alteration in mrna levels of fas splice variants in hepatitis c-infected liver

, . 183: 299–304 (1997)

ALTERATION IN mRNA LEVELS OF Fas SPLICEVARIANTS IN HEPATITIS C-INFECTED LIVER

. 1, . 2, 1, . . 1 . 1*1Department of Pathology, Edinburgh University Medical School, Teviot Place, Edinburgh, EH8 9AG, U.K.

2Department of Medicine, Edinburgh Royal Infirmary NHS Trust, Lauriston Place, Edinburgh, U.K.

SUMMARY

The Fas receptor (APO-1/CD95) is expressed on hepatocytes and is thought to be important in triggering apoptosis after ligation bythe Fas ligand carried on cytotoxic T cells. Recent evidence has shown that several splice variants of Fas exist, the major one of which(FasTMDel) may produce a soluble protein which can modulate apoptosis by interacting with ligand. There are no data on the expressionof splice variants of Fas in liver disease. RNA was extracted from needle biopsies from 13 patients with hepatitis C virus (HCV) infectionand six normal liver samples. By reverse transcriptase polymerase chain reaction (RT-PCR) FasTMDel expression was demonstratedat the mRNA level, in both normal and HCV-infected liver. Quantitative PCR demonstrated an increase in Fas transcript relative toFasTMDel in HCV infection. This difference is due to an induction of Fas, with FasTMDel remaining at constant levels in the twogroups. If translated into protein, liver cells may express more Fas and thus be susceptible to apoptosis inducible by ligand-bearingcytotoxic T cells. These findings suggest that mechanisms exist to regulate the differential splicing of Fas and FasTMDel dependent onthe cell’s environment. The degree of alteration in the levels of Fas relative to FasTMDel occurred independently of the ALT levels andhistological grading of the HCV-infected cases. However, an association was noted between increasing Fas:FasTMDel ratio and logviral load in the liver, measured by competitive PCR. ? 1997 John Wiley & Sons, Ltd.

J. Pathol. 183: 299–304, 1997.No. of Figures: 6. No. of Tables: 0. No. of References: 25.

KEY WORDS—Fas; Hepatitis C; liver; splice variants; CD95

INTRODUCTION

The Fas antigen (APO-1/CD95) was first identified in19891,2 and subsequently shown to be a member of theTNF-R superfamily, mapping to chromosome 10q23.3When ligated and trimerized in vitro, Fas induces apop-tosis in a variety of sensitive cell types and lines,1,2,4 by amechanism closely coupled to members of the cysteineprotease family.5,6 The Fas/Fas ligand system of cyto-toxicity is now recognized as a major mechanism in themaintenance of peripheral immune tolerance7,8 and as asecond arm of the cytotoxic response of the specificimmune system. Activated T cells upregulate their Fasligand and cause apoptosis in the target cells, whichexpress Fas in response to cytokine stimulation.9,10Special interest has been directed at the role of Fas

function in the liver. When activating antibodies areinjected intravenously into mice, the majority of theirhepatocytes undergo apoptosis, leading to haemorrhageand death.11 A similar sensitivity has been demonstratedfor human hepatocytes in vitro.12 A Fas-knockoutmouse has been generated, which is immune to the lethaleffects of anti-Fas antibody, but develops a substantialliver hyperplasia,13 suggestive of a role for Fas in thehomeostasis of the liver. Fas protein expression iselevated in liver failure and in viral hepatitis B and

C,12,14 whilst Fas ligand mRNA is expressed by hepato-cytes suffering alcoholic liver damage.12 These findingssuggest that the Fas/Fas ligand system is a majormechanism in physiological and pathological hepaticcytotoxicity. Recent research has revealed a solublesplice variant of Fas, FasTMDel, which functionsin vitro as a soluble decoy receptor, antagonizing cyto-toxicity by binding and inactivating ligand.15–18 Theexpression of FasTMDel in vivo is largely unknown, butmay represent a physiological mechanism which modu-lates Fas-mediated apoptosis. This work sought toexamine the effects of hepatitis C virus (HCV) infectionon the expression of Fas and FasTMDel at the mRNAlevel.

