All genes available for an organism to use -- a

very important tool for biologists

ليتوافر كل جينات الكائن الحي لإلستخدام بواسطة علماء األحياء

Not just sequence of genes, but also positioning

of genes and sequences of regulatory regions

تسلسل الحمض النووي يعني تحديد مواقع الجينات وتسلسل مواقع التنظيم

New recombinant DNA constructs must be

sequenced to verify construction or positions of

mutations

بناء الحمض النووي المؤتلف لتحقيق البناء أو تموضع الطفرات

Nitrogenous Bases القواعد النيتروجينية

Nucleosides النيكليوتيدات

Base linked to a 2-deoxy-D-ribose at 1’ carbon

1إرتباط القاعدة النيتروجينة مع السكر عند ذرة الكربون’

• Nucleosides with a phosphate at 5’ carbon

5-إرتباط النيكليوسايد مع الفوسفات عند ذرة الكربون •

Determining the Sequence of DNA تحديد تسلسل الحمض النووي

• Methods:

:الطرق •

Chain termination or dideoxy method

ديوكسي-فك إرتباط السلسلة أو دي. 1

– F. Sanger

سانقر –

Shotgun sequence method

طريقة التسلسل القسري

2nd generation sequence methods

(بايرو التسلسل)طرق الجيل الثاني

– Pyrosequencing

(Sanger) Method طريقة سانقر

• 4 Steps:

أربع خطوات •

Denaturation

المسخ

Primer attachment and extension of bases

لصق البادئات وتوسيع القواعد

Termination

اإلنتهاء

Gel electrophoresis

هالم الرحالن الكهربي

for dideoxy sequencing you need: :اإلحتياجات -

Single stranded DNA template

خيط مفرد من الحمض النووي كقالب

A primer for DNA synthesis

بادئة لتخليق الحمض النووي

DNA polymerase

إنزيم بولي ميريز الحمض النووي

Deoxynucleoside triphosphates and

dideoxynucleotide triphosphates

دينيكليوتايد ثالثي الفوسفتيز-ديوكسي نيكايوتايد ثالثي الفوسفتيز ودي

Oligonucleotide primers can be synthesized by phosphoramidite chemistry--usually designed manually and then purchased

نيكليوتايد أحادي، عادة يتم تصميمها يدويا ومن ثم شراؤها

Sequence of the oligo must be complimentary to DNA flanking sequenced region

يجب أن يكون تسلسل األحادي مكمال ألجنحة الحمض النووي في منطقة التسلسل

Oligos are usually 15-30 nucleotides in length

نيكليوتيدة في طولها 30-15األحاديات تكون دائما

Single stranded DNA isolated from

recombinant M13 bacteriophage containing

DNA of interest

يعزل الخيط األحادي للحمض النووي من البكتريا التي تحوي الحمض

النووي تحت الدراسة

Double-stranded DNA that has been

denatured

خيط مزدوج من الحمض النووي الممسوخ

Non-denatured double stranded DNA (cycle

sequencing)

خيط مزدوج من الحمض النووي غير الممسوخ

Should be highly processive, and incorporate ddNTPs efficiently

يجب أن يكون عالي المعالجة له القدرة على دمج اإلنزيم بكفاءة عالية

Should lack exonuclease activity

يفتقد للنشاط خارج النواة

Thermostability required for “cycle sequencing”

مستقر حراريا، مطلوبة لدورات التسلسل

(Sanger) Method مختصر طريقة سانقر

(Sanger) Method مختصر طريقة سانقر

• Run four separate reactions each with different ddNTPs

إجراء أربع تفاعالت •

مختلفة• Run on a gel in four separate lanes

إجراء اإلختبار على •

الهالم• Read the gel from the bottom up

قراءة الهالم من أسفل •

الى أعلي

The dideoxy method is good only for 500-750bp reactions

زوج 750-500تعتبر هذه الطريقة مثالية فقط للتفاعالت من

قواعد نيتروجينة

Expensive

مكلفة

Takes a while

تأخذ الكثير من الوقت

The human genome is about 3 billion bp

بليون زوج قاعدة 3)ال يمكن إستخدامها في الجينوم البشري

نيتروجينة

Began in 1990

1990بدأ في العام

Why?

األسباب

Human evolution

التطور البشري

Nature versus nurture

الطبيعة مقابل التغذية

Causes of disease

مسببات األمراض

Used to sequence whole genomes

يستخدم لتسلسل كل الجينوم

Steps:

الخطوات

DNA is broken up randomly into smaller fragments

كسر الحمض النووي عشوائيا

ألجزاء صغيرة

Dideoxy method produces reads

تطبيق طريقة سانقر

Look for overlap of reads

تحديد التداخالت

Strand Sequence

First Shotgun Sequence AGCATGCTGCAGTCATGCT-------

-------------------TAGGCTA

Second Shotgun Sequence AGCATG--------------------

------CTGCAGTCATGCTTAGGCTA

Reconstruction AGCATGCTGCAGTCATGCTTAGGCTA

Sequencing by synthesis

التسلسل بالتخليق

Advantages:

المزايا:

Accurate

دقيق

Parallel processing

معالجة متوازية

Easily automated

سهولة في عمله آليا

Eliminates the need for labeled primers and nucleotides

ال يحتاج الى بادئات معرفة ونيكليوتيدات

No need for gel electrophoresis

ال يحتاج لهالم الرحالن الكهربي

Basic idea:

الفكرة األساسية

Visible light is generated and is proportional to the number of incorporated nucleotides

تسليط إضاءة مرئية تتناسب مع عدد النيكليوتيدات المدرجة

1pmol DNA = 6*1011 ATP = 6*109 photons at 560nm

Smaller sequences

تسلسالت صغيرة

Nonlinear light response after more than 5-6 identical nucleotides

نيكليوتيدات متماثلة 6-5عدم وجود رد فعل للضوء بعد