alk gene products in anaplastic large cell lymphomas and hodgkin's

RAPID COMMUNICATION

ALK Gene Products in Anaplastic Large Cell Lymphomas and Hodgkin's Disease

By Hermann Herbst, Joannis Anagnostopoulos, Barbara Heinze, Horst Durkop, Michael Hummel, and Harald Stein

The translocation t(2;5)(p23;q35), discovered in CD30' anaplastic large cell (ALC) lymphomas, creates a potentially oncogenic fusion gene, part of which is contributed by a novel tyrosine kinase, ALK. Absence of ALK expression from normal hematolymphoid cells provides a basis for the morphologic assessment of t(2;5). The distribution of the t(2;5) in ALC lymphomas and Hodgkin's disease (HD), as assayed by nonmorphologic methods, is controversial. We used in situ hybridization andlor immunohistology to show ALK gene products in 85 ALC lymphomas, 82 HD cases, 40 other lym- phoproliferations, as well as in 6 HD- and 4 ALC lymphoma- derived cell lines. ALK gene products were restricted to t(2;5)-positive ALC lymphoma cell lines and tumor cells of

D30' ANAPLASTIC large cell (ALC) lymphomas represent a recently recognized entity of high-grade non-

Hodgkin's lymphomas (NHL), arising as primary lymphonodal and extranodal neoplasms or secondary to non-ALC NHL and Hodgkin's disease (HD).'-4 In their most prototypic form ("common" type), ALC lymphomas are characterized by CD30+ tumor cells with abundant cytoplasm, large irregu- lar nuclei, and prominent, sometimes rod-shaped, nucleoli.',2 In cases with lymphonodal involvement, these tumor cells typically grow in coherent sheets with a sinusoidal dissemination, initial infiltration of the parafollicular areas, and spar- ing of germinal centers.',' Although displaying distinct morphologic features, ALC lymphomas share a number of properties with HD, such as cytomorphologic similarities with Hodgkin and Reed-Stemberg (H-RS) cells, the constitutive expression of activation markers, most notably the CD30 antigen, a bimodal age distribution in primary disease, and the association with Epstein-Barr virus in a proportion of

In some ALC lymphomas additional features of HD may be present such as fibrosis, capsule thickening, CD15 expression by tumor cells, and a variably heteroge- neous reactive cellular admixture. These cases, many of which may previously have been diagnosed as lymphocyte- depleted HD, are now classified as HD-related or HD-like ALC l y m p h ~ m a . ~ , ~

Because of this heterogeneity among ALC lymphomas

C

From Konsultations-und Referenuentrum fur Lymphknoten-und Hamatopathologie am Institut f i r Pathologie, Klinikum Benjamin Franklin, Freie Universitat Berlin, Berlin, Germany.

Submitted May 25, 1995; accepted June 13, 1995. Supported by Deutsche Krebshilfe, Mildred-Scheel-Stifung

(Grant No. W81/92/Hel). Address reprint requests to Hermann Herbst, MD, Institute of

Pathology, Klinikum Benjamin Franklin, Hindenburgdamm 30, 12000 Berlin, Germany.

The publication costs of this article were defrayed in pari by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. section 1734 solely to indicate this fact

Q 1995 by The American Society of Hematology. 0006-4971/95/8605-0052$3.00/0

1694

16 primary non-B cell, common-type ALC lymphomas. These were mainly from young patients with initial lymphonodal disease. ALK expression was not detectable in any other specimen, including all cases of HD and HD-like type ALC lymphoma as well as secondary ALC lymphomas. Full congruence was noted for labeling results obtained with both methods. In agreement with cytogenetic analyses, but at variance with recently published studies, ALK gene expression distinguishes a subset of ALC lymphomas from other CD30+ lymphomas, including HD. The results do not support concepts attributing a significant role to the t(2;5) in the development of HD. Q 1% by The American Society of tfematology.

and the diagnostic dilemma of distinguishing between such lymphomas and tumor cell-rich HD, the observation of a characteristic reciprocal translocation involving chromosomes 2 and 5 , t(2;5)(p23;q35), in ALC lymphomas has attracted By cytogenetic analysis, the t(2;S) seemed to be unique to ALC lymphoma associated with a non-B cell phenotype and genotype6"' and it was not found in any of over 100 cytogenetically analyzed HD cases.'"" However, because of the technical difficulty of reliably assigning abnormal karyotypes to H-RS cells, it is conceivable that this translocation may have been missed in HD. Thus, many questions relating to the clinical and bio- logic significance of the t(2;5) and their distribution among CD30+ lymphomas remained open.

