cell stem cell, volume 1 3 supplemental information tet1 ... · 1 cell stem cell, volume 1 3...
Post on 27-May-2018
213 Views
Preview:
TRANSCRIPT
1
Cell Stem Cell, volume 13 Supplemental Information Tet1 Regulates Adult Hippocampal Neurogenesis and Cognition Run-Rui Zhang, Qing-Yan Cui, Kiyohito Murai, Yen Ching Lim, Zachary D. Smith Shengnan Jin, Peng Ye, Luis Rosa, Yew Kok Lee, Hai-Ping Wu, Wei Liu, Zhi-Mei Xu, Lu Yang Yu-Qiang Ding, Fuchou Tang Alexander Meissner, Chunming Ding, Yanhong Shi, and Guo-Liang Xu
Supplemental Figures and Legends
Figure S1. Tet1 Expression in Neural Progenitors and the Effect of Its Acute
Ablation on Neurosphere Growth, Related to Figure 2
2
(A) Tet1 mRNA levels in ESC, adult NPCs and indicated tissues were determined by
quantitative PCR (qPCR) analysis. Data are normalized to Gapdh (Error bars are
presented as mean ± s.e.m.).
(B) Neurosphere immunostaining confirm the protein expression of Tet1 in WT, but
not in KO neural progenitors. Two different antibodies specific for the N- and
C-terminal protein were used. Scale bar, 100 μm.
(C) Neurospheres were infected with control (empty-IRES-GFP) and Cre
(Cre-IRES-GFP) lentiviruses for 7 days. Tet1f/f NPCs were isolated from the adult DG.
Scale bar, 100 μm.
(D) Average diameter of infected GFP-positive neurospheres (n = 3 cases, two-tailed
t-test: *P < 0.05, error bars are presented as mean ± s.e.m.).
3
Figure S2. Normal Dentate Gyrus Formation and Neuronal Proliferation in
Young Neural Tissue Specific Knockout Mice, Related to Figure 3
(A) Normal dentate gyrus formation in early development (P0) and young adult mice
(P60). Tet1 f/-; Nestin-Cre mice were compared with Tet1 f/+; Nestin-Cre.
(B) TUNEL assay of SGZ coronal brain sections of Tet1 f/+; Nestin-Cre and Tet1 f/-;
Nestin-Cre mice. No apoptosis was observed in 2-month-old NCKO mice. Scale bar, 200
μm. Mouse E12.5 trigeminal ganglion coronal sections were used as positive control.
Scale bar, 15 μm.
4
(C) – (F) Immunostaining and quantification of BrdU-positive cells in the SGZ of Ctrl
(Tet1 f/+; Nestin-Cre) and NCKO (Tet1 f/-; Nestin-Cre) hippocampi at P14 (C and D) and P30
(E and F). Scale bar, 100 μm. In the quantification, n = 3 pairs of mice, two-tailed
t-test, and P > 0.05, error bars are presented as mean ± s.e.m.
5
Figure S3. Reduced Neural Progenitor Proliferation and Impaired Neurogenesis
in Adult Tet1 Deficient Mice, Related to Figure 3
6
(A) – (D) Immunostaining and quantification of proliferating cells (A and B) and
newborn neurons (C and D) in the SGZ at 4 months in Ctrl (Tet1f/+; Nestin-Cre) and Tet1
NCKO (Tet1f/-; Nestin-Cre ) dentate gyrus. (n = 4 pairs of mice, two-tailed t-test: *P <
0.05, **P < 0.01, error bars are presented as mean ± s.e.m.. All scale bars of whole
images are 100 μm and the upper-left panels are enlarged images of the arrow-pointed
cells with a scale bar of 10 μm).