MATERIALS AND METHODS

Origin of tissuesThirteen patients presenting for diagnostic laparo-

scopy and liver biopsy to assess their hepatitis C infec-tion were included; informed consent was obtained fromeach patient. Normal liver tissue was obtained fromsections trimmed from organs awaiting transplant. Alltissue samples were stored at "70)C for future use.

Extraction of RNA from liver samples

RNA was extracted from normal and HCV tissueusing the phenol/guanidinium thiocyanate-based one-step method.19 RNAzol B (Cinna/Biotecx) reagent wasused for this purpose, following supplied protocols.

*Correspondence to: David J. Harrison, Department of Pathology,Edinburgh University Medical School, Teviot Place, EdinburghEH8 9AG, U.K.

Contract grant sponsor: The Scottish Home and HealthDepartment.

CCC 0022–3417/97/110299–06 $17.50 Received 3 January 1997? 1997 John Wiley & Sons, Ltd. Accepted 6 May 1997

RNA concentration was determined by absorbance at260 nm.

Reverse transcription of cDNA

Complementary DNA (cDNA) was synthesizedfrom template RNA by means of a Moloney MurineLeukaemia Virus Reverse Transcriptase, Superscript II(GibcoBRL). Reverse transcription was primed usingprimer p(dT)10 (GibcoBRL), which hybridizes with thepoly-A tail of the 3* terminus of mature messenger RNA(mRNA).

Polymerase chain reaction (PCR) for Fas andFasTMDel

Primers were designed flanking exon 6, which isomitted from the alternatively spliced FasTMDel (seeFig. 1). These primers generated bands of 242 and179 bp for Fas and FasTMDel, respectively. Furtherprimers amplified a section of the housekeeping geneâ-actin mRNA, which served as a reference to controlfor differences in cDNA concentration. Sequences wereas follows:Fas3*:TGGAATCATCAAGGAATGCAFas5*:GCCACTGTTTCAGGATTTAAGGâ-act3*:AACGGCTCCGGCATGTâ-act5*:ATCACGCCTGGTGCCT

Both primer pairs annealed at 55)C, allowing thermalcycling to be conducted in the same reaction block.Samples were denatured at 94)C for 150 s and thencycled at 94)C for 30 s, 55)C for 30 s, and 72)C for 30 s.By running identical samples at different cycle numbers,log linear amplification of product could be demon-strated for all calculations. By using sequentially smallerquantities of template, it was possible to produce

identical curves of amplification at the same number ofcycles of amplification.

Quantification of PCR product concentration

The resulting PCR amplimers were visualized on15 per cent arcylamide gel and stained with ethidiumbromide, rendering DNA bands fluorescent under ultra-violet light. The intensity of this fluorescence was quan-tified using a GelDoc 3000 UV camera and computeranalysis software (BioRad, U.K.), with subtraction ofbackground readings.

Quantification of viral RNA in liver

HCV RNA levels in the liver were measured semi-quantitatively by limiting dilution analysis of cDNAreverse-transcribed and amplified from RNA asdescribed previously.20 Amplified DNA was detected by2 per cent agarose gel electrophoresis and ethidiumbromide staining.PCR with nested primers detects single molecules of

target DNA sequence. Tests on multiple replicates at asuitable limiting dilution give a Poisson distributionof positive and negative results that reflects theconcentration of target DNA.20 To obtain an RNAconcentration from quantification of cDNA, we haveassumed an overall efficiency of 5 per cent for the reversetranscription step. Centrifugation of 0·1 ml of seraprovided a level of detection of approximately 400 HCVcopies/ml. To increase the sensitivity of the assay,samples which were negative at this level of detection(<4000 HCV copies/ml) were further analysed bycentrifugation of 0·5 ml of sera, providing a cut-off pointof approximately 800 HCV copies/ml.