Now, these issues may be addressed by molecular method- ology after cloning of the t(2; 5 ) breakpoint regions has been achieved.14 The chromosomal disruptions were found to oc- cur each within the introns of two unique loci. The gene at region 5q35 was identified as nucleophosmin (NPM), a cell- cycle regulated and ubiquitously expressed nucleolar phosphoprotein involved in shuttling ribosomal components between the nucleolus and the cytoplams. The downstream sequences of the t(2; 5)-fusion gene product are derived from a novel tyrosine kinase gene with similarity to receptor pro- teins such as the insulin re~eptor . '~ Physiologically, this novel gene, designated ALK (anaplastic lymphoma kinase), is expressed in brain, gut, testis, and rhabdomyosarcoma cell lines, but not in hematolymphoid cells.I4 Expression of ALK sequences in lymphoid lesions seems to be restricted to cells carrying the t(2;5) or other aberrations involving chromosomal region 2p23 and may therefore serve as a phenotypic tumor marker. In the t(2;5), expression of the fusion gene is controlled by the NPM promoter, resulting in cell-cycle- dependent expression of a truncated, constitutively activated, putatively oncogenic ALK k i n a ~ e . ' ~ ~ ' ~

Because of the variable intronic localization of the breakpoints on both chromosomes, the t(2;5) cannot be con- veniently shown by polymerase chain reaction (PCR) at the genomic level. Both t(2;5) breakpoint junctions are spliced out during RNA transcript processing, giving rise to a fusion mRNA with invariant breakpoint junctions corresponding to

Blood, Vol 86, No 5 (September l) , 1995: pp 1694-1700

For personal use only.on April 4, 2019. by guest www.bloodjournal.orgFrom

http://www.bloodjournal.org/

http://www.bloodjournal.org/site/subscriptions/ToS.xhtml

ALK GENE PRODUCTS 1695

Table 1. Summary of In Siu Hybridization and Immunohistology Results

Histology ISH IH Total ~ ~~~

ALCL, B-phenotype 011 9 011 9 ALCL, T-phenotype 2/32 6n" 6/35 (17%) ALCL, "Null"-phenotype 8/30 9/12' 10131 (32%) ALCL, total 10181 15/19' 16/85 (19%) HDlp 014 on 0/9 HDns 0132 0128 0132 HDmc 0140 0136 0140 HDld 01 1 011 HD, total Off 7 on1 0182 T-NHL 011 4 011 4 B-NHL 011 6 011 6 Tonsil, FHIEH 016 016 Tonsil, IM 014 012 014

Abbreviations: ISH, in situ hybridization; IH, immunohistology; ALCL, CD30'anaplastic large cell lymphoma; Ip, lymphocyte predominance; ns, nodular sclerosis; mc, mixed cellularity; Id, lymphocyte depletion; FHIEH, follicular/extrafollicular hyperplasia; IM, infectious mononucleosis.

* Selected cases, largely overlapping with cases studied by in situ hybridization.

exonic b~undaries. '~ Detection of NPM rearrangements by Southern blot hybridization and reverse transcription followed by PCR (RT-PCR) of NPM-ALK transcripts have al- ready been applied to a limited number of ALC lymphomas and HD cases with contradictory result^.'^*'"*^ HD patients may be prone to chromosomal instability, and it is therefore conceivable that the detection of NPM-ALK transcripts in HD biopsy samples may reflect translocations occurring out- side the tumor cell population. These uncertainties and the lack of morphologic information prompted us to address the question as to the cellular localization of ALK gene transcripts in ALC lymphoma and HD biopsy specimens.

Because of the absence of ALK expression in normal hematolymphoid cells,I4 the t(2; 5) lends itself to the application of morphologic techniques even on archival materials by detection of ALK gene products in situ. We used ALK RNA probes for in situ hybridization on t(2; 5)-positive cell lines, HD-derived cell lines, 82 HD cases, and 85 ALC lymphomas representing different histologic types and immunopheno- types. Controls consisted of non-ALC high-grade NHL with variable, but usually small, numbers of CD30+ cells as well as lymphoid tissue with reactive lesions. Additionally, detection of ALK protein was achieved by immunohistology with an antibody specific for the ALK kinase domain as present in the p80 NPM-ALK chimaeric fusion protein."

