4: genome evolution. exon shuffling 3 types of exon shuffling exon duplication = the duplication of...

4: Genome evolution

Exon Shuffling

3 types of exon shufflingexon duplication = the duplication of one or more exons within a gene (internal duplication)

exon insertion = exchange of domains between genes or insertions into a gene

exon deletion = the removal of a segment from a gene.

Mosaic Mosaic (or (or chimericchimeric)) protein protein = a protein encoded = a protein encoded by a gene that contains by a gene that contains regions also found in other regions also found in other genes. The existence of such genes. The existence of such proteins provides proteins provides evidenceevidence of of exon shuffling. exon shuffling.

exon shufflingexon shuffling

mosaic proteinsmosaic proteins

4: Genome evolution

Blood Clotting

Clotting - History

1863: Joseph Lister showed that blood is a fluid inside an ox, and undergoes clotting when put on a test glass.

Clotting – The end reaction

thrombinfibrinogen fibrin

After the wound is healed…

plasmin

thrombinfibrinogen fibrin

Clotting

no fibrin (peptides)

plasminogen

Plasmin should only be activated when the wound is healed. Plasmin is created from plasminogen by an enzyme called plasminogen activator (TPA).

Tissue type plasminogen activator (TPA)

fibrin no fibrin

plasmin

Heart attacks

plasminogen

If TPA is given 1h after a heart attack it significantly increases the chance of surviving. (If you run out of TPA chewing aspirin will also do)

Tissue type plasminogen activator (TPA)

fibrin no fibrin

plasmin

plasminogen

Urokinase catalyzes the same reaction as TPA.

urokinase

fibrin no fibrin

plasmin

tissue type plasminogen activator (TPA)

plasminogen

prourokinase

urokinase

fibrin no fibrin

plasmin

Prourokinase is the precursor of urokinase

Prourokinase and TPA are very similar. They both catalyze the same reaction (prourokinase only after it is cleaved to urokinase). But, the difference is that TPA interacts with fibrin and urokinase – does not.

plasminogen

prourokinase

urokinase

fibrin no fibrin

plasmin

Prourokinase and TPA – the domains

The difference is that TPA has another domain, the F1 domain (43 amino acids) that is missing in prourokinase.F1 = fibronectine type 1 module.F1 is responsible for the affinity of TPA to fibrin.

KR ProteaseEG KR

KR ProteaseF1 EG KR

Prourokinase

What is the origin of the F1 domain?

KR ProteaseEG KR

KR ProteaseF1 EG KR

Prourokinase

It probably came from another protein, called fibronectin.

F5 F3F2

F2 = Collagen binding domainF3 = Heparin biding domainF4 = Cell binding domain

Six repeats of F1

F4 F3F1

F5 F3F2

F4 F3F1

Fibronectin

Fibronectin can connect (F4) fibroblasts to fibrin (F1) to repair site of injury.

F5 F3F2

F2 = Collagen binding domainF3 = Heparin biding domainF4 = Cell binding domain

Six repeats of F1

F4 F3F1

F5 F3F2

F4 F3F1

Much more complicated

In fact, there are other domains in the clotting system that resemble each other. It looks like a big complicated puzzle of domain shuffling.

AP = apple module; EG = epidermal growth-factor; F1 & F2 = fibronectin type-1 & type-2; GA = -carboxy-glutamate domain; KR = kringle

TPA acquired its exons from other genes…

There are also many computer programs that analyze a given sequence, and search for homology in known existing domains.

4: Genome evolution

Phase limitations on exon shuffling

The phase of an intron

ATGGGATTCGTTAGCCATTT

Intron of phase 0: lies between two codons

Intron of phase 1: lies between the first and second positions of a codon

ATGGGATGTTAGTCCCATTT

Intron of phase 2: lies between the second and third positions of a codon

ATGGGATTGTTAGCCCATTT

The class of an exon

Exon of class 0-0. Starts at the beginning of a codon, and ends at the end of a codon.

GTTAGCCATTTGTT

Exon of class 0-1. Starts at the beginning of a codon, and ends between positions 1 and 2 of a codon.

GTTAGCCATTTGTT

Exon of class 2-1. Starts between positions 2 and 3 of a codon and ends between positions 1 and 2 of a codon.

GTTAGCCATTTGTT

Exon of class?

Symmetrical exons.

GTTAGCCATTTGTTT

Symmetrical exons are those that are multiples of 3 nucleotides?

(Otherwise, they are asymmetrical).

Tandem duplication of symmetrical exons

GTTAGCCATTTGTGCCATTTGTTT

Tandem duplication of symmetrical exons will not cause a frameshift mutation.

