermophilic municipal biogasplant. Appl. Microbiol. Biotechnol. 81 (1), 163e173.
microbial community composition in mesophilic and ther-t reactors, Water Research (2013), http://dx.doi.org/10.1016/
top related