MATERIALS AND METHODS

Tissues. Paraffin-embedded tissue blocks representing 207 cases of ALC lymphoma, HD, NHL, and nonmalignant lesions (Table 1) were drawn from the files of the Institute of Pathology at the Klini- kum Benjamin Franklin, Free University Berlin. Tissues were fixed with neutral-buffered formalin, and embedded in paraffin by routine procedures. Paraffin blocks of 14 human T-lymphotropic virus-I (HTLV-I)-associated adult T-cell lymphomas (ATL) were a kind gift of Dr A. Micata (Chiba, Japan). 5 pm sections were cut onto

3-aminopropyltriethoxysilane (APES)-treated slides for immunohis- tologic staining and in situ hybridization.

Cell lines. The HD-derived cell lines L428, L540, and L5912' were obtained from Dr V. Diehl (Cologne, Germany). CO and HoZZ were kindly provided by Dr D.B. Jones (Southampton, UK), and K " H P 3 was a gift from Dr H. Kamesaki (Kyoto, Japan). The t(2;5)-bearing cell lines Karpas 299" and JB6= were kindly provided by Drs A. Karpas (Cambridge, UK) and M. Kadin (Boston, MA), respectively. The cell line DEL,*' donated by Dr J. Delabie (Leuven, Belgium), contains a cytogenetically evident t(5;6) translocation, which on molecular analysis proved to be a cryptic t(2;5).I6 SU- DHL-1, also a t(2;5)-positive cell line," was obtained from Dr R. Warnke (Stanford, CA). Cells were grown in RPM1 1640 medium supplemented with 10% fetal calf serum and antibiotics. For immunohistology and in situ hybridization, cells were transferred to APES- treated slides by cytocentrifugation.

RT-PCR and generation of in situ hybridization probes. Total RNA was extracted from cell lines, digested with DNase I, and transcribed to cDNA using random hexamere primers and reverse transcriptase from Moloney murine leukemia virus (Perkin-Elmer Cetus, Weiterstadt, Germany). In brief, 1 pg of total cellular RNA was incubated for 25 minutes at 42°C with 50 U of reverse transcriptase and 20 U placental RNase inhibitor in a 20-pL v01 containing 2.5 pmoVL random primers, 5 mmoW MgC12, 50 mmoVL KCl, 10 mmoVL Tris-HCI, and 1 mmoVL each of deoxynucleoside- triphosphates, heated to 99°C and subsequently cooled at 5°C for 5 minutes each. Oligonucleotide primers corresponding to po- sitions 566 through 585 (primer l , 5"AGGTGTATGAAG- GCCAGGTG-3') and 1004 through 1023 (primer 2, 5"GCTC- GCCCTGTAGATGTCTC) as well as 934 through 953 (primer 3,

(primer 4, 5'-GCCTGlTGAGAGACCAGGAG) of the published ALK sequence14 were synthesized. Primer pairs 112 and 3/4 were used to obtain PCR amplification products of 457 bp and 535 bp, respectively. The PCR reaction mixture consisted of 1.5 mmoVL MgCI2, 50 mmoVL KCl, 10 mmoVL TFUS-HCI, each 0.2 pmoVL of both primers, 2.5 U of Taq DNA polymerase (Perkin-Elmer Cetus) in a 0.1-mL v01 containing 20 pL of the above-mentioned RT reaction mixture. Reaction conditions were each l minute at 96°C and 6WC, and 2 minutes at 72°C for 30 cycles followed by a final extension for 10 minutes at 72°C. For control, a 289-bp product corresponding to sequences of the P-actin genez8 was amplified from cDNA after RT. The P-actin primer sequences were 5"CGGAAC-

plification was performed with 30 cycles at 95'C and 54°C for each 1 minute and 72°C for 2 minutes followed by a final extension for 10 minutes at 72°C. Amplification products from the cell line SU- DHL-1 were cloned into the run-off transcription vector pAMPl (GIBCO-BRL, Eggenstein, Germany) and subjected to automated nucleotide sequence determination. The sequences were found to conform to the published ALK sequence.I4

In situ hybridization. In situ hybridization was performed as previously described.29 After linearization of the pAMPl constructs with appropriate restriction enzymes, antisense and sense (control) RNA probes were generated by run-off transcription with incorpora- tion of [35S]-labeled nucleotides yielding an average specificity of 1.3 X IO9 cpdpg . Both ALK RNA probes were applied independently as well as in combination to achieve maximum sensitivity in extended exposure experiments. EBERI- and EBER2-specific pBluescript- based vectors, kindly provided by Dr G. Niedobitek (Birmingham, UK), prepared from plasmids pJJJl and pJJJ2, were used as described.29

Immunohistology. Immunhistologic detection of p80 was performed using an affinity-purified rabbit antibody directed at the sequence SNQEVLEFVTSGGR corresponding to the putative ALK

