beyond cloning: 101 uses of synthetic, high-fidelity, double-stranded dna
Post on 10-May-2015
1.150 Views
Preview:
DESCRIPTION
TRANSCRIPT
Integrated DNA Technologies
Beyond Cloning: 101 Uses of Synthetic, High-Fidelity, Double-Stranded DNA
Adam Clore, PhD
gBlocks® Gene Fragments Product Information
Double-stranded, linear, synthetic DNA fragments
200 ng DNA provided, dry Typically shipped within 2–4 business days Affordable for basic research needs
Designed and tested with the Gibson Assembly® method
Suitable for all purposes that require dsDNA
Gene Assembly
• Leverages IDT proprietary Ultramer® synthesis technology
Assembly Selection
• Process removes gene assemblies with deletions and/or substitutions
Sequence Confirmation
• Each gBlocks fragment is confirmed by three independent methods
Ship Preparation
• gBlocks fragements are amplified, normalized, packaged, and shipped
Making gBlocks® Gene Fragments
Assembled using IDT Ultramer® Oligonucleotides Correctly assembled sequences are enriched using a proprietary,
cloning-independent method Each gBlocks Gene Fragment is verified The result is high-fidelity, double-stranded DNA that is routinely
cloned to yield >80% correct colonies
3 Ways We Make Sure Your gBlocks are Correct
Capillary Electrophoresis
Mass Spectrometry
Sanger Sequencing
Cloning of gBlocks® Gene Fragments
0%
20%
40%
60%
80%
100%
120%% WT/Full Coverage
125bp 300bp 500bp 750bp Length of gBlocks Fragment
The Evolution of gBlocks® Gene Fragments — Cheaper, Faster, Better
Jan 2012 •500 bp •4–7 day TAT•$99
Oct 2013•750 bp for $149•3–4 day TAT
Nov 2013• Mass Spec QC added
•2–4 day TAT•$89/$129
Dec 2013 •gBlocks Libraries
Feb 2014 •1 kb gBlocks fragments
gBlocks® Gene Fragments Libraries
Pools of gBlocks Gene Fragments with 1–18 N or K mixed bases Mixed bases need to be consecutive Mixed bases need to be 125 bp from either end Length of gBlocks libraries is between 251 and 500 bp
Top 4 Questions:- Can you make more complex libraries?
Other mixed bases than N or K Multiple variable regions Variable regions within the first and last
125 bp of the gBlocks Specific codon substitutions (AlaΔSer)
………- Why only 18 Ns?- Are your libraries biased?- Can I get a discount?
Libraries @idtdna.com
At least 125 bp At least 125 bp1–18 bases
NNNNN….NNNNNOr
NNKNN….NKNNK
How are gBlocks® Libraries Made and QCed?
How are they made? This is proprietary, but the process is based on our capability for making very
high quality oligos and gBlocks Gene Fragments.
How are they QCed? The constant regions are gBlocks Gene Fragments and are QCed by size
verification, capillary electrophoresis, and mass spec for sequence verification.
We rely on a validated process (by NGS) to ensure that >80% of DNA species are present in the final 200 ng of material shipped.
Sequence Fidelity in the Constant Regions
6 NNK
Looking for the error rates at each position in the constant region of the gene fragments
5 NNK
Base Distribution in Variable Region
1 NNK
2 NNK
3 NNK
4 NNK
5 NNK
6 NNK
115 bp 115 bp• Built 6 gene fragments
with 1–6 NNK codons• Sequence-verified each
by NGS: MySeq®, 250 bp reads, forward and reversePosition 1 2 3
Base mix N N KA 2502744 2400917 2286C 2183361 2088264 3160G 2124224 2315143 4180965T 2761775 2767780 5385693
Count of reads by position
Position 1 2 3Base mix N N K
A 26% 25% 0.02%C 23% 22% 0.03%G 22% 24% 44%T 29% 29% 56%
Percentage of each base by position
Base Distribution in Variable Region
6 NNK
Examples of Orders/Applications
• Binding site engineering• Catalytic site analysis• Antibody engineering• Vaccine development• DNA binding analysis• Promoter optimization
• Systematic codon replacement
• Introducing multiple variable regions
NNK(1-18)
NNM(1-18)
NNK
NNK(1-9)
NNM(1-9)
NNK(1-9)
NNM(1-9)
Libraries@idtdna.com
Pricing and Delivery Time
# of Ns Diversity NNKs Diversity Price USD0 1 0 1 89.00$ 1 4 4 239.00$ 2 16 16 239.00$ 3 64 1 32 314.00$ 4 256 128 389.00$ 5 1,024 512 464.00$ 6 4,096 2 1,024 539.00$ 7 16,384 4,096 614.00$ 8 65,536 16,384 689.00$ 9 262,144 3 32,768 764.00$
10 1,048,576 131,072 839.00$ 11 4,194,304 524,288 914.00$ 12 16,777,216 4 1,048,576 989.00$ 13 67,108,864 4,194,304 1,064.00$ 14 268,435,456 16,777,216 1,139.00$ 15 1,073,741,824 5 33,554,432 1,214.00$ 16 4,294,967,296 134,217,728 1,289.00$ 17 17,179,869,184 536,870,912 1,364.00$ 18 68,719,476,736 6 1,073,741,824 1,439.00$
TAT: 10–15 Business Days
>1 billion sequence variants for = $1,439
Mixed Base
Remember the Carlson Curve?
