dna profiling used to be called dnafingerprinting, but this was confusing fingerprinting-1354231

DNA Profiling

Used to be called DNAfingerprinting, but this was

confusing

http://www.5min.com/Video/DNA-Genetic-Fingerprinting-1354231

(genetic fingerprinting, 2 min)

DNA profiling is the process where a specific DNA pattern, called a profile, is obtained from an

individual or tissue sample

?

Uses of DNA Profiling:

To identify the probable origin of a body fluid sample associated with a crime or crime scene.

Uses of DNA Profiling:

To reveal family relationshipse.g. checking on pedigree in stock breeding

programs.e.g. checking that captive populations of

endangered species are not inbred.

Uses of DNA Profiling:

To identify disaster victims. For example, ESR scientists traveled to Thailand to help identify victims of the Boxing Day tsunami

Uses of DNA Profiling:

Genetic screening: the presence of a particular gene, such as cystic fibrosis) in a family.

Polymorphisms (differences)Most of our DNA is identical to other people’s

DNA

Alleles usually differ by only a base or two

Non-coding regions vary greatly between people

Differences called polymorphisms.

Unique combination of polymorphisms Unique DNA profile

Short Tandem Repeats (STRs)

Eg CATGATCATGGATCATGCATGCATGCATGCATGCATGT

TCCATGATA

Found at specific loci Number of repeats varies greatlyHomologous chromosomes have different

numbers of repeats.

Profile is unique

DNA profile - ten specific STRs

No two people (except identical twins) are likely to have the same numbers of repeats in all of these STRs.

Microsatellite containing 4 repeat units

Homologous pair of chromosomes

Microsatellite containing 7 repeat units

Flanking regions to which PCR primers can be attached

centromerestelomeres

1 Get a sample

DNA found in most cells (eg white blood cells, semen, hair roots) and body fluids, such as saliva and perspiration.

Forensic scientists and police officers collect samples of DNA from crime scenes.

Mouth swab collects inner cheek cells.

2. Extract the DNA

DNA is contained within the nucleus of cells. Chemicals are added to break open the cells, extract the DNA, and isolate it from other cell components.

Magnify the DNA

PCR used to magnify the DNA sample for profiling.

Specific primers are used during PCR, which attach a fluorescent tag to the copied STRs.

4. Determine the size of the STRs

Gel electrophoresis separates the STRs and can detect the fluorescent dye on each

STR.

More repeats Larger STRs

Useful links for DNA profiling

DNA profiling at ESRESR is a Crown Research Institute and is New Zealand’s leading organization working in forensic science.

www.esr.cri.nz/competencies/forensicscience/dna/Pages/currenttechniques.aspx

Forensic success storiesNew Zealand examples of DNA profiling helping to solve real crimes.

www.esr.cri.nz/competencies/forensicscience/Pages/ForensicSuccessStories.aspx

DNA profiling to test for parentageA presentation on DNA profiling made by a New Zealand High school teacher. Please click on ‘DNA profiling’ to access.

www.sbs.auckland.ac.nz/uoa/science/about/departments/sbs/student_information/....cfm

DNA profiling interactiveA student-friendly interactive demonstration developed by Biotechnology Online Australia. Try using DNA profiling to investigate a crime or work out who is entitled to inheritance.

www.biotechnologyonline.gov.au/biotechnologyonline/popups/int_dnaprofiling.html

Human identification made simpleA student-friendly description of DNA profiling and how it is used in a variety of international court cases. Go to ‘human identification’ to access.

www.dnai.org/d/index.html

http://www.5min.com/Video/Restriction-Fragment-Length-Polymorphisms-Genetic-Markers-151426148

(Wolfe, genetic markers, 11 min)

http://www.5min.com/Video/Genetic-Screening-151018455 (Wolfe, screening, 11 min)