Seediscussions,stats,andauthorprofilesforthispublicationat:https://www.researchgate.net/publication/262940212

AlteredsubstratespecificityofthePterygoplichthyssp.(Loricariidae)CYP1Aenzyme

ARTICLEinAQUATICTOXICOLOGY(AMSTERDAM,NETHERLANDS)·MAY2014

ImpactFactor:3.45·DOI:10.1016/j.aquatox.2014.05.021·Source:PubMed

READS

84

4AUTHORS,INCLUDING:

ThiagoEMParente

FundaçãoOswaldoCruz

17PUBLICATIONS165CITATIONS

SEEPROFILE

PhilippeUrban

FrenchNationalCentreforScientificResea…

49PUBLICATIONS1,862CITATIONS

SEEPROFILE

MaurodeFreitasRebelo

FederalUniversityofRiodeJaneiro

51PUBLICATIONS661CITATIONS

SEEPROFILE

Allin-textreferencesunderlinedinbluearelinkedtopublicationsonResearchGate,

lettingyouaccessandreadthemimmediately.

Availablefrom:PhilippeUrban

Retrievedon:12January2016

AC

Ta

b

c

d

a

ARRAA

KPCAEKC

1

P(tttSpet

(B

h0

Aquatic Toxicology 154 (2014) 193–199

Contents lists available at ScienceDirect

Aquatic Toxicology

j ourna l ho me pa ge: www.elsev ier .com/ locate /aquatox

ltered substrate specificity of the Pterygoplichthys sp. (Loricariidae)YP1A enzyme

hiago E.M. Parentea,∗, Philippe Urbanb,c,d, Denis Pomponb, Mauro F. Rebeloa

BioMA, Instituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro, BrasilUniversité de Toulouse; INSA, UPS, INP; LISBP, 135 Avenue de Rangueil, F-31077 Toulouse, FranceINRA, UMR792 Ingénierie des Systèmes Biologiques et des Procédés, F-31400 Toulouse, FranceCNRS, UMR5504, 135 Avenue de Rangueil, F-31400 Toulouse, France

r t i c l e i n f o

rticle history:eceived 21 February 2014eceived in revised form 16 May 2014ccepted 19 May 2014vailable online 27 May 2014

eywords:450atfishdaptationvolutioninetics parametersoumarins

a b s t r a c t

Ethoxyresorufin is a classical substrate for vertebrate CYP1A enzymes. In Pterygoplichthys sp. (Loricari-idae) this enzyme possesses 48 amino acids substitutions compared to CYP1A sequences from othervertebrate species. These substitutions or a certain subset substitution are responsible for the non-detection of the EROD reaction in this species liver microsomes. In the present study, we investigatedthe catalytic activity of Pterygoplichthys sp. CYP1A toward 15 potential substrates in order to under-stand the substrate preferences of this modified CYP1A. The fish gene was expressed in yeast and theaccumulation of the protein was confirmed by both the characteristic P450-CO absorbance spectra andby detection with monoclonal antibodies. Catalytic activities were assayed with yeast microsomes andfour resorufin ethers, six coumarin derivates, three flavones, resveratrol and ethoxyfluoresceinethylester.Results demonstrated that the initial velocity pattern of this enzyme for the resorufin derivatives is dif-ferent from the one described for most vertebrate CYP1As. The initial velocity for the activity with thecoumarin derivatives is several orders of magnitude higher than with the resorufins, i.e. the turnovernumber (kcat) for ECOD is 400× higher than for EROD. Nonetheless, the specificity constant (kcat/km) for

EROD is only slightly higher than for ECOD. EFEE is degraded at a rate comparable to the resorufins.Pterygoplichthys sp. CYP1A also degrades 7-methoxyflavone and �-naphthoflavone but not resveratroland chrysin. These results indicate a divergent substrate preference for Pterygoplichthys sp. CYP1A, whichmay be involved in the adaptation of Loricariidae fish to their particular environment and feeding habits.

© 2014 Elsevier B.V. All rights reserved.