(E) and (F) Lentiviral knockdown of Tet1 expression reduced neural progenitor cell
proliferation in the hippocampal dentate gyrus of adult mouse brains. (E) Lentiviral
transduction of Tet1 shRNA (shTet1) reduced BrdU labeling in the dentate gyrus of
mouse brains. Wild-type mouse brains were injected with scrambled control (SC) or
shTet1-expressing lentiviruses. Both SC and shTet1-expression vectors harbor a GFP
reporter. BrdU staining was performed to label dividing cells and was shown in red
and nuclei DAPI staining was shown in blue. Scale bar, 50µm for top panels. The
bottom panels are enlarged images of the arrow-pointed cells with a scale bar of 12.5
µm. (F) Quantification of the GFP-positive and BrdU-positive (GFP+BrdU+) cells
among the GFP+ cells in the dentate gyrus of viral-transduced mouse brains. Data are
represented as mean ± standard deviation. ***P=0.000418 by Student’s t-test. n = 10
for scrambled control RNA-transduced mice and n = 7 for shTet1-transduced mice.
7
Figure S4. Proliferation of Tet1-null NPCs in Vitro Was Partially Rescued by
Galanin Supplementation, Related to Figure 4
(A) Growth of Tet1-null neurospheres in medium with or without the supplementation
of 5 nM Galanin 2–11. Galanin 2-11 is a Galanin receptor agonist and can stimulate
NPCs proliferation (Abbosh et al., 2011). Adult NPCs for neurosphere assay were
sorted from Tet1+/+; Nestin-GFP (WT) and Tet1-/-; Nestin-GFP (KO) mice. Scale bars, 100 μm.
(B) and (C) Quantification of the number and diameter of primary neurospheres in
normal and rescue media (n = 3 cases, two-tailed t-test: *P < 0.05, error bars are
presented as mean ± s.e.m.).
(D) and (E) Quantification of the number and diameter of secondary neurospheres in
normal and rescue media (n = 3 cases, two-tailed t-test: *P < 0.05, **P < 0.01, error
bars are presented as mean ± s.e.m.).
8
Table S1. List of Genes with Both Differential Promoter Methylation (RRBS) and
Differential Expression (RNA-seq), Related to Figure 4. A promoter was considered
as differentially methylated if the absolute methylation level difference was ≥ 20%
between KO and WT. A significant expression change was defined as 1) expression
ratio between KO and WT was either ≥ 2 or ≤0.5; and 2) P < 0.01 (Fisher exact test
adjusted by the Benjamini-Hochberg method).
Supplemental Experimental Procedures
Generation of Tet1 Knockout Mice
A targeting vector for Tet1 was prepared using the recombineering technique (Liu et
al., 2003) and electroporated into 129Sv ES cells for selection of targeted clones. The
floxed region contains exons 10-13, which code for the most part (421 amino acids
from VEYEE to YNRWV, GenBank accession number NP_001240786) of the
catalytic domain (Figure 1A). Positive clones were further characterized by Southern
blotting to confirm homologous recombination on the left side of the targeted
genomic region (Figure 1B). Embryonic stem cells carrying a correctly targeted allele
were injected into blastocysts to generate germline chimaeras. Mice with a floxed
allele were obtained by breeding with C57BL/6J mice. Mice with a floxed Tet1 allele
were crossed with EIIa-Cre mice, Nestin-Cre or Nestin-CreERT2 mice for generating
whole-body knockout (KO) or nervous system knockout lines respectively.
Whole-body KO line was used for initial phenotype analysis. Tet1 KO mice with
Nestin-GFP transgenic background and nervous system-specific knockout strains
were used for analysis of neurogenesis. Male mice on a mixed 129Sv&C57BL/6J
9
background were used in all experiments. Primers for genotyping PCR are as follows
(5'-3'):
• Tet1C CAGTAGTATTTTGCCTGCCTGCAT
• Tet1F CATCCTAAATAACCCAACCACCAA
• Tet1R TTCCCTAAGGAGTTTACTGCAACG
Morris Water Maze
The Morris water maze was conducted as described (Vorhees and Williams, 2006). A
white plastic tank 120 cm in diameter was filled with 22°C water, which was made
opaque with white non-toxic plastic beads. A transparent platform 10 cm in diameter
was located in the center of one of the four virtually divided quadrants during training
and was submerged 0.5 cm below the surface of opaque water. Mice were handled
daily for 1 week before swim training. The swim training was consisted of 1day of
pre-training, 1 day of visible platform version and 5 days hidden platform version. For
pre-training, mice were released in the corner and were allowed to stay in the hidden
platform for 30 sec once they found it. For visible platform version, the tank was
rounded by curtains. Platform location was indicated by a multicolor rod, which was
24 cm above the water and was attached to the platform. Mice were trained with
visible platform for four trials per day with an inter-trial interval of about 30 min.
