1 advances in the treatment of chronic hepatitis c: update to the committee...

Advances in the treatment of chronic hepatitis C:

Update to the Committee

PEG-Intron/RebetolPEG-Intron/RebetolPEG-Intron/RebetolPEG-Intron/Rebetol

Treating chronic hepatitis C10 years of progress

PEG-Intron+ Rebetol

>10.6 mg/kg

PEG-Intron+ Rebetol

Intron A +Rebetol

PEG-Intron

Intron A24 weeks

Intron A48 weeks

1991 2001

Advancements in the treatment of chronic hepatitis C Participant Introduction

Schering-Plough TeamDr. J.J. Garaud Exec. V.P., Clinical ResearchDr. Kenneth Koury Director, BiostatisticsDr. Mark Laughlin Director, Clinical Pharmacology

Dr. Penelope J. Giles Director, Regulatory AffairsDr. Janice K. Albrecht Vice President, Clinical Research

ConsultantsDr. J. McHutchison Medical Director, Liver Transplantation, Scripps ClinicDr. L.J. Wei Professor, Biostatistics, Harvard School of Public Health

Indication: Chronic Hepatitis C(Treatment Naïve Adults)

Approved Dose

PEG-Intron 1.5g/kg Once Weekly

Rebetol 800mg/day

48 Weeks

Treatment chronic hepatitis CInformation provided to the committee

Intron A + Rebetol• Treatment of Relapse Patients

• NEJM 1998, Davis et al• Treatment of Naïve Patients

• NEJM 1998, McHutchison et al• Lancet 1998, Poynard et al

PEG-Intron Monotherapy• Treatment of Naïve Patients

• Hepatology 2001, Lindsay et al

PEG-Intron + Rebetol• Treatment of Naïve Patients

• Lancet 2001, Manns et al

The PEG-Intron molecule

0 20 40 60 80 100 120 140 160 180

Interferon alfa-2b 3MIU

PEG-Interferon alfa-2b 1.5 μg/kg

T½ 40 hours

Intron A 3MU TIWSustained virologic response by patient weight

<55kg (n=40)

55-75kg(n=300)

75-95kg(n=334)

>95kg(n=132)

Patient weight

Intron A 3 MU TIW 48 weeks

PEG-Intron monotherapystudy design

Primary Endpoint: Loss of serum HCV-RNA 24 weeks post-treatment

48 weeks 24 weeksEndpoint

Follow-up

Screening

PEG 0.5g/kg QW N= 315

Intron-A 3MIU TIW N= 303

PEG-Intron monotherapyvirologic response

0 4 12 24 36 EOT FU24

Treatment week

Intron A PEG 0.5 PEG 1.0 PEG 1.5

49%41%

33%24%

*HCV <100 copies/ml

PEG-Intron monotherapyvirologic response

0 4 12 24 36 EOT FU24

Treatment week

Intron A PEG 0.5 PEG 1.0 PEG 1.5

25%23%18%12%

*HCV <100 copies/ml

PEG-Intron monotherapyFactors Associated with

Sustained Virologic Response*

HCV Genotype - Non-1*

HCV-RNA level - Lower*Cirrhosis or bridging fibrosis - Absence**Age - Younger ***

Body weight - Lighter (p=0.9336)

* Multivariate logistic regression, n=914

* p0.0001** p<0.006*** p<0.05

PEG-Intron dose selection

PEG-Intron doses selected for use in combination with Rebetol

• 1.5 g/kg - had maximum antiviral activity particularly in HCV-1

• 0.5 g/kg - had similar antiviral activity to Intron A and was better tolerated

PEG-Intron plus Rebetol

PEG-Intron + Rebetol 1000-1200mg/daily

0.5 g/kg QW (44 wks)1.5 g/kg QW (4 wks) N=514

PEG-Intron + Rebetol 800mg/daily

N=5111.5 g/kg QW (48 weeks)

Screening

Intron A + Rebetol 1000-1200mg/daily

N=5053MIU TIW (48 wks)

Endpoint

Follow-up

48 weeks 24 weeks

Primary Endpoint: Loss of serum HCV-RNA 24 weeks post-treatment

Demographics

Gender

Weight (kg)

828382Mean

434443Mean (yrs.)