GTTAGCCATTTGTTT

Deletion of symmetrical exons

Deletion of symmetrical exons will not cause a frameshift mutation.

GCGTTAGCCATTTGTTTATTT

What about exons insertion?

Only symmetrical exons can be inserted without causing a frameshift mutation.

GTTAGCCATTTGTTTACCGATTTCAC

But not all symmetrical exons can enter. For example, a 0-0 exon will cause a frameshift if

entered.

GTTAGCCATTTGTTTAGGTACGCCGATTTCAC

GGTACG

0-0 exons can only be inserted in phase 0 introns1-1 exons can only be inserted in phase 1 introns2-2 exons can only be inserted in phase 2 introns

GTTAGCCATTTGTTTAGGTACGCCGATTTCAC

GGTACG

Prourokinase and TPA – exon classes

All recruited exons are of class 1-1. It might be a “frozen accident”: if the first one was 1-1, all the rest should also be 1-1…

KR ProteaseEG KR

KR ProteaseF1 EG KR

Prourokinase

4: Genome evolution

exonization and exon lost

Splicing

In splicing, introns are removed. There are signals in the DNA (in the mRNA) that direct the excision of introns.

exon1 exon2protein

exon1 exon2

mature mRNA

exon1 exon2DNA

ExonizationMutations in the DNA that encode signals for intron excision might result in exonization of the intron.

protein

mature mRNA exon1

DNA exon1

exon1 exon2

mutation in the splicing signal

Exon lostOf course, in a similar vain, exons can also be removed due to such mutations.

protein

mature mRNA

mutation in the splicing signal

4: Genome evolution

Principal biochemical reactions in the synthesis of Principal biochemical reactions in the synthesis of fatty acidsfatty acids from from malonyl CoAmalonyl CoA in in eukaryotes and eubacteriaeukaryotes and eubacteria_____________________________________________________________________________________________________________________

Reaction Enzyme_____________________________________________________________________________________________________________________1. acetyl CoA + condensing-enzyme domain acetyl-condensing enzyme acetyl transferase2. malonyl CoA + acyl-carrier peptide malonyl-acyl-carrier peptide malonyl transferase3. acetyl-condensing enzyme + malonyl-acyl-carrier peptide -ketoacyl-carrier peptide -ketoacyl synthase-keto-acyl carrier peptide + NADPH + H+ -hydroxyacyl-carrier peptide + NADP+ -ketoacyl reuctase5. -hydroxyacyl-carrier peptide 2-butenoyl-acyl-carrier peptide + H2O -hydroxyacyl

dehydratase6. 2-butenoyl-acyl-carrier peptide + NADPH + H+ butyryl-acyl-carrier peptide + NADP+ enoyl reductase7. butyryl-acyl-carrier peptide + condensing-enzyme domain butyryl-condensing enzyme + acyl-carrier peptide thioesterase_____________________________________________________________________________________________________________________

7 enzymatic activities + 1 acyl carrier protein

Multi-domain gene assembly

In most bacteria, these functions are carried on by discrete monofunctional proteins.

In fungi, the activities are distributed between two proteins encoded by two unlinked intronless genes, FAS1 and FAS2. FAS1 encodes 3 of the 8 activities (-ketoacyl synthase, -ketoacyl reductase, and acyl-carrier protein). FAS2 encodes the rest of the five enzymatic activities.

In animals, all functions are performed by one polypeptide, fatty-acid synthase. The gene product has 8 modules, including one that performs a dual function and another whose function is unrelated to fatty-acid synthesis but may determine the 3D structure of this protein.

4: genome evolution. exon shuffling 3 types of exon shuffling exon duplication = the duplication of...

fibrin plasmin slide

fibrin f1

f1 domain

exon shuffling slide

precursor of urokinase

blood clotting slide

affinity of tpa

repeats of f1 f1

Documents

chapter 13 rna splicing the chemistry of rna splicing the...

exon-mobile drilling guide

shuffling with ordered cards

exon - exeter.ox.ac.uk

cd duplication and dvd duplication

exon table

the plant journal gene duplication, exon gain and...

sorting and shuffling arrays

crispr/cas9-mediated genome editing induces exon skipping...

defective(exon(recognition(...

exon autumn 2010

scalable and practical locking with shuffling

shuffling toward a different future

canine models of human amelogenesis imperfecta ...10 of enam...

opposite orientations inverted duplication and allelic...

chapter...

jvm bypass for effcient hadoop shuffling

supporting information - pnas · supporting information...

rfa exon dairy

exon mobil new