Compares the cost of reading DNA to the cost of writing DNA
1.0E-09 IDT
• You get up to 418 combinations in a tube = about 68 billion gene fragments
• For $1,439• That is $0.000 000 021 per gene
fragment • Or 0.000 000 0042 ¢/base (for a
500 bp library)
Biosecurity
IDT is one of the five founding members of the International Gene Synthesis Consortium (IGSC)
Screens the sequence of every gene/gBlocks Gene Fragment order
To ensure safety and regulatory conformance
IDT reserves the right to refuse any order that does not pass this analysis
For more information about the IGSC and the Harmonized Screening Protocol, please visit the website at http://www.genesynthesisconsortium.org/Home.html.
In October of 2010, the United States government issued final Screening Framework Guidance for Providers of Synthetic Double-Stranded DNA, describing how commercial providers of synthetic genes should perform gene sequence and customer screening. IDT and the other IGSC member companies supported the adoption of the Screening Framework Guidance, and IDT follows that Guidance in its application of the Harmonized Screening Protocol. For more information, please see 75 FR 62820 (Oct. 13, 2010), or http://federalregister.gov/a/2010-25728.
How are Researchers Using gBlocks® Gene Fragments?
Genome Modification
qPCR and SNP Detection Controls
New Technologies
Gene Construction and Modification
How are Researchers Using gBlocks® Gene Fragments?
Genome Modification
qPCR and SNP detection controls
New Technologies
Gene Construction and Modification
3 Ways to Assemble GenesUltramer® Oligos gBlocks® Gene Fragments Custom Gene Synthesis
Product Description Single-stranded custom oligo
Double-stranded linear fragment
Double-stranded product delivered in a vector/BAC
Delivery Amount 200 pmol 200 ng >4μg
Length 45–120 bases 125–750 bp 25 – 2M bp
Turnaround Time 2–3 business days 2–4 business days Variable
Quality Control Mass Spec Sanger Sequencing Sanger Sequencing (or NGS for long constructs)
Estimated Purity 50–80% 85–90% 100%
Minimum Order Size 288 oligos 1 fragment 1 gene
Sequence Fidelity
Cost
Delivery time
$ $$$
Gene Construction Case Study #1:An alternative to site-directed mutagenesis
gBlocks® Gene Fragments
Direct cloning & mutagenesis
gBlocks® Gene Fragments used as an alternative to site-directed mutagenesis to introduce 18 mutations spread over the 1039 nt exon 7 of the gene JARID2 in order to verify that C-rich consensus sites with a central invariant CA dinucleotide are important for the in splicing of large exons >1000 nt.