. Introduction

CYP1A is a structurally conserved subfamily of cytochromes450 that has been found in every species, from fish to mammalsGoldstone and Stegeman, 2006; Goldstone et al., 2007). CYP1A pro-eins are able to use a wide variety of compounds as substrates,aking part in the endogenous metabolism and biotransforma-ion of xenobiotics (Ioannides and Lewis, 2004; Goldstone andtegeman, 2006). These enzymes catalyze xenobiotic oxidation,

roducing more polar compounds, which expedites xenobioticxcretion from the organism. In addition, CYP1As often catalyzehe bioactivation of pre-toxins, producing the final mutagenic and

∗ Corresponding author at: Av. Carlos Chagas Filho s/n, CCS, Bl. G, Sala G2-0502 andar), UFRJ, Ilha do Fundão, Cidade Universitária, 21941902 Rio de Janeiro, RJ,razil. Tel.: +55 21 98656 0101.

E-mail addresses: parente@biof.ufrj.br, thiparente@gmail.com (T.E.M. Parente).

ttp://dx.doi.org/10.1016/j.aquatox.2014.05.021166-445X/© 2014 Elsevier B.V. All rights reserved.

carcinogenic metabolites (Nebert et al., 2004). Ethoxyresorufin isthe usual substrate used to measure CYP1A catalytic activity by theethoxyresorufin-O-deethylase (EROD) reaction (Burke et al., 1994;Radenac et al., 2004; Vehniainen et al., 2012).

Birds, reptiles and mammals possess two CYP1A isoforms, whilemost fish species have a single gene (Goldstone and Stegeman,2006). The substrate specificity of this protein in fish and mam-mals is similar, despite some marked differences in the oxidationrate of some molecules (e.g. 3,3′,4,4′-tetrachlorobiphenyl, TCB) andon the regiospecificity of the enzyme (Prasad et al., 2007). Our grouphas demonstrated that the CYP1A protein is expressed in three fishspecies of the Loricariidae family, but EROD activity is not detected(Parente et al., 2009; Parente et al., 2011). Recently, we demon-strated that the CYP1A from one of these species, Pterigoplichthys

sp. (Loricariidae), possess 48 amino acids substitutions in relationto the CYP1A sequence of 27 other fish species (Parente et al., 2011).As suggested by molecular modeling simulations, these amino acidsubstitutions or a certain subset substitution alter the frequency

1 c Toxi

aeE2

(asgoseimsCcs

s1t

2

2

rfarf5PaespbtFatPiT

2

a(waewPptwiccc

94 T.E.M. Parente et al. / Aquati

nd the conformation with which ethoxyresorufin docks inside thenzyme active site, and are the suggested cause for the lack ofROD activity in the liver microsome of this species (Parente et al.,011).

Fish from the Loricariidae family, the largest catfish familySiluriformes), are endemic to Central and South America. Theyre benthonic and inhabit a vast array of environments but eachpecies is highly adapted to its habitat, showing a small geo-raphic distribution (Montoya-Burgos, 2003). Loriicarids feedsn algae, microinvertebrates and detritus by scraping the sub-trate with their suckermouths (Montoya-Burgos, 2003; Mazzonit al., 2010; Lujan and Armbruster, 2012). As CYP1A takes partn the metabolism of environmental chemicals, vegetal secondary

etabolites and other toxins found in food, it is hypothe-ized that the modifications found in the Pterygoplichthys sp.YP1A have evolved as an adaptation to the particular chemi-al environments and feeding habits of this particular Loricariidaepecies.

In this context, in order to understand Pterygoplichthys sp. CYP1Aubstrate preferences, we investigated its catalytic activity toward5 potential substrates by the heterologous expression of this pro-ein in a yeast host.