67%67%63%Male

89%88%91%Caucasian

43-163 38-181 43-159Range

22-68 22-67 22-68Range

Intron A/R(n=505)

PEG 0.5/R (n=514)PEG 1.5/R (n=511)

Disease Characteristics

HCV RNA copies/ml

HCV genotype

Fibrosis/Cirrhosis*

* Knodell HAI F3/4

29%30%29%Geno 2/3

68%68%68%Geno 1

68%67%69%>2 million

29%30%28%Present

Geno 4/5/6 3% 2% 3%

Intron A/R(n=505)

PEG 0.5/R (n=514)PEG 1.5/R (n=511)

Sustained Virologic Response

Intron A + Rebetol1,000-1,200 mg

PEG 0.5 + Rebetol1,000-1,200 mg

PEG 1.5 + Rebetol800 mg

52%46%46%

* PEG 1.5/800 vs. I/R p=0.03

Sustained Virologic Response

Intron A + Rebetol1,000-1,200 mg

PEG 0.5 + Rebetol1,000-1,200 mg

PEG 1.5 + Rebetol800 mg

54%47%47%

* PEG 1.5/800 vs. I/R p=0.01

Variables associated with sustained response logistic regression analysis

Univariate Genotype

• non-1*

Baseline HCV level*

• lower

Baseline Weight*

• lighter

Bridging fibrosis/cirrhosis*

• absence

• Lower

Gender**

• Female*p 0.001 **p=0.01

Multivariate Genotype

• non-1*

Baseline HCV level*

• lower

Baseline Weight**

• lighter

Bridging fibrosis/cirrhosis*

• Absence

• Age**

• Lower

*p 0.001 **p<0.05

Effect of Rebetol dose mg/kg on virologic response(Logistic regression analysis)

Rebetol mg/kg

5 7 9 11 13 15 17 19 21 23 25 27

PEG 1.5 g/kg

Intron-A 3MU TIW

Rebetol 10.6 mg/kg

All genotypesSustained virologic response

Controlling for Rebetol dose (mg/kg)

*p=0.01Rebetol dose/weight (mg/kg)

47%54%

50% 47%

All 10.6mg/kg >10.6mg/kg

PEG 1.5/R

n=505n=505

n=511n=511

n=22n=22

n=323n=323

n=483n=483

n=188n=188

HCV-1Sustained virologic response

*p=0.02

38%34%

PEG 1.5/R

n=343n=343

n=348n=348

n=15n=15

n=226n=226

n=328n=328

n=122n=122

Rebetol dose/weight (mg/kg)

HCV-2/3Sustained virologic response

Rebetol dose/weight (mg/kg)

79% 82%

82% 81%88%

PEG 1.5/R

n=146n=146

n=147n=147

n=6n=6

n=89n=89

n=140n=140

n=58n=58

Sustained virologic response Controlling for Rebetol dose (mg/kg)

Intron ARebetol

PEG-Intron 1.5 g/kgRebetol 800mg

PEG-Intron 1.5 g/kgRebetol (mg/kg)

10.6 >10.6

2 million

> 2 million

HCV-2/3

77% 74%

2 million

> 2 million

RelapseControlling for Rebetol dose and genotype

Genotype 2/3

Genotype 1 21% 28% 17%

7% 14% 7%11%

Intron/ PEG 1.5/ PEG 1.5/ PEG 1.5/ R1000-1200 R800 R 10.6 R >10.6

All patients 14% 22% 12%18%

Efficacy summary

PEG-Intron 1.5 g/kg/Rebetol is significantly more effective than Intron A/Rebetol and PEG-Intron 0.5 g/kg /Rebetol

• Approved Regimen: 48 weeks of treatment PEG-Intron 1.5g/kg once weekly

plus Rebetol 800mg/day

Further analyses suggest that weight based dosing of ribavirin (mg/kg) results in improved sustained virologic response

PEG-Intron/Rebetol Safety

Adverse eventsIncidence >10% difference between groups

Application site Injection site inflammation 18% 25% 28% 20% Injection site reaction 36% 58% 61% 54%Body as a whole Fever 33% 46% 49% 41% Rigors 41% 48% 51% 43% Weight decrease 20% 29% 28% 30%GI side effects Nausea 33% 43% 44% 43%Skin Alopecia 32% 36% 31% 45%

PEG 1.5/R<10.6 mg/kg

PEG 1.5/R>10.6 mg/kg

Intron/R

PEG 1.5/R800 mgN=511

Incidence 10% in any treatment group:Injection site inflammation, Injection site reaction , mouth dry, sweating, Asthenia,

fatigue, fever, headache, flu-like symptoms, rigors, RUQ pain, weight decrease, dizziness, abdominal pain, anorexia, diarrhea, nausea, vomiting, arthralgia, musculoskeletal pain,

myalgia, anxiety, concentration impaired, depression, emotional liability, insomnia, irritability, infection viral, coughing, dyspnea, pharyngitis, alopecia, pruritis, rash, dry skin

Discontinuations and dose modificationsdue to adverse events

Dose Modifications

Discontinuations 13% 15% 14%

34% 38% 49%42%

Intron/R

PEG 1.5/R800 mgN=511

Dose modification>2% difference between groups

Intron/R

8% 18% 16% 21%

13% 9% 7% 12%

1% 3% 4% 2%

6% 9% 9% 10%

4% 7% 6% 9%

Neutropenia

Anemia

Platelet

Body as a Whole

Gastrointestinal

PEG 1.5/R800 mgN=511

Psychiatric Events 4% 5% 4% 6%

Adverse hematologic effects Neutrophils

Discontinued for Neutropenia

% Patients with<500 at any time

8% 18% 17% 21%

2% 4% 3% 7%

0.2% 1% 0.3% 2%

(1)* (5) (1) (4)