Each trial started with a random point away from the visible platform and lasted either
until the mouse had found the platform or for a maximum of 60 sec. Afterwards, mice
were allowed to stay on or were put onto the platform for 30 sec. Hidden platform
trainings were conducted 1 day after the visible version in the same pool within the
same room. Distal cues, such as air-conditioner and painted cardboard on the white
wall, were provided as spatial references. The platform was submerged 0.5 cm below
10
the opaque water in a new fixed position without any visible local cues. Training
procedures were identical to that of the visible platform. Memory was examined by
using a probe trial that was administered 24 hrs (short-term probe) or 3 weeks
(long-term probe) after the last training. During the probe trial, mice were allowed to
swim 60 sec without the platform in the tank. We used a video tracking system
(Ethovision; Noldus Information Techonology) to record and analyze the swimming
path, velocity and time taken to reach the platform (latency) or in each zone. We
compared the single time-points’ data by Student t-test and also analyzed the serial
days’ data as dependent values by two-way ANOVA.
Isolation of Nestin-GFP Positive Cells
Dentate gyrus was dissected from Nestin-GFP transgenic adult mice in Hibernate
A/B27 medium (Invitrogen), then digested in 0.25% papain (Worthington) at 37 °C
for 30 min. After quenching the digestion, the material was triturated with a
fire-polished Pasteur pipette. Dissociated cells were suspended in Neurobasal A/B27.
Cell sorting and analyses were performed using a FACSVantage flow cytometer/cell
sorter equipped with CELL Quest software (Becton-Dickinson). Cells were analyzed
for forward scatter, side scatter and GFP fluorescence with an argon laser (488 nm,
100 mW). Dead cells were excluded by gating on forward and side scatter. Viable
cells from the transgenic mice were sorted into Neurobasal A/B27 medium for further
experiments.
Neurosphere Assay
Neurosphere cultures were prepared as described (Brewer and Torricelli, 2007).
Briefly, Nestin-GFP positive cells sorted from adult dentate gyrus were plated 20,000
11
cells per well of 24-well plate. The cultures were maintained in NeurobasalA/B27
medium (Invitrogen) containing growth factors (20 ng/ml bFGF and 20 ng/ml EGF).
After 7-day culture, neurospheres were dissociated by TrypLE™ (Invitrogen) and
suspensions were diluted to 20,000 cells per well in fresh medium for secondary
neurosphere formation. The number and diameter of neurosphere were measured by
using the Microcomputer Imaging Device Program.
For differentiation, neurospheres were dissociated to single cells and plated onto
glass substrate coated with 100 μg/ml poly-D-Lys (Sigma) at 50,000 cells per P24
well in NeuroCult Differentiation Medium (Stem Cell). After 7-day culture, cells
were used for immunostaining.
Immunohistochemistry and Antibodies
For neurosphere immunostaning, neurospheres were settled by gravity and fixed by 4%
PFA. Then they were cryoprotected in 30% sucrose overnight and 10- μm thick
sections were prepared. Immunostaining was conducted with rabbit antibodies
specific for the N- and C-terminal Tet1 protein. For neurosphere differentiation assay,
primary antibodies to Tuj1 (Mouse, 1:1000, Covance), GFAP (Mouse, 1:500, Cell
Signaling), O4 (Mouse, 1:200, Millipore) were used. Secondary antibodies used were
Alexa Fluor 488 or 546 conjugated, goat anti-rabbit, goat anti-mouse or donkey
anti-goat antibodies.