. Methodology

.1. Pterygoplichthys sp. CYP1A cloning

Pterygoplichthys sp. CYP1A was amplified using as starting mate-ial the fish gene inserted in the PGEM-T easy plasmid (PROMEGA)rom our previous study (Parente et al., 2011). The gene wasmplified using the following primers in order to add specificestriction sites and sequences to aid expression by the yeast host:orward 5′- GGATCCAAAATGGTGCTGGCAGTTCTCCCAATT; reverse′- GGAATTCTCACACTTCGGACCCTGGCCGCGGAGT. The resultingCR product was gel purified, inserted in the PCR-SCRIPT vectornd cloned in E. coli for plasmid expansion. Plasmids from sev-ral clones were purified (Plasmid DNA maxiprep, Qiagen) andequenced for CYP1A sequence confirmation (MWG Eurofins). Alasmid with the exact sequence as deposited in the GenBank geneank (GI: 312982586) was treated with EcoRI and BamHI restric-ion enzymes (Fermentas) and the CYP1A gene was gel purified.or yeast expression, the purified gene was ligated into an EcoRInd BamHI pre-digested pYeDP60 vector, and used to transformhe BY(R) yeast strain, which overexpresses both the recombinant450 and yeast NADPH-P450 reductase when the cells are grownn the presence of galactose as a carbon source (Urban et al., 2001;aly et al., 2007).

.2. Yeast expression

Yeast (Saccharomyces cerevisiae) of the BY(R) strain were grownnd made competent by applying the lithium acetate protocolUrban et al., 2001). The competent yeasts were transformedith the ligated plasmid by heat shock (42 ◦C for 20 s) with the

ssistance of polyethylene glycol and lithium acetate, as detailedlsewhere (Urban et al., 2001). Selection of positive transformantsas conducted on plates with selective medium (CSM–His, Fisher).

ositive clones were selected for mitochondrial respiration onlates containing glycerol. Several well-growing clones were usedo inoculate 50 mL of SGI selective liquid media. This culture

as grown overnight to reach stationary phase and was used to

noculate 250 mL of YPGE liquid culture. After 48 h growing ononstant shaking and at 28 ◦C, 5 g of galactose were added to theulture for the overnight induction of the expression of both theloned gene and the yeast P450 reductase.

cology 154 (2014) 193–199

2.3. Microsomal fractions preparation

Briefly, yeast cells were harvested by centrifugation, resus-pended and washed in 50 mM Tris–HCl 1 mM EDTA 6 M Sorbitol(TES) buffer pH7.3. Cells were disrupted by manual shaking with400 �m-diameter glass beads. Cellular debris was removed by cen-trifugation. The supernatant was transferred to another centrifugetube, NaCl and PEG4000 were added at final concentrations of0.1 M and 10% respectively, and the mixtures were kept on ice for30 min. The microsomes were then precipitated by centrifugationfor 10 min at 10,000 rpm, washed, resuspended in 50 mM Tris–HCl1 mM EDTA 20% glycerol (TEG) buffer and stored at −80 ◦C (Urbanet al., 2001).

2.4. Confirmation of CYP1A cloning in yeast

CYP1A expression in yeast was confirmed by both the quantifi-cation of total P450 and immunoblotting. Total P450 content in themicrosomal preparations was quantified by the method of Omuraand Sato (1964). Microsomal proteins were fractionated on a 12%polyacrylamide gel, transferred to a nitrocellulose membrane andthe cloned Pterygoplichthys sp. CYP1A was detected using anti-fishCYP1A monoclonal antibody (MAb 1-12-3, ref). Additionally, theNADPH-cytochrome c reductase activity of the yeast NADPH-P450reductase was assayed in the presence of 0.1 M KCN, as describedelsewhere (Taly et al., 2007).

2.5. Catalytic activities

2.5.1. Fluorimetric assaysThe catalytic activities for resorufin ethers, coumarin deriva-

tives and 7-ethoxyfluorescein ethyl ester (EFEE) were measured byspectrofluorimetry (bandwidths = 10 nm, PM tension = 500 V, FLX-Xenius, Safas Monaco). The chemical structures of all substratesare shown in Scheme 1. Briefly, yeast microsomes (15 �mol of CYP)were incubated at 30 ◦C in 0.1 M phosphate buffer containing 1 mMEDTA pH 7.4, in the presence of the 15 substrates, one by one. Thereaction was started by the addition of NADPH and the increasein fluorescence was recorded for 5 min at the excitation/emissionwavelength pair specific for the fluorogenic substrate. For thedetermination of steady state parameters (Km and Vmax), catalyticactivities were assayed in a varying range of substrate concentra-tions (0–4 �M for ethoxyresorufin; 0–3 �M for benzyloxyresorufinand ethoxyethylfluorescein; and 0–500 �M for ethoxycoumarin).The excitation and emission wavelength for each end product isshown in Table 1.