Histology of HCV-infected livers

Histological sections were obtained from thesame needle biopsy material which provided RNA

Fig. 1—The full length Fas and the FasTMDel mRNAs (after Cascino et al.16), showing the region amplified by PCR

300 D. A. FERENBACH ET AL.

? 1997 John Wiley & Sons, Ltd. , . 183: 299–304 (1997)

for the PCR analysis. These sections were graded by ahistological scoring system after Ishak et al.21

Statistical analysis

Non-parametric statistical tests were used as appro-priate: Mann–Whitney test and Spearman rank corre-lation. Because of the small number of cases,multivariate analysis was not attempted.

RESULTS

Both Fas and FasTMDel mRNA are expressed in thenormal liverPCR primers were designed flanking the region tran-

scribed from exon 6 of the genomic Fas gene, which isdeleted in FasTMDel. Amplification generates frag-ments differing in size by 63 bp. In all six control livers,

electrophoresis of the RT-PCR products generatedanticipated fragments of 242 and 179 bp for Fas andFasTMDel, respectively (see Fig. 2).

Ratio Fas:FasTMDel is increased in HCV infectionThe ratio Fas:FasTMDel transcript was obtained

from the six normal and 13 HCV-infected liver samples.In the HCV-infected cases, there was an altered ratio(P=0·043, Mann–Whitney) between Fas and FasTMDeltranscripts (Fig. 4). The ratio was calculated at points inthe reaction where PCR amplification of the two tran-scripts was shown to be log linear and to display equalcoefficients (Fig. 3).

Fas mRNA is upregulated; FasTMDel mRNA levels areunchanged in HCV infectionThe observed increase in the Fas:FasTMDel ratio did

not demonstrate whether this change was due to an

Fig. 2—Polyacrylamide gel electrophoresis showing accumulation of PCR product withincreasing number of PCR cycles. Fas (242 bp) and FasTMDel (179 bp) are shown

Fig. 3—Graph of PCR product quantities demonstrating equal reaction coefficients (shown bygradient) with increasing cycle number

301FAS SPLICE VARIANTS IN HEPATITIS C INFECTION


induction of Fas, an inhibition of FasTMDel, or acombination of both processes. To investigate the natureof this alteration, quantitative PCR was undertakenusing â-actin as an endogenous control gene. In sixnormal and seven HCV cases where sufficient mRNAwas available, this was performed. There was an increasein Fas mRNA levels in HCV infection (Fig. 5a)(P=0·018, Mann–Whitney), but FasTMDel mRNAremained unchanged between normal and HCV livers(Fig. 5b).

Fas:FasTMDel ratio correlates with log liver viral load,but not with ALT levels or histological activity scores

Serum alanine aminotransferase levels of the HCVpatients were obtained and examined relative toFas:FasTMDel, with no relationship observed (P>0·2).Similarly, Fas:FasTMDel was plotted against thehistological activity index, but no correlation wasevident (P>0·2). Additionally, the degree of Fas upregu-lation was examined relative to the scored degree ofinflammatory infiltrate present, but no relationship wasfound.Fas:FasTMDel levels were plotted against log intra-

hepatic viral load calculated by RT-PCR and a relation-ship was observed, with greater expression of Fasassociated with higher levels of HCV viral RNA in theliver (Fig. 6, P=0·035, rs=0·62).

DISCUSSION

Both Fas and FasTMDel mRNA are expressed innormal liver. In hepatitis C infection, there is an increase

Fig. 4—The ratio between the abundance of Fas and FasTMDelmRNA transcripts is altered in HCV-infected liver (P=0·043, Mann–Whitney)