For brain immunostaining, wild-type and mutant mice were transcardially
perfused with 4% PFA. Brains collected were cryoprotected in 30% sucrose for 24 hrs,
and sectioned in the coronal plane on a cryostat (Leica) at 40 μm. For BrdU staining,
sections were treated in 2 M HCl at 37°C for 15 min before blocking. Antibody
incubation was carried out overnight at 4°C. Primary antibodies to BrdU (Mouse,
12
1:500, Millipore; Rat, 1:200, Abcam), Ki67 (Rabbit, 1:500, Abcam), Tbr2 (Rabbit,
1:200, Abcam), GFAP (Mouse, 1:500, Cell Signaling), Nestin (Goat, 1:50, Santa),
Dcx (Rabbit, 1:2000, Abcam), NeuN (Mouse, 1:100, Millipore) and GFP (Rabbit,
1:500, Invitrogen) were used. The following day, sections were incubated with
secondary antibodies. Secondary antibodies used were Alexa Fluor 488 or 546
conjugated, goat anti-rabbit, goat anti-mouse or donkey anti-goat antibodies. Sections
were examined using a Olympus fluorescent microscope or a Leica confocal system.
For quantification, 10-12 sections (every 5th section of slides from each animal)
including the DG area were selected. The entire dentate gyri were scanned using a
confocal microscope. Z series stacks of confocal images were obtained. The number
of single or double stained cells were counted using the Image Pro Plus software.
Two-tailed t-test was used in statistics.
Lentiviral Infection and Acute Ablation of Tet1 in Tet1 flox/flox NPCs
Control (UbiC-empty-IRES-EGFP) or Cre-expressing (UbiC-Cre-IRES-EGFP)
FUIGW lentiviral construct was co-transfected with two other helper vectors (PAX2
and SVGV) into HEK-293T cells. Packaged lentiviral particles were harvested at 48h
and 72h post transfection. Harvested lentiviral particles were then combined and
concentrated using ultracentrifugation (Beckman L-100K rotor, 20,000 rpm for 120
min). Adult Tet1 flox/flox NPCs were transduced with concentrated lentiviruses in the
presence of 4 μg/ml polybrene (Sigma) by centrifugation (300 g for 90 min) and
analyzed 7 days after infection.
13
BrdU Labeling for Young Postnatal Mice
P14 and P30 mice were injected BrdU every two hours for 3 times and perfused 2
hours later. Then brain sections were processed for immunostaining.
Nissl Staining
It was performed by using 0.25% Cresyl violet on 30-μm frozen sections.
TUNEL Assay
Cell apoptosis in SGZ was examined using a Terminal deoxynucleotidyl transferase-
mediated dUTP nick end labeling (TUNEL) kit (Roche).
Viral Production and Intracranial Lentiviral Infection
The scrambled control and Tet1 shRNA 3387-expressing lentiviruses were produced
using 293T cells as described (Shi et al., 2004); For intracranial lentiviral infection,
0.5 µl of concentrated lentiviruses was injected into the hippocampal dentate gyrus of
6-8-week-old wild type ICR mice by stereotaxic injection as described (Qu et al.,
2010). Two weeks after viral injection, the transduced mice were injected with BrdU
for 7 days and preceded for perfusion and subsequent BrdU (Sigma) labeling. The
coordinates for the dentate gyrus of wild type mice were anterior-posterior-2.5 mm,
mediolateral (ML) ±2.6 mm, and dorsoventral (DV) -2.8 and -3.3 mm from the skull
surface.
Reduced Representation Bisulfite Sequencing (RRBS)
Adult NPCs were sorted from dentate gyrus of Nestin-GFP transgenic mice.
Genomic DNA was prepared by using Qiagen DNeasy Blood &Tissue Kit. The
14
RRBS library construction and sequencing referred to previous methods(Meissner et
al., 2005). Briefly, genomic DNA was fragmented by sequential restriction digestion
with MspI and TaqI according to manufacturer’s instructions (New England Biolabs).
The digested product was purified with the QIAquick PCR Purification Kit (Qiagen).
End-repair and adaptor ligation were performed using the ChIP-Seq Sample
Preparation Kit (Illumina). Illumina’s RRBS for Methylation Analysis protocol was
followed. The purified fragments were then bisulfite-treated using the EZ DNA
Methylation-Gold Kit (Zymo Research), according to manufacturer’s instructions.
The converted DNA was amplified with 1x reaction buffer, additional 1.5 mM of
MgCl2, 300 µM of dNTP mix, 500 nM each of PCR primer PE 1.0 and 2.0, and 2.5 U
of HotStar Taq DNA polymerase. The thermocycling condition was 15 min at 94 °C
for heat activation, and 8-12 cycles of 20 sec at 94 °C, 30 sec at 65 °C and 30 sec at
72 °C, followed by a 5-min final extension at 72 °C. The enriched fragments were
purified by gel electrophoresis and quantified by Agilent 2100 Bioanalyzer (Agilent
Technologies). Sequencing was performed on the Illumina Genome Analyzer IIx
platform, as per manufacturer’s instructions.