2.5.2. HPLC/MSActivities with the three flavonoids (7-methoxyflavone, �-

naphthoflavone and chrysin) and with resveratrol, as well as certainalternative metabolites of the activities with resorufin ethers andcoumarin derivatives, were analyzed on a HPLC/MS.

This was performed due to our previous docking simulationsthat indicated an inverted dock position of ethoxyresorufin inthe active site, suggesting that oxidation could be occurring ata different position, therefore, altering enzyme regiospecificity(Parente et al., 2011). Activities were stopped by the addition ofacetonitrile (1:1 vol/vol) after 5, 10, 15 and 20 min. The mixtureswere homogenized by vortex and kept on ice for phase separa-tion. The acetonitrile phase was transferred to another tube and30 �L were injected into the HLPC/MS for product separation.The acetonitrile extracts were separated at 40 ◦C with an XTer-

raMS C18 5 �m 4.6 × 100-mm column (Waters) and analyzed bothon a PDA microdiode array UV-Visible detector (Waters) and ona Micromass ZQ single quadrupole mass spectrometer (Waters).The solvent system consisted of water +0.03% formic acid (by

T.E.M. Parente et al. / Aquatic Toxicology 154 (2014) 193–199 195

assay

vdfpdflt3v

Scheme 1. Chemical structures of the 15 substrates

ol.) versus acetonitrile +0.03% formic acid (by vol.). The gra-ient used for all substrates starts at 90:10 (water:acetonitrile)ollowed by a linear gradient from 90:10 to 0:100 in 10 min, alateau at 0:100 for 2 min, and, finally, a return to initial con-itions, held for 2 min. The total run time is 14 min with aow rate set at 1 mL/min. Parameters for the mass spectrome-

er were set at electrospray positive ionization, capillary voltage.4 kV, cone voltage 30 V, desolvation gas flow at 550 L/h, desol-ation temperature at 350 ◦C and source temperature at 120 ◦C.

ed with yeast-expressed Pterygoplichthys sp. CYP1A.

Continuous metabolite mass detection was conducted both atfull scan of mass range 200–500 amu and several SIR (SingleIon Response) channels set at precise m/z corresponding to thedifferent expected protonated metabolites (Urban et al., 2008,2009).

2.6. Statistical analyses

All statistical analyses were performed using the softwarePrism 5 GraphPad for Mac OS. The initial velocity for resorufin

196 T.E.M. Parente et al. / Aquatic Toxicology 154 (2014) 193–199

Table 1Emission and excitation wavelengths (nm) for the detection of the EFEE products and for each of the resorufin and coumarin substrates.

Substrate Excitation � (nm) Emission � (nm) Standard

7-Ethoxyresorufin

530 586 Resorufin7-Methoxyresorufin7-Benzyloxyresorufin7-Pentoxyresorufin

7-Ethoxyfluorescein Ethylester 480 521 Fluorescein

7-Ethoxycoumarin

380 460Coumarin

7-Methoxycoumarin7-Methoxy-4-methylcoumarin

afKn

3

3

Cfa4CeCTp

3

wdfldc

FTa

7-Methoxy-4-bromomethylcoumarin7-Ethoxy-4-methylcoumarin

385 7-Methoxy-4-trifluoromethylcoumarin

nd coumarin derivates were compared using one-way ANOVAollowed by Tukey’s multiple comparison tests. The Vmax andm calculations were performed using the Michaelis–Mentenon-linear fit available on the software.