5"GCCAGAAACTGCCTCTTGAC) and 1450 through 1469

CGCTCAlTGCC and 5"ACCCACACTGTGCCCATCTA and am-




1696

Fig 1. Amplification of ALKcDNA sequences by PCR subsequent to RT of total cellular RNA. Amplification products of 535 bp (top) and 457 bp (middle) representing ALKsequences were obtained only from t(2;5)-bearing cell lines SU-DHL-1, DEL, JB6, and Karpas 299 (lanes 2 through 5). but not from HD-derived cell lines Lao, E91, CO, Ho, and KM-H2 (lanes 6 through 10). Amplification products of 289 bp representing a p-actin sequence (bottom) were obtained with total cellular RNA prepared from all of the cell lines, indicating the presence of sufficient RNA in HD-derived cell line extracts.

kinase domain.” The antibody was kindly made available to us before commercial distribution by Nichirei CO (Tokyo, Japan), through Dm M. Shiota and S . Mori (Tokyo, Japan), and applied in a 150 dilution to deparaffinized sections that were previously subjected to high-pressure cooking for antigen retrieval. Normal rabbit serum served as control. Immobilized rabbit antibody was detected with affinity-purified mouse-antirabbit biotinylated antibodies, strep- tavidin-conjugated peroxidase, and 3.3‘-diaminobenzidine tetrahy- drochloride as chromogen. Immunophenotypic analysis of lymphoid lesions was routinely performed using the alkaline phosphataselanti- alkaline phosphatase (APAAP) technique with the monoclonal antibodies Ber-H2 (CD30). L26 (CD20), C3Dl (CD15). PG-MI (CD68). PFI (specific for the T-cell antigen receptor 8-chain), CS1.4 (de- tecting the Epstein-Barr virus latent membrane protein-l, LMPI), and a rabbit-antibody against the CD3 antigen. With the exception of PFI, which was from T-cell Sciences (Cambridge, MA), all primary antibodies as well as secondary reagents and chromogens were pur- chased from DAKO (Glostrup, Denmark).

RESULTS

Cell lines. PCR amplification of cDNA obtained from all four t(2;5)-bearing cell lines, JB6, DEL, SU-DHL-l, and Karpas 299, with primer pairs 1/2 and 3/4 resulted in products of 457 bp and 535 bp, respectively (Fig 1). No PCR products were amplifiable from the HD-derived cell lines L540, L591, Ho, CO, and KM-H2 with these sets of primers,

HERBST ET AL

whereas control RT-PCR reactions for the RT of actin mRNA and amplification of cDNA sequences displayed the presence of sufficient amounts of RNA. In situ hybridization showed positive signals only in cytocentrifuge preparations from the t(2;5)-canying cell lines with both independently applied RNA antisense probes, whereas sense-probes on t(2;5)-positive cell lines resulted in background signal. No specific in situ hybridization signal was obtained with any of the HD-derived cell lines, L428, L540, K591, CO, Ho, and KM-H2 (Fig 2).

CD30’ ALC lymphomas. A total of 85 ALC lymphomas was tested by in situ hybridization using ALK-specific RNA probes (81 cases) and/or p80-specific immunohistology (19 cases). Ten cases displayed clear in situ hybridization signals exclusively over tumor cells (Table 1, Figs 2 and 3). Both ALK antisense probes produced signals of similar intensity. Sense control RNA hybridizations resulted in background signal. Because of the limited amount of p80-specific antibody available, only a small number of selected ALC lymphomas could be tested by immunohistology. Reactivity with the p80-specific antibody was entirely restricted to ALC lymphoma cells in 15 cases (Fig 3). Nine of these cases were ALC lymphomas previously found to express ALK RNA transcripts, thus providing additional validation of the in situ hybridization results. The other 10 cases displayed common- type morphology. They were studied only by immunohistology because only few paraffin sections were available.

All of the ALK-positive ALC lymphomas were of non-B phenotype, morphologically conforming to the common type of ALC lymphomas. The median patient age was 24 years, with a range from 8 to 52 years. Fourteen of 16 ALK-positive ALC lymphomas were primary nodal neoplasias; only 2 cases represented primary extranodal disease in sceletal mus- cle and parotid gland, respectively. Among common-type ALC lymphomas, ALK-positive tumors represented a proportion of approximately one third of our cases. The histologic, phenotypic, and topographic characteristics of the ALC lymphomas of the present series are listed in Table 2. All ALC lymphomas of HD-like or lymphohistiocytic type, and those known to have developed secondary to HD or non-ALC NHL, did not display ALK expression. Interest- ingly, ALK-positive ALC lymphomas proved to be morphologically indistinguishable from ALK-negative T-/“Null” -cell ALC lymphomas of common-type histology, but the latter cases were often from patients with advanced age (median 36 years, range 11 to 80 years).