Fig. 5—(a) Abundance of the FasTMDel mRNA transcript relative to the â-actintranscript was examined in normal and HCV-infected liver. There was no alteration inexpression between the two groups (P>0·2). (b) Abundance of the Fas mRNAtranscript relative to the â-actin transcript was examined in normal HCV-infectedliver. There was a marked increase in expression in the HCV-infected cases



in the amount of Fas mRNA transcript, whilst FasTM-Del mRNA remains constant. This increase in FasmRNA occurs independently of disease markers suchas the histological activity indices, the degree of lym-phoid infiltration, and the levels of ALT present inserum. An association was noted between increasing Fastranscript expression and the log viral load measured inthe liver.Alteration in Fas-mediated cell killing has been

associated with inappropriate activation of the immunesystem in both mice and humans.8,22 Increased produc-tion of FasTMDel has been shown to protect fromFas-mediated apoptosis in vitro and to result in anSLE-like autoimmunity when introduced as a transgeneto murine models in vivo.15 Furthermore, it has beenreported that FasTMDel is found in increased levels insome patients with SLE,15 potentially antagonizing thedeletion of autoreactive lymphocytes. Modulation ofFasTMDel levels could represent a mechanism formodulating the susceptibility of the liver to the cytotoxiceffects of the immune system. We have demonstratedthat this is not the case in hepatitis C virus-infected liver.The constant FasTMDel levels exhibited here are con-sistent with those observed in peripheral blood mono-nuclear cells (PBMCs) following in vitro upregulation ofFas in response to phytohaemagglutinin-P (PHA-P).17 Itappears that FasTMDel may act as a buffer againstexcessive apoptosis, with modulation of the systemachieved via alteration in Fas. The upregulation of Faswithout accompanying upregulation of FasTMDelmRNA indicates that the generation of full length andTMDel Fas are differentially regulated. If this splicingwas an autocatalytic event, then a constant Fas:FasTM-Del ratio would exist. The data presented here comp-lement previous findings showing increased expressionof membrane-bound Fas protein in the hepatitisC-infected liver,12,23 indicating that alterations inmRNA are translated into upregulation at the proteinlevel.

Why Fas mRNA expression is increased is notknown. Previous studies have found increased levels ofFas protein around areas with lymphocytic infiltra-tion,23,24 suggesting that lymphocytes may stimulate Fasexpression. Fas has been shown in vitro to increase inresponse to viral infection.25 We found no relationshipbetween the degree of inflammation or cell death inhistological sections and upregulation of Fas relative toFasTMDel, but we have shown a correlation betweenFas mRNA and viral load in vivo. Whether this indicatesa specific effect of virus on Fas expression remains to bedetermined by investigating other diseases. HCV maycontribute to a chronic virally infected state and anincreased risk of tumourigenesis by interfering with themechanisms of cell death.

ACKNOWLEDGEMENTS

DAF was a Wellcome Trust Vacation Scholar. Thiswork was supported in part by The Scottish Home andHealth Department.

REFERENCES

1. Trauth BC, Klas C, Peters AMJ, et al. Monoclonal antibody-mediatedtumor regression by induction of apoptosis. Science 1989; 245: 301–305.

2. Yonehara S, Ishii A, Yonehara M. A cell-killing monoclonal antibody(anti-Fas) to a cell surface antigen co-downregulated with the receptor oftumour necrosis factor. J Exp Med 1989; 169: 1747–1750.

3. Lichter P, Walczak H, Weitz S, Behrmann I, Krammer PH. The humanAPO-1 antigen maps to 10q23, a region that is syntenic with mousechromosome 19. Genomics 1992; 14: 179.

4. Dhein J, Daniel PT, Trauth BC, Oehm A, Moeller P, Krammer PH.Induction of apoptosis by monoclonal antibody anti-APO-1 class switchvariants is dependent on cross-linking of APO-1 cell surface antigens.J Immunol 1992; 24: 753.

5. Boldin MP, Goncharov TM, Goltsev, YV, Wallach D. Involvement ofMACH, a novel MORTI/FADD-interacting protease, in Fas/APO-1- andTNF receptor-induced cell death. Cell 1996; 85: 803–815.

6. Muzio M, Chinnaiyan AM, Kischkel FC, et al. FLICE, novel FADD-homologous ICE/CED-3-like protease, is recruited to the CD95 (Fas/APO-1) death-inducing signalling complex. Cell 1996; 85: 817–827.