. Results

.1. Confirmation of CYP1A expression in yeast

Yeast microsomal fractions expressing Pterygoplichthys sp.YP1A displayed the characteristic CO-bound reduced P450 dif-

erential spectrum with an absorbance peak around 450 nm andlmost no denaturated CYP, which has a maximum absorption at20 nm (Fig. 1). Protein production varied from 7.5 to 16.5 nmol ofYP per liter of yeast culture. On the SDS-PAGE, a single band at thexpected molecular weight (∼60 kDa) was reactive against the fishYP1A monoclonal antibody MAb 1-12-3 (Stenotomus chrysops).he reductase activity was calculated to be 7.7 nmol cyt c reduceder min per mg microsomal protein.

.2. Catalytic activities

The catalytic activity of Pterygoplichthys sp. CYP1A was assayedith fifteen different substrates; four resorufin ethers, six coumarin

erivatives, one fluorescein derivative, and four polyphenols (threeavonoids and resveratrol). There is a marked difference in the oxi-ation rates of the resorufin and coumarin derivatives, in which theoumarin rates were two orders of magnitude higher.

ig. 1. Differential absorbance spectrum of CO reduced yeast microsomal fractions.he CYP characteristic absorbance peak at 450 nm is clearly shown with a minimummount of its degraded P420 form.

502

Among the resorufin ethers, as shown in Fig. 2a, benzy-loxyresorufin (vi = 0.38 ± 0.02 �mol−1 min−1 �mol of P450−1) andethoxyresorufin (vi = 0.32 ± 0.02 �mol−1 min−1 �mol of P450−1) O-dealkylation rates were not significantly different from eachother and presented the highest oxidation rates, followedby methoxyresorufin and penthoxyresorufin, that showed thesame activity (vi = 0.04 ± 0.01 �mol−1 min−1 �mol of P450−1). EROD(ethoxy-resorufin O-deethylase) activity was inhibited by 1 nM �-naphthoflavone (ANF), a known CYP1A inhibitor, by 80 ± 4%. Noalternative product other than resorufin was detected by HPLC/MSfor all activities with resorufin ethers as substrates.

Regarding the coumarin derivatives, 7-ethoxycoumarin-O-deethylase (ECOD) activity showed the highest oxidation rate(vi = 124.0 ± 4.0 �mol−1 min−1 �mol of P450−1) followed by 7-ethoxy-4-methyl-coumarin (ETCO, vi = 68.1 ± 5.0), 7-methoxy-coumarin (MCOD, vi = 63.1 ± 1.9), 7-methoxy-4-methyl-coumarin(MMCO, vi = 21.1 ± 4.1), 7-methoxy-4-threefluoromethylcoumarin(MTCO, vi = 17.2 ± 2.5) and 7-methoxy-bromomethylcoumarin(MBCO, vi = 14.9 ± 2.2) (Fig. 2b). ECOD activity was inhibited by1 nM ANF by 40 ± 12%. The HPLC/MS analysis detected threemetabolites produced by the incubations with 7-ethoxycoumarinand two metabolites in the incubations with 7-methoxy-4-methylcoumarin. The major product for 7-ethoxycoumarin wasumbelliferone (m/z = 163 in electrospray positive ionization mode)while the m/z of the other two products could not be determineddue to unknown fragmentation. Both products for 7-methoxy-4-methylcoumarin could not have their m/z determined for the samereason.

7-Ethoxyfluorescein ethylester (EFEE), a fluores-cein derivative, was degraded at an initial velocity of0.72 ± 0.01 �mol−1 min−1 �mol of P450−1, a rate comparableto the velocity found for the resorufin ethers (Fig. 2a). It was notpossible to quantify the initial velocity for the four polyphenolsdue to the lack of appropriate standards. However, it was observedthat the Pterygoplichthys sp. CYP1A is able to degrade 7-methoxy-flavone and �-naphthoflavone while not being able to degraderesveratrol and chrysin. The degradation of 7-methoxyflavonewas linear during the first 20 min of the reaction while thedegradation of �-naphthoflavone reached a plateau at 10 min(Fig. 3). The 7-methoxyflavone metabolite could not be iden-tified by HPLC/MS due to the limited amount of this product,but the �-naphthoflavone metabolite has m/z = 289, suggesting ahydroxylated product.