Gene Construction Case Study #2: Immune Response After Flu Vaccination
DECODED 2.4 (October 2012):Using gBlocks® Gene Fragments to Generate Antibody Variable RegionsFrancois Vigneault, PhDChurch Lab at Harvard University now Abvitro, Inc
Each domain (VL, VH, CL, CH) is≈ 100 aa or ≈ 400 nt
So each domain = 1 gBlocks fragment
Identifying Rare Antibodies
1. Patient vaccination2. Identification and quantification of all
mRNAs by NGS (multiple data points)— thousands of antibody sequences
3. Select the very few VL and VH domains that are highly expressed
4. Build the potentially best antibodies by combining a small selection of VL
domains and gBlocks Gene Fragments coding for the VH domains
5. Selection of the strongest binding antibodies by phage display and surface plasmon resonance (Georgiou lab at University of Texas, Austin)
6. Verify when the best antibodies are produced using NGS data
Making Gene Synthesis More AffordableAssume 1200 bp gene; what is the price differential for 8 genes with one variable region? Assume $0.35/bp
3’ 1 5’
3’ 2 5’
3’ 3 5’
3’ 4 5’
3’ 5 5’
3’ 6 5’
3’ 7 5’
3’ 8 5’
gBlocks® Gene Fragments
10 gBlocks fragments = ~$890
1
2
3
4
5
6
7
8
Genes
8 Genes = $3,360
Assembling Multiple gBlocks® With the Gibson Assembly® Method
Gibson Assembly™ Master Mix
• gBlocks Gene Fragments with 20–30 bp overlaps designed by the researcher or by specialists at IDT
• gBlocks Gene Fragments and
vector are assembled using the Gibson Assembly® Method
• Construct is transformed and screened for the correct sequence
Gibson Assembly® MethodHow Isothermal Assembly of gBlocks® Gene Fragments WorksStep 1: gBlocks Gene Fragments are designed with 30 bp overlaps on the 3’ strand for use in the reaction with the following steps.
Step 2: A mesophilic exonuclease briefly cleaves bases from the 5’ end of the double-stranded DNA fragments, before being inactivated by the 50°C reaction temperature.
Step 3: The newly generated, complementary, single-stranded 3’ ends anneal.
Step 4: A high fidelity DNA polymerase fills in any single-stranded gaps.
Step 5: Finally, a thermophilic DNA ligase covalently joins DNA segments.
How are Researchers Using gBlocks® Gene Fragments?
Genome Modification
qPCR and SNP Detection Controls
New Technologies
Gene Construction and Modification
How are Researchers Using gBlocks® Gene Fragments?
Genome Modification
qPCR and SNP Detection Controls
New Technologies
Gene Construction and Modification
CRISPR — Easy Genome Modification
Clustered Regularly Interspaced Short Palindromic Repeat A prokaryotic defense mechanism that screens for and cleaves specific DNA
sequences Can be used to create targeted changes to the genomes of bacteria, archaea,
and eukaryotes
The 3 Stages of CRISPR Resistance
● Stage 1: CRISPR Adaptation– Foreign DNA is incorporated in the CRISPR
array.
● Stage 2: CRISPR Expression– CRISPR RNAs (crRNAs) are transcribed from
CRISPR locus.
● Stage 3: CRISPR Interference– Foreign nucleic acid complementary to the
crRNA is neutralized.
Utilizing CRISPR for Genome Modification
We need 3 components: 1. CRISPR Associated Gene 9 (CAS9) 2. RNA with CRISPR repeats (crRNA)3. Trans-acting RNA (tracrRNA)
* 2 and 3 can be combined into a single sequence called a single guide RNA (sgRNA)
Zhang lab: http://www.genome-engineering.org
CRISPR-Cas9 System in Mammals
gBlocks® Gene Fragments for CRISPR
gBlocks® Gene Fragments for CRISPR
Genome Editing Case Study #1:CRISPR Mediated Deletions
Non Homologus End Joining (NHEJ)Error prone
Leads to indels and rearrangements
Gene Fragments Used in CRISPR Research
4 gBlocks for Cas9 codon optimization
• gBlocks U6-gRNA• gBlocks T7-gRNA for IVT
Genome Engineering Case Study #2:CAS9 as a Homing device
Multiple, tuned, gene activation with nuclease-dead CAS9/gene promoter fusion proteins
Promoter gene and sgRNA were gBlocks fragments
2013 Citations of CRISPR/Cas Genome Editing with gBlocks®
First author Affiliation JournalChen UCSF CellMalina McGill Genes Dev.Mali Harvard Med School (Church lab) ScienceMali Harvard Med School (Church lab) Nature BiotechFriedland Harvard Med School (Church lab) Nature MethodsPerez-Pinera Duke Nature MethodsDickinson Univ. North Carolina Nature MethodsGilbert UCSF CellCheng Whitehead/MIT Cell ResearchWaaijers Univ. Utrecht GeneticsGratz Univ. Wisconsin GeneticsBassett Oxford Biology Open
How are Researchers Using gBlocks® Gene Fragments?
Genome Modification
qPCR and SNP Detection Controls
New Technologies
Gene Construction and Modification
How are Researchers Using gBlocks® Gene Fragments?