7. Krammer PH, Dhein J, Walczak H, et al. The role of APO-1 mediatedapoptosis in the immune system. Immunol Rev 1994; 142: 175–191.

8. Fisher GH, Rosenberg FJ, Straus SE, et al. Dominant interfering Fas genemutations impair apoptosis in a human autoimmune lymphoproliferativesyndrome. Cell 1995; 81: 935–946.

9. Kagi D, Seiler P, Pavlovic J, et al. The roles of perforin- and Fas-dependentcytotoxicity in protection against cytopathic and noncytopathic viruses. EurJ Immunol 1995; 25: 3256–3262.

10. Kagi D, Vignaux F, Ledermann B, et al. Fas and perforin pathways asmajor mechanisms of T cell-mediated cytotoxicity. Science 1994; 265:528–530.

11. Ogasawara J, Watanabe-Fukanaga R, Adachi M, et al. Lethal effect of theanti-Fas antibody in mice. Nature 1993; 364: 806–809.

12. Galle PR, Hofmann WJ, Walczak H, et al. Involvement of the CD95(APO-1/Fas) receptor and ligand in liver damage. J Exp Med 1995; 182:1223–1230.

13. Adachi M, Watanabe-Fukunaga R, Nagata S. Aberrant transcriptioncaused by the insertion of an early transposable element in an intron of theFas antigen gene of 1 pr mice. Proc Natl Acad Sci USA 1993; 90: 1756–1760.

14. Mita E, Hayashi N, Iio S, et al. Role of Fas ligand in apoptosis induced byhepatitis C virus infection. Biochem Biophys Res Commun 1994; 204:468–474.

15. Cheng J, Zhou T, Liu C, et al. Protection from Fas-mediated apoptosis bya soluble form of the Fas molecule. Science 1994; 263: 1759–1762.

16. Cascino I, Fiucci G, Papoff G, Ruberti G. Three functional soluble forms ofthe human apoptosis-inducing Fas molecule are produced by alternativesplicing. J Immunol 1995; 154: 2706–2713.

17. Liu C, Cheng J, Mountz JD. Differential expression of human Fas mRNAspecies upon peripheral blood mononuclear cell activation. Biochem J 1995;310: 957–963.

18. Tokano Y, Miyake S, Kayagaki N, et al. Soluble Fas molecule in the serumof patients with systemic lupus erythematosus. J Clin Immunol 1996; 16:261–265.

Fig. 6—Relationship between increase in log viral load and FasmRNA in the HCV-infected liver (P=0·035, rs=0·62)

303FAS SPLICE VARIANTS IN HEPATITIS C INFECTION


19. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acidguanidinium thiocyanate–phenol–chloroform extraction. Anal Biochem1987; 162: 156–159.

20. Simmonds P, Balfe P, Peutherer JF, Ludlam CA, Bishop JO, Leigh-BrownAJ. Human immunodeficiency virus-infected individuals contain provirus insmall numbers of peripheral mononuclear cells and at low copy numbers.J Virol 1990; 64: 864–872.

21. Ishak K, Baptista A, Bianchi L, et al. Histological grading and staging ofchronic hepatitis. J Hepatol 1995; 22: 696–699.

22. Ju S-T, Panka DJ, Cui H, et al. Fas(CD95)/FasL interactions required forprogrammed cell death after T cell activation. Nature 1995; 373: 444–448.

23. Hiramatsu N, Hayashi N, Katayama K, et al. Immunohistochemicaldetection of Fas antigen in liver tissue of patients with chronic hepatitis C.Hepatology 1994; 19: 1354–1359.

24. Mochizuki K, Hayashi N, Hiramatsu N, et al. Fas antigen expression inliver tissues of patients with chronic hepatitis B. J Hepatol 1996; 24: 1–7.

25. Hiromatsu K, Aoki Y, Makino M, et al. Increased Fas antigen expression inmurine retrovirus-induced immunodeficiency syndrome, MAIDS. Eur JImmunol 1994; 24: 2446–2451.



alteration in mrna levels of fas splice variants in hepatitis c-infected liver

Documents