3.3. Enzyme kinetics

Kinetic parameters were calculated for EROD, BROD and ECOD as

they showed the highest initial velocity of resorufin and coumarinderivatives, and also for EFEE due to its high fluorescent signal(Fig. 4). ECOD showed the highest kcat and also the highest Km,followed by EFEE, BROD and EROD (values shown in Table 2). All

T.E.M. Parente et al. / Aquatic Toxicology 154 (2014) 193–199 197

Fig. 2. Initial velocities for activities with the resorufin ethers and EFEE (A) and coumarin derivatives (B). EROD and BROD were significantly different from the other activitiesbut not from each other (a). MROD and PROD were significantly different from the other aactivities (c). ECOD was significantly different from the other activities (d). MCOD and ETCMTCO, MBCO and MMCO were significantly different from the other activities but not fro

Table 2Turnover number (kcat), Km and catalytic efficiency constant (kcat/Km) for EROD,BROD, EFEE and ECOD activities catalyzed by yeast-expressed microsomal Ptery-goplichthys sp. CYP1A.

Activity kcat (min−1) Km (�M) kcat/Km (M−1 s−1)

EROD 0.39 ± 0.02 0.12 ± 0.02 5.4 × 104

4

fet

4

tdbPhr(eTaM2pf

FC

BROD 0.41 ± 0.01 0.15 ± 0.01 4.5 × 10EFEE 0.84 ± 0.02 0.27 ± 0.03 5.2 × 104

ECOD 158.4 ± 7.5 62.5 ± 10.0 4.2 × 104

our activities showed a similar kcat/Km ratio (Table 2). The catalyticfficiency constants (kcat/Km ratios) were as follows, from highesto lowest: EROD, EFEE, BROD, ECOD.

. Discussion

The initial velocity for the activities with the resorufin deriva-ives catalyzed by the Pterygoplichthys sp. CYP1A exhibited aifferent pattern than the one usually presented by most verte-rate species. The pattern presented in the present study by theterygoplichthys sp. CYP1A was BROD = EROD > MROD = PROD. Itas been shown elsewhere that the CYP1A from zebrafish (Danioerio) shows the following pattern: EROD > MROD > BROD > PRODScornaienchi et al., 2010). Human CYP1A1 and avian CYP1A4xhibited the same pattern as zebrafish (Urban et al., 2001;aly et al., 2007; Kubota et al., 2009). The human CYP1A2 andvian CYP1A5, on the other hand, have shown a third profile:

ROD > EROD > BROD > PROD (Taly et al., 2007; Kubota et al.,

009). The EROD/MROD ratio described here for the Pterygo-lichthys sp. CYP1A (EROD/MROD = 8) is also different from the ratioound for human CYP1A1 (EROD/MROD = 3) and human CYP1A2

ig. 3. Degradation of 7-methoxyflavone, producing 7-hydroxy-flavone, (A) and �-naphtYP1A in yeast microsomal fractions shown as an increment of the main product HPLC p

ctivities but not from each other (b). EFEE was significantly different from the otherO were significantly different from the other activities but not from each other (e).m each other (f).

(EROD/MROD = 1) (Urban et al., 2001; Taly et al., 2007). These dataindicate that the substrate specificity of the CYP1A isoform fromPterygoplichthys sp. is divergent from the usual vertebrate CYP1Asubstrate specificity.

There was a marked difference between the turnover number(kcat) of EROD, BROD and ECOD activities. This pronounced differ-ence was also observed for the initial velocity of the activities withthe other resorufin ethers and coumarin derivatives, when assayedat non-limiting substrate concentrations. The very low turnovernumbers for EROD and BROD activities and the even lower ini-tial velocities for MROD and PROD activities are the most probableexplanation for the lack of those activities in the liver microsomesof AHR agonist treated and untreated Pterygoplichthys sp., Hyposto-mus affinis and H. auroguttatus (Parente et al., 2009; Parente et al.,2011). On the other hand, the turnover number for ECOD activitywas high. This is in accordance with the ECOD activity found inHypotomus spp., which was five to ten times higher than the sameactivity in Tilapia (Oreochromis niloticus) (Parente et al., 2009).