Genome Modification
qPCR and SNP Detection ControlsNew Technologies
Gene Construction and Modification
Synthetic Template Case Study #1:gBlocks® Gene Fragments as DNA Standards
Zymo ResearchDecoded 3.3 (July 2013)
• gBlocks Gene Fragments as truly un-methylated DNA standards
• PrimeTime® qPCR Assays for multiplex analysis
Synthetic Template Case Study #2: gBlocks® Gene Fragment as Synthetic Template in Multiplex PCR
ACVR2B-LIMK1-ACVR1B-CDK7 wtTCATACCTGCATGAGGATGTGCCCTGGTGCCGTGGCGAGGGCCACAAGCCGTCTATTGCCCACAGGGACTTTAAAAGTAAGAATGTATTGCTGAAGAGCGACCTCACAGCCGTGCTGGCTGACTTTGGCTTGGGAACATCATCCACCGAGACCTCAACTCCCACAACTGCCTGGTCCGCGAGAACAAGAATGTGGTGGTGGCTGACTTCGGGCTGGCGCGTCTCATGGTGGACGAGAAGACTGTATGTGATCAGAAGCTGCGTCCCAACATCCCCAACTGGTGGCAGAGTTATGAGGCACTGCGGGTGATGGGGAAGATGATGCGAGAGTGTTGGTATGGATGTATGGTGTAGGTGTGGACATGTGGGCTGTTGGCTGTATATTAGCAGAGTTACTTCTAAGGGTTCCTTTTTTGCCAGGAGATTCAGACCTTGATCAGCTAACAgcggccgc
• Equimolar ratios of the four samples are always perfect
A single DNA source for 4 different standard curves.
gBlocks® Gene Fragments as Quadruplex Standards
2.00E+06 2.00E+04 2.00E+020.0
5.0
10.0
15.0
20.0
25.0
30.0
35.0
40.0
gBlocks Fragments as Standards
Hs LIMK1
Hs CDK7
Hs ACVR1B
Hs ACVR2B
Copies
Cq
Va
lue
s
Fourplex Reaction Conditions
Reagent Final Conc.10X buffer 1X100 mM dNTPs 800 nM50 mM MgCl2 3 mM25 µM Forward Primer 1 500 nM25 µM Reverse Primer 1 500 nM12.5 µM Probe 250 nM25 µM Forward Primer 2 500 nM25 µM Reverse Primer 2 500 nM12.5 µM Probe 250 nM25 µM Forward Primer 3 500 nM25 µM Reverse Primer 3 500 nM12.5 µM Probe 250 nM25 µM Forward Primer 4 500 nM25 µM Reverse Primer 4 500 nM12.5 µM Probe 250 nMImmolase polymerase 0.8 UH2O ----Template
Synthetic Template Case Study #3:Using gBlocks® Gene Fragments As Modified Standards
While both template sequences contain the primers and probe binding sites, by altering the length of one, the modified amplicon can be distinguished from the endogenous one.
Hs.PT.51.4056836 LIMK1Hs LIMK1 ForwardGAACATCATCCACCGAGACCHs LIMK1 ReverseAGTCTTCTCGTCCACCATGAHS LIMK1 ProbeCCAGCCCGAAGTCAGCCACC
Hs LIMK1 endogenous amplicon sequenceGAACATCATCCACCGAGACCTCAACTCCCACAACTGCCTGGTCCGCGAGAACAAGAATGTGGTGGTGGCTGACTTCGGGCTGGCGCGTCTCATGGTGGACGAGAAGACT
Hs LIMK1 –10GAACATCATCCACCGAGACCTCAACTCCCACAACTGCCTAACAAGAATGTGGTGGTGGCTGACTTCGGGCTGGCGCGTCTCATGGTGGACGAGAAGACT
SYBR® Green Dye Dissociation Curve
By deleting or adding bases, a unique standard can be used that is distinguishable from the endogenous sequence.
If you have trouble with contamination, you will always be able to distinguish the standard from the endogenous amplicon.
gBlocks fragment (–10 bases)
gBlocks fragment (endogenous )
How are Researchers Using gBlocks® Gene Fragments?
Genome Modification
qPCR and SNP Detection Controls
New Technologies
Gene Construction and Modification
How are Researchers Using gBlocks® Gene Fragments?
Genome Modification
qPCR and SNP Detection Controls
New Technologies
Gene Construction and Modification
New Uses for gBlocks® Gene Fragments in 2014
Gene variant libraries Promoter variation Gene insertion without homologous recombination
Synthetic Biology Partners
New England BioLabs Gibson Assembly™ Master Mix
IDT and SGI are working together to develop further enabling tools for the SynBio community.
Gene constructs from 5 kb to 2 Mb
top related