dna: history and structure. a brief history of dna (deoxyribonucleic acid): –discovery of dna by...
Post on 15-Dec-2015
219 Views
Preview:
TRANSCRIPT
A Brief History of DNA (deoxyribonucleic acid):
– Discovery of DNA by many different scientists– 1928 – Griffith – studied how bacteria made
people sick; found that a gene could change harmless bacteria into disease-causing ones
– 1944 – scientists led by Avery – DNA is a nucleic acid that stores and transmits the genetic information from one generation of an organism to the next
– 1952 – Hershey & Chase – studied viruses that killed bacteria; viruses have DNA too
Structure of DNA
• Three important jobs of DNA:– Carry information from one generation to the
next– Put information to work by determining the
heritable characteristics of organisms– Has to be easily copied
Structure of DNA (continued)
• DNA is a long molecule made up of units called nucleotides and has two strands/sides
• Each nucleotide is made up of three basic parts– A 5-carbon sugar (deoxyribose)– A phosphate– A nitrogenous (nitrogen-containing) base
• 4 bases found in DNA– Adenine and Guanine (both purines)– Cytosine and Thymine (both pyrimidines)
• Backbone of DNA formed by sugar and phosphate groups
• Four nucleotides can be strung together in many different ways to carry coded genetic information
Structure of DNA
Hydrogen bonds
Nucleotide
Sugar-phosphate backbone
Key
Adenine (A)
Thymine (T)
Cytosine (C)
Guanine (G)
Chargoff’s Rule – “Base-Pairing”
– Adenine (A) can ONLY bond with one Thymine (T)
– Cytosine (C) can ONLY bond with one Guanine (G)
“Base-Pairing” Tool
• Here’s an excellent tool to help you remember which nucleotides bond together and why:
A = T
G = C
Using the Base-Pairing Rule
• Because of the structure of DNA, the Base-Pairing Rule, and the “tool” from the previous slide, if given ONE side of DNA, you can give the “other side.”
• Ex: What is the “other side,” or complimentary strand, to this strand of DNA:– GGGGTTCGAAATTTCGCGAAT
CCCCAAGCTTTAAAGCGCTTA
top related