The Henri–Michaelis–Menten constant (Km) value is often simi-lar to the real concentration of the substrate in the enzyme cellularenvironment. The Km values for the synthetic substrates used forassaying the EROD and BROD activities were very low when com-pared to the Km value for the ECOD activity. This observationindicates that, in the cellular environment, the enzyme would bemore exposed to coumarin derivatives than to resorufin-like com-pounds. This hypothesis makes sense in light of the coumarin-richdiet of the fish in question (Pterygoplichthys sp.), since it feeds on

periphyton and other algae. Moreover, alongside the high turnovernumber for ethoxy-coumarin, this coumarin preference suggeststhat Pterygoplichthys sp. CYP1A plays a relevant role in the biotrans-formation of coumarin derivatives.

hoflavone, producing a hydroxylated product, (B) catalyzed by Pterygoplichthys sp.eak area.

198 T.E.M. Parente et al. / Aquatic Toxicology 154 (2014) 193–199

F alyzedw sorufie

dscatt

5

CsTffmifidftrtsa

A

(

ig. 4. (A–D) Henri–Michaelis–Menten plot for EROD, BROD, EFEE and ECOD catere assayed in a varying range of substrate concentrations (0–4 �M for ethoxyre

thoxycoumarin) at 30 ◦C with 15 �mol of yeast expressed CYP.

The structural basis for these modified patterns have beeniscussed previously (Parente et al., 2011). In essence, twoubstitutions located at the opening of the major substrate accesshannel, Phe222 and Ile255, stabilizes the EOR outside the enzymective center and, during the few times that the substrate entershe enzyme core, it enters in an inverse position, not productive forhe deethylation reaction.

. Conclusions

The amino acid substitutions found in the Pterygoplicthys sp.YP1A have provoked a marked change in this enzyme’s substratepecificity when compared to most vertebrate CYP1A isoforms.hese structural changes have reduced the specificity constantor EROD, maintained this constant for BROD and increased itor ECOD, suggesting that, in Pterygoplicthys sp., CYP1A plays a

ore important role in the biotransformation of coumarins thann other vertebrate species. In the same context, the similar speci-city constants indicate that the CYP1A from Pterygoplichthys sp.oes not have a preferential substrate. The low specificity constantor EROD is caused by both an increase of the Km and a decrease ofhe Vmax for this activity. This low Vmax is also the most probableeason for the lack of EROD in liver microsomes from Pterygoplic-hys sp. The significance of these functional changes on the CYP1Aubstrate specificity for the fish physiology, toxicological responsesnd environment adaptation are under investigation.

cknowledgments

TEMP is supported by a PEER Science grant from USAID/NASPGA-2000003446). Authors are thankful to Dr. Gilles Truan and

by Pterygoplichthys sp. CYP1A in yeast microsomal fractions. Catalytic activitiesn; 0–3 �M for benzyloxyresorufin and ethoxyethylfluorescein; and 0–500 �M for

Florence Calvayrac for their valuable assistance on yeast transfor-mation.

References

Burke, M.D., Thompson, S., et al., 1994. Cytochrome P450 specificities of alkoxyre-sorufin O-dealkylation in human and rat liver. Biochem. Pharmacol. 48 (5),923–936.

Goldstone, H.M., Stegeman, J.J., 2006. A revised evolutionary history of the CYP1Asubfamily: gene duplication, gene conversion, and positive selection. J. Mol. Evol.62 (6), 708–717.

Goldstone, J.V., Goldstone, H.M., et al., 2007. Cytochrome P450 1 genes in earlydeuterostomes (tunicates and sea urchins) and vertebrates (chicken and frog):origin and diversification of the CYP1 gene family. Mol. Biol. Evol. 24 (12),2619–2631.

Ioannides, C., Lewis, D.F., 2004. Cytochromes P450 in the bioactivation of chemicals.Curr. Top. Med. Chem. 4 (16), 1767–1788.

