darwin & natural selection · evolution evolution: the process of change over time; one species...

Darwin & Natural Selection

Adapted from Mr. Gray & Bristol University

Hypothesis: is an educated guess, based on observations . It's a prediction of cause and effect.

Theory:

Summarizes a hypothesis/hypotheses

Supported with repeated testing

Valid as long as there is no evidence to dispute it

Explains how and why something happens

Example: Theory of Plate Tectonics

Law:

Generalizes a LOT of observations

Tells you what IS going to happen

Example: Law of Gravitation

Basic Scientific Terms Review

Directions Manager: read ?’s

1. Can a theory become a law?

Explain.

2. What’s wrong with this statement

– I have a theory that students

get more write ups after the

holidays.

Evolution

Evolution: The process of change over

time; one species gives rise to another &

“tree” grows!

All living things share a common ancestor.

We can draw a “family” tree of life to show

how every species is related.

Learning Manager – read ?

Besides cell phones, what other

non-biological items have

evolved?

Charles Darwin

Father of Evolution

Proposed the theory of evolution, change over time

Made observations on a 5-year trip around the world on the ship the HMS Beagle

Wrote a book “Origin of the Species” that documented his observations

Survival of the Fittest idea came from this book

Darwin’s Finches

Check out their feet!!!

On Task Manager – read ?

Charles Darwin noticed all the

different looks of the same species.

How might different looks affect

whether a species goes extinct?

Natural Selection

Natural Selection: Organisms that are best

adapted to an environment survive and

reproduce more than others

How Natural Selection Occurs – 4 Ways

Overproduction

Variation

Competition

Selection

Overproduction

Each species produces more offspring that can

survive

Each individual has a unique combination of inherited traits (DNA)

Adaptation: an inherited trait that increases an organism’s chances of survival

Environments can changewhich can change the success of an adaptation Same Parents

Variation

Adaptation Categories

Camouflage (Blend in and hide)

Mimicry (Act and look like)

Physiological (Poison)

Behavioral (Group behavior)

Remember the organism doesn’t CHOOSE the

adaptation! They are born with it or the

environment is more supporting of it!

Coral Snake

(Poisonous)Milk Snake

(Not

poisonous)

Stick Mantid

Flower Mantid

What adaptations do

you see?

What adaptations do

you see?

Variation

The more variation within a species, the more likely they are to survive

The more variation of types of species in a habitat, the more likely at least some will survive

Which community has a better chance of

surviving a natural disaster?

Community A Community B

Competition

Individuals COMPETE for food, water, space, etc.

Survival of the Fittest – the fittest is most able to

survive and reproduce

Not all individuals survive to adulthood

Best adaptations will survive and be able to pass on

their traits to their kids

Genotype: your genes/DNA

Ex: Cat’s ear shape

Phenotype: your physical appearance that is

influenced by your genes and the environment

The color of the flamingo is based on what they eat

(environment)

Selection

Materials Manager – read ? ‘s

What are the 4 “methods” of natural

selection?

Which “method” in your opinion

affects humans most?

How It Works

Individuals with traits that are not well suited to their environment either die or leave few offspring.

Evolution occurs when good traits build up in a population over many generations and bad traits are eliminated by the death of the individuals.

50 Million Years Ago

Today

Directions Manager – read ?

Summarize how giraffes evolved.

Peppered Moth

Which moth will the bird catch?

A

B

Evidence for Evolution:

Fossil Record

Homologous Body Structures

Vestigial Organs

Embryology

Biochemical Evidence

Fossils provide a record of the history of life on

Earth

Fossil Record

Progression of Organisms

dinosaurs humansbacteriaorigins

http://en.wikipedia.org/wiki/Geologic_time_scale

en.wikipedia.org/wiki/Image:Eopraptor_sketch5.png© World Health Org.

© NASA

complex cells

The fossil record shows a sequence from simple bacteria to

more complex organisms through time and provides the most

compelling evidence for evolution.

Transitional Fossils – Ex.

Archaeopteryx

Missing link between

reptiles and birds

Geologic Separation

Homologous Body Structures

Body parts that are

similar in different

species

Related organisms have

similar body structures

Humans and Gorillas Bone Structure

“Leftover” organs (traces of

evolution) that serve no

purpose currently (did in the

past)

Examples appendix,

tonsils, tailbone, wisdom

teeth

Vestigial Organs

Embryos of all vertebrates are very similar early

on – yes you had gills!

Embryology

The Pharyngeal Pouches will shape parts of the

pharynx and upper bronchial segments

DNA with more similar

sequences suggest species

are more closely related

Humans and chimpanzees

share > 98% of identical

DNA sequences

Biochemistry

HUMAN CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA

CHIMPANZEE CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGA

GORILLA CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA

Genetic code of chimps and gorillas is almost identical to humans

Directions Manager – read ?

What are the 5 types of evidence

used for evolution?

What is your opinion about evolution?

Thinking outside

biology/species – how might

the quote above affect you in

everyday/real life?

Supporting Resources

https://www.youtube.com/watch?v=0SCjhI86grU

Must Watch—Fantastic Review

https://www.youtube.com/watch?v=FW-uW71-DHU

Simpson Evolution