A promoter was defined as -1000 to 500-bp relative to a transcription start site.
The methylation level of a promoter was determined by calculating the average
methylation level for CpGs with ≥10 sequencing depth. A promoter was considered as
differentially methylated if the absolute methylation level difference between WT and
KO was ≥20%.
RNA-Seq Analysis
Total RNA was purified from sorted nestin-GFP positive progenitor cells of adult DG
by using the Qiagen RNeasy Micro Kit. cDNA synthesis and amplification was
15
performed according to the protocol of RNA-Seq analysis of a single cells (Tang et al.,
2010). In brief, about 1-2 ng of RNA was added to 4 µl of lysis buffer and reverse
translated into cDNA. After free primer removal, 3’ polyA tailing and second strand
synthesis, the cDNA was amplified using the UP1 primer for 18 cycles. Then the
amplified products were purified, and the purified products were separated on a 2%
agarose gel, fragments excised from the size range of 0.5-8 kb. The gel-purified
products were amplified for 10 cycles with AUP1 and AUP2 primers. The second
round amplification products were purified and products within the size range from
0.5 to 5 kb isolated. Then the final purified products (about 1 μg) were fragmented by
Covaris S2 sonicator (Covaris) and purified with QIAquick PCR purification kit.
About 100 ng of the products were converted to sequencing libraries with the TruSeq
DNA Sample Prep Kit (Illumina). The libraries were pair-end sequenced by
IlluminaHiseq 2000 instrument.
Expression levels for the genes were reported as RPKM (Reads Per Kilobase of
exon model per Million mapped reads). Only genes with RPKM ≥ 0.5 in at least one
of the samples were used in the analysis. For genes with RPKM less than 0.5, their
RPKM value was set to 0.5. A gene was considered differentially expressed if 1)
Fisher exact test with a Benjamini-Hochberg corrected p-value of less than 0.01 and 2)
ratio between WT and KO ≤ 0.5 or ≥ 2.
RNA Isolation and Quantitative RT-PCR
Total RNA was purified from sorted nestin-GFP positive progenitor cells of adult DG
by using the Qiagen RNeasy Microprep Kit, treated with DNAase and
reverse-transcribed into the first-strand cDNA by One Step SYBR PrimeScript
RT-PCR Kit (Takara). Real-time PCR was performed in Bio-Rad CFX96 using
16
SYBR Premix Ex Taq (Takara). PCR efficiency and specificity of each primer pair
was examined by standard curve of serially diluted cDNA and melting curve
functionality respectively. Fold change was calculated based on 2-∆∆Ctmethod after
normalization to the transcript level of housekeeping gene Gapdh. Gene specific
primers used for quantitative RT-PCR are as follows (5'-3'):
• Atp5h Atp5h-qRT-F GCTGGGCGTAAACTTGCTCTA
Atp5h-qRT-R CAGACAGACTAGCCAACCTGG
• Galanin Galanin-qRT-F GGCAGCGTTATCCTGCTAGG
Galanin-qRT-R CTGTTCAGGGTCCAACCTCT
• Gapdh Gapdh-qRT-F GCCAGCCTCGTCCCGTAGACA
Gapdh-qRT-R CAACAATCTCCACTTTGCCACTGC
• Ng2 Ng2-qRT-F GGGCTGTGCTGTCTGTTGA
Ng2-qRT-R TGATTCCCTTCAGGTAAGGCA
• Ngb Ngb-qRT-F CCGGAGTCAGAGCTGATCC
Ngb-qRT-R GCGGCCATTGTACTGGAAGA
• Kctd14 Kctd14-qRT-F CAAAGGTCATCTATGGAGCCAG
Kctd14-qRT-R GAGAAGCCCAAAGTAGGTGCC
• Tet1 Tet1-RT-d CATTCTCACAAGGACATTCACAACA
Tet1-RT-e AGTAAAACGTAGTCGCCTCTTCCTG
• Trpm3 Trpm3-qRT-F CCGTGGGGGACCGTTTATTTT
Trpm3-qRT-R CAATTTAGGGGTCGAGAAGCAT
17
Gene-specific Bisulfite Sequencing
We carried out bisulfite conversion of 100 ng of genomic DNA purified from adult
NPCs using EZ DNA methylation-Gold Kit according to manufacturer’s instructions.
