dna subway green line overview. growth of sequence read archive (sra) 2.2 quadrillion bases log...

DNA Subway

Green Line Overview

Growth of Sequence Read Archive (SRA)2.2 Quadrillion bases

Log

Scal

e!

http://www.ncbi.nlm.nih.gov/Traces/sra/

DNA SubwayGreen Line: Transcriptome analysis

Green Line

• Examine RNA-Seq data for differential expression or annotate sequenced genome

• Use high-performance computing to analyze complete datasets

• Generate lists of genes and fold-changes; add results to Red Line projects

• RNA Collected from multiple samples/time points

• Library prep and sequencing

• QC of Reads

• Assembly and mapping

• Abundance estimation

RNA-Seq OverviewGreen Line: Differential expression

Next Generation RNA-Sequencing for Undergraduates

2. Isolate RNA

1. Design experiment(Differential expression or genome annotation)

3. Sequence RNA 4. Analyze RNA sequence datasets using the Green Line of DNA Subway and other bioinformatics tools

5. Follow-up validations

Working Group Faculty Projects 2014

Agnes Ayme-Southgate College of Charleston, SC Gene expression changes in Apis melifera flight muscle during life-stage transitions

Judy Brusslan California State University, Long Beach, CA Gene expression changes during leaf development and senescence in Arabidopsis thaliana

Raymond Enke James Madison University, VA Gene expression changes during retina development in Gallus gallus

Shaye Lewis Prarie View A&M University, TX Gene expression in caprine testes during juvenile development to puberty

Irina Makarevitch Hamline University, MN Gene expression changes in maize in response to cold stress

Judith Ogilvie Saint Louis University, MO Gene expression changes in the retinas of mice with retinitis pigmentosa

Jeremy Seto New York City College of Technology – CUNY, NY Gene expression changes during differentiation of rat pheochromocytoma line cells (PC12) to a neuronal-like phenotype

Carrie Thurber Abraham Baldwin Agricultural College, IL Gene expression changes during seed abscission in Sorghum bicolor

George Ude Bowie State University, MD Transcriptome analysis of floral inflorescence genes in banana/plantains

Deirdre Vaden Prairie View A&M University, TX Gene expression changes in peripheral blood mononuclear cells from hypertensive rats treated with captopril

Scott Woody University of Wisconsin, WI Gene expression changes upon gibberellic acid exposure in Brassica rapa (Fast Plants, self-compatible) gibberellic acid (gad) mutants

RNA-Seq OverviewGreen Line: Differential expression and genome annotation

Biologically rich Biologically rich

Technical challenge(bottleneck)

Molecular techniques

Sequencing technologies

Expression plots

Validation experimentsImage from Advanced Sequencing Technologies & Applications http://meetings.cshl.edu/courses.html

RNA-Seq OverviewGreen Line: Technical challenges

1. Crowded field of choices

RNA-Seq OverviewGreen Line: Technical challenges

2. Bioinformatics skill level

@SRR070570.4 HWUSI-EAS455:3:1:1:1096 length=41CAAGGCCCGGGAACGAATTCACCGCCGTATGGCTGACCGGC+BA?39AAA933BA05>A@A=?4,9#################@SRR070570.12 HWUSI-EAS455:3:1:2:1592 length=41GAGGCGTTGACGGGAAAAGGGATATTAGCTCAGCTGAATCT+@=:9>5+.5=?@<6>A?@6+2?:</7>,%1/=0/7/>48##@SRR070570.13 HWUSI-EAS455:3:1:2:869 length=41TGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCA+

Bioinformatician

010011010 1

RNA-Seq OverviewGreen Line: Technical challenges

3. Data and computation

DNA SubwayGreen Line: Transcriptome analysis

• Tuxedo Workflow

• Simple layout

• HPC powered

• Integrated with iPlant Data Store

DNA SubwayGreen Line: Tuxedo Workflow

DNA SubwayGreen Line: HPC through iPlant Agave API

Base Cluster (Dell/Intel/Mellanox):• Intel Sandy Bridge processors• Dell dual-socket nodes w/32GB RAM (2GB/core)• 6,400 nodes• 56 Gb/s Mellanox FDR InfiniBand interconnect• More than 100,000 cores, 2.2 PF peak performance

Co-Processors: • Intel Xeon Phi “MIC” Many Integrated Core processors• Special release of “Knight’s Corner” (61 cores)• All MIC cards are on site at TACC

o more than 6000 installed• 7+ PF peak performance

Max Total Concurrency:exceeds 500,000 cores1.8M threads

Stampede

DNA SubwayGreen Line: iPlant Data Store

Initial 100 GB allocation – TB allocations available

Automatic data backup

Easy upload /download and sharing

DNA SubwayPublic Maize RNA-Seq Dataset

http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?study=SRP010680

DNA SubwayGreen Line: Differential expression

DNA SubwayGreen Line: Differential expression

DNA SubwayGreen Line: Differential expression

DNA SubwayGreen Line: Differential expression

DNA SubwayGreen Line: Differential expression

DNA SubwayGreen Line: Differential expression

DNA SubwayGreen Line: Differential expression

DNA SubwayGreen Line: Differential expression

DNA SubwayGreen Line: Differential expression

DNA SubwayGreen Line: Differential expression

DNA Subway“Power Desktop”

• Intuitive interface to support seamless genome “round trip” for eukaryote of choice• Access high performance computing to analyze whole genome data (RNA-

seq, initially)• Scaffold data to sequenced genomes available in iPlant Data Store• Directly upload RNA-seq reads as biological evidence for genome

annotation using Red Line

The iPlant Collaborative is funded by a grant from the National Science Foundation Plant Cyberinfrastructure Program (#DBI-0735191).