% Patients with <750 at any time

Neutrophils 109/L

Intron /R

PEG 1.5/R800 mgN=511

*Number of patients

Adverse hematologic effects Hemoglobin

Decrease below10g Hemoglobin

Discontinuedfor Anemia

12% 9% 6% 14%

0.2% 0.8% 0% 2%

(1)* (4) (0) (4)

Intron /R

PEG 1.5/R800 mgN=511

*Number of patients

Safety Summary

The types of adverse events observed in the I/R and PEG 1.5/R groups are similar, but there is a somewhat higher incidence with PEG1.5/R

Neutropenia (<750) was more frequent with PEG 1.5/R than with I/R for both the fixed-dose and weight-based dose analyses

With weight-based Rebetol >10.6 mg/kg there was an increased occurrence of anemia and neutropenia than with PEG 1.5/800

Discontinuations due to adverse events were low and similar between the groups; dose modifications due to the adverse events were more frequent with PEG 1.5/R

The higher incidence of AE’s associated with PEG 1.5/R for either fixed-dose or weight-based Rebetol were adequately managed by dose modifications

Study 1-(n~4000) PEG1.5g/kg QW

• Rebetol 800mg vs. weight-based dosing (800 to 1400mg)

• (n~1000) evaluate effect of duration (6 vs.12 months) for patients with favorable prognostic factors

Study 2-(n~1500)

• PEG1.5g/kg vs. PEG1.0g/kg

• Rebetol dose regimen determined from study 1

• Evaluate effect of therapy in African Americans (n~100)

PK food effect of ribavirin (fasted vs. low fat vs. high fat)

Post-marketing studiesPEG-Intron/RebetolPEG-Intron/RebetolPEG-Intron/RebetolPEG-Intron/Rebetol

Dr. J. McHutchison

Medical Director, Liver Transplantation, Scripps Clinic, La Jolla, California

The Decision to Treat Hepatitis C

ComplexComplexControversialControversialHostHost

Severity diseaseSeverity diseaseCo-morbid conditionsCo-morbid conditions

ViralViralGenotype Genotype

TherapyTherapyEfficacyEfficacySide effectsSide effectsCostCost

Weighing the Risks and BenefitsWeighing the Risks and Benefits

Likelihood of responseside effectsside effectsinvestmentsinvestments

Sustained responseSustained responseALT normalALT normalHCV RNA negHCV RNA negHistologic improvementHistologic improvementImproved HQOLImproved HQOLDurable Durable

Decision to TreatDecision to Treat

Majority hepatitis C patientsMajority hepatitis C patientsUnfavorable profileUnfavorable profileGenotype 1Genotype 1

Significant investment and Significant investment and commitmentcommitmentTime (48 weeks)Time (48 weeks)More “aggressive” therapyMore “aggressive” therapyPatientPatientDoctorDoctorOther StaffOther Staff

Decision to Treat Hepatitis C

Practitioner and patientsPractitioner and patients““Do our best first time around”Do our best first time around”

How can we achieve the greatest benefit How can we achieve the greatest benefit whilst diminishing the risk?whilst diminishing the risk?

Provide best support/education

availablePrescribe most

effective dose of peginterferon

Provide most appropriate dose

of ribavirin

Manage side effects via dose reduction

rather than discontinuation

Discontinue treatment early in those unlikely to

respond

1 advances in the treatment of chronic hepatitis c: update to the committee...

screening peg

pegintron monotherapy

weeks intron

pegintron molecule hours

committee pegintronrebetolpeg

hcv slide

committee intron

intronrebetol slide

Documents

review open access origin and evolution of spliceosomal...

intron technology holdings limited

this drawing illustrates the context of the existing ......

intron lte

gtcagatgagcaaagtagacactccagtaacgcggtgagtacattaa exon intron...

intron correlations evolution intron/exonproc. natl. acad....

freka peg gastric freka peg - cobramedical.com

intron evolution: testing hypotheses of intron evolution

p1792, polyethylene glycol 4500, nf - spectrum...

property description preliminary drawings - not …...

itp forest products: development and validation of … ptlf...

intron® a (interferon alfa-2b)

contrasting population structure from nuclear intron...

intron correlations evolution intron/exon

phylogenetic relationships among group ii intron orfs

n preliminary drawings - not for · pdf filepeg fnd peg gone...

product information rebetol (ribavirin, usp)...

product information intron a interferon alfa … 1 product...

percutaneous endoscopic gastrostomy (peg) endoscopic...

group i & ii intron