Kubota, A., Kim, E.Y., et al., 2009. Alkoxyresorufin (methoxy-, ethoxy-, pentoxy- andbenzyloxyresorufin) O-dealkylase activities by in vitro-expressed cytochromeP450 1A4 and 1A5 from common cormorant (Phalacrocorax carbo). Comp.Biochem. Physiol. C: Toxicol. Pharmacol. 149 (4), 544–551.

Lujan, N.K., Armbruster, J.W., 2012. Morphological and functional diversity of themandible in suckermouth armored catfishes (Siluriformes: Loricariidae). J. Mor-phol. 273 (1), 24–39.

Mazzoni, R., Rezende, C.F., et al., 2010. Feeding ecology of Hypostomus punctatusValenciennes, 1840 (Osteichthyes, Loricariidae) in a costal stream from South-east Brazil. Braz. J. Biol. 70 (3), 569–574.

Montoya-Burgos, J.I., 2003. Historical biogeography of the catfish genus Hypostomus(Siluriformes: Loricariidae), with implications on the diversification of Neotrop-ical ichthyofauna. Mol. Ecol. 12 (7), 1855–1867.

Nebert, D.W., Dalton, T.P., et al., 2004. Role of aryl hydrocarbon receptor-mediatedinduction of the CYP1 enzymes in environmental toxicity and cancer. J. Biol.Chem. 279 (23), 23847–23850.

Omura, T., Sato, R., 1964. The carbon monoxide-binding pigment of liver micro-

somes. I. Evidence for its hemoprotein nature. J. Biol. Chem. 239, 2370–2378.

Parente, T.E., De-Oliveira, A.C., et al., 2009. Lack of constitutive and inducibleethoxyresorufin-O-deethylase activity in the liver of suckermouth armoredcatfish (Hypostomus affinis and Hypostomus auroguttatus, Loricariidae). Comp.Biochem. Physiol. C: Toxicol. Pharmacol. 150 (2), 252–260.

c Toxi

P

P

R

S

T

and exogenous susbtrates between members of the CYP1A subfamily. Open Drug

T.E.M. Parente et al. / Aquati

arente, T.E., Rebelo, M.F., et al., 2011. Structural features of cytochrome P450 1Aassociated with the absence of EROD activity in liver of the loricariid catfishPterygoplichthys sp. Gene 489, 111–118.

rasad, J.C., Goldstone, J.V., et al., 2007. Ensemble modeling of substrate binding tocytochromes P450: analysis of catalytic differences between CYP1A orthologs.Biochemistry 46 (10), 2640–2654.

adenac, G., Coteur, G., et al., 2004. Measurement of EROD activity: caution onspectral properties of standards used. Mar. Biotechnol. (NY) 6 (4), 307–311.

cornaienchi, M.L., Thornton, C., et al., 2010. Functional differences in thecytochrome P450 1 family enzymes from zebrafish (Danio rerio) using heterol-ogously expressed proteins. Arch. Biochem. Biophys. 502 (1), 17–22.

aly, V., Urban, P., et al., 2007. A combinatorial approach to substrate discriminationin the P450 CYP1A subfamily. Biochim. Biophys. Acta 1770 (3), 446–457.

cology 154 (2014) 193–199 199

Urban, P., Jobert, A.S., et al., 2001. Cytochrome P450 (CYP) mutants and substrate-specificity alterations: segment-directed mutagenesis applied to humanCYP1A1. Biochem. Soc. Trans. 29 (Pt 2), 128–135.

Urban, P., Truan, G., et al., 2008. High-throughput enzymology and combinatorialmutagenesis for mining cytochrome P450 functions. Expert Opin. Drug Metab.Toxicol. 4 (6), 733–747.

Urban, P., Truan, G., et al., 2009. Diferences in functional clustering of endogenous

Metab. J. 3, 17–30.Vehniainen, E.R., Schultz, E., et al., 2012. More accuracy to the EROD measurements

– the resorufin fluorescence differs between species and individuals. Aquat.Toxicol. 116–117, 102–108.