Hot-start PCR was used to amplify the region of interest from the bisulfite converted
genomic DNA. The PCR products were purified (Qiagen) and sub-cloned into the
pMD19-T vector (Takara). 10 clones were randomly selected and sequenced.
Genomic sequences were retrieved from the Ensemble. All the bisulfite genomic
sequencing primers were designed using the MethPrimer program. Gene-specific
PCR primers for bisulfite sequencing are as follows (5'-3'):
• Galanin Galanin-BS-R2F GTAGTTTTTATTGGGTATAAATA
Galanin-BS-R2R AAAAACAAAACTATAAAAAATACA
• Ng2 Ng2-BS-F TTTGGGGGTTTAAAGATTTAAG
Ng2-BS-R CCAAAATAAAAACCAAAACCA
• Ngb Ngb-BS-F TTTTTTGGGTTGGATTAGTAAAG
Ngb-BS-R ATCAATAACAAACCAAACAATCTC
Tet-Assisted Bisulfite Sequencing (TAB-seq)
200 ng of genomic DNA purified from adult NPCs were treated as described (Yu et
al., 2012). Gene specific PCR primers for TAB-seq were the same as those for
bisulfite sequencing PCR.
Rescue Experiment
Tet1-null single neural progenitor cell suspensions were cultured in the presence of 5
nM Galanin 2-11 (GL Biochem) for 7 days to form neurospheres. The number and
18
diameter of both primary and secondary neurospheres were compared among cell
samples of WT, Tet1 KO and Tet1 KO treated with Galanin 2-11.
Supplemental Reference
Abbosh, C., Lawkowski, A., Zaben, M., and Gray, W. (2011). GalR2/3 mediates
proliferative and trophic effects of galanin on postnatal hippocampal precursors. J
Neurochem 117, 425-436.
Brewer, G.J., and Torricelli, J.R. (2007). Isolation and culture of adult neurons and
neurospheres. Nature protocols 2, 1490-1498.
Liu, P., Jenkins, N.A., and Copeland, N.G. (2003). A highly efficient
recombineering-based method for generating conditional knockout mutations.
Genome research 13, 476-484.
Meissner, A., Gnirke, A., Bell, G.W., Ramsahoye, B., Lander, E.S., and Jaenisch, R.
(2005). Reduced representation bisulfite sequencing for comparative high-resolution
DNA methylation analysis. Nucleic Acids Res 33, 5868-5877.
Qu, Q., Sun, G., Li, W., Yang, S., Ye, P., Zhao, C., Yu, R.T., Gage, F.H., Evans,
R.M., and Shi, Y. (2010). Orphan nuclear receptor TLX activates Wnt/beta-catenin
signalling to stimulate neural stem cell proliferation and self-renewal. Nat Cell Biol
12, 31-40; sup pp 31-39.
Shi, Y., Chichung Lie, D., Taupin, P., Nakashima, K., Ray, J., Yu, R.T., Gage, F.H.,
and Evans, R.M. (2004). Expression and function of orphan nuclear receptor TLX in
adult neural stem cells. Nature 427, 78-83.
19
Tang, F., Barbacioru, C., Nordman, E., Li, B., Xu, N., Bashkirov, V.I., Lao, K., and
Surani, M.A. (2010). RNA-Seq analysis to capture the transcriptome landscape of a
single cell. Nat Protoc 5, 516-535.
Vorhees, C.V., and Williams, M.T. (2006). Morris water maze: procedures for
assessing spatial and related forms of learning and memory. Nat Protoc 1, 848-858.
Yu, M., Hon, G.C., Szulwach, K.E., Song, C.X., Jin, P., Ren, B., and He, C. (2012).
Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine. Nat Protoc 7,
2159-2170.
top related