HD. A total of 82 HD biopsy samples was studied for the presence of ALK gene products. In situ hybridization was performed on 77 cases with both independently applied ALK RNA probes. Seventy-one HD cases, 66 of which had also been tested by in situ hybridization, were stained with the p80-specific antibody. Neither in situ hybridization nor immunohistology provided evidence for the presence of ALK or NPM-ALK gene products in any of the HD cases, even when both of the ALK RNA probes were used in combination with autoradiographic exposure times up to 12 weeks. The HD biopsy samples represented all four histologic types recognized by the Rye classification and comprised cases with B-, T-, or “Null”-cell phenotype (14, 11, and 57 cases,





. ~ . . ,. .

F

T p . .-

Fig 2. In situ hybridization for the demonstration of ALKRNA transcripts in cases of ALC lymphomas and cell lines. (A and B) ALC lymphoma of common type hybridized with the [)sSl-labeled 535-bp ALK single-stranded antisense (A) and sense control (B) RNA probes. (C) Another ALC lymphoma displaying characteristic sinusoidal tumor cell dissemination (457-bp antisense ALK probe). (D and E) In situ hybridization of SU-DHL-1 and L428 (F and G ) cells with antisense (D through F) and sense (E through G ) 535-bp ALK RNA probes. Specific labeling is displayed only by the tl2;5)-bearing SU-DHL-1 cells with antisense probe. Autoradiographic exposure times 20 days (A through C), 12 days (D through G). Original magnification x 100.

respectively), and cases with or without Epstein-Barr virus Controls. Sixteen B-NHL and 14 T-NHL with varying, infection of tumor cells (33 and 49 cases, respectively) as but usually small, proportions of CD30' tumor cells were evidenced by LMP1-specific staining and/or in situ hybrid- investigated by in situ hybridization. Four of the B-NHL ization for EBER expression. were related to human immunodeficiency virus infection,




1698 HERBST ET AL

and all T-NIU were related to HTLV-I infection. Six tonsils with moderate follicular andor extrafollicular hyperplasia as well as four tonsils from patients with clinically established infectious mononucleosis were tested by in situ hybridization. Two infectious mononucleosis tonsils were additionally studied by immunohistology with the p80-specific antibody. All of these control tissues did not provide any evidence of ALK or NPM-AM gene expression (Table 1).

DISCUSSION

The reciprocal translocation, t(2;5)(p23;q35), results in fusion of the NPM and ALK genes with the subsequent expression of chimaeric NPM-ALK RNA and ~r0tein.l~ Be- cause of the absence of ALK gene expression in hematolymphoid cells, detection of RNA and protein derived from the 3' portion of the ALK gene is indicative of the t(2;5)14 or other aberrations resulting in activation of the ALK gene. We have studied the expression of ALK RNA in 85 ALC lymphomas, 82 HD cases, as well as 30 high-grade non- ALC NHL and 10 nonmalignant lymphoid lesions by in situ hybridization using [35S]-labeled single-stranded RNA

Fig 3. Systemic T-/"Null"-call ALC lymphomas of common type: ( A I Largely cytoplwmatic staining for p80 NPM-ALK protein restricted to tumor cdls (avidin-biotin peroxidase method, original magnification x 100). (B) Detection of Al.K-specific trandpts by in s h hybridization with the 535-bp antisense RNA in probe in ALC lymphoma cells (autoradiographic exposure time 22 days, original magnification x 100).

Table 2. N k Expression in ALC Lymphomas

Lymphoma Typea ALP CaseslCases

Studied ~~ ~ ~~~ ~ ~~ ~

Primary T-/Null-cell ALC lymphoma, common type 16/48 (33%) Systemic 16/42 Cutaneous 0/6

Primary T-/Null-cell ALC lymphoma, HD-like type OB Primary T-/Nulltell ALC lymphoma,

lymphohistiocytic type 0/1 Secondary T-/Null-cell ALC lymphoma OB

Secondary to cutaneous non-ALC lymphomas 012 Secondary to systemic non-ALC lymphoma 0/4 Secondary to HD OB

Primary B-cell ALC lymphoma 0/11 Secondary B-cell ALC lymphoma 018

* Categories according to the Revised European-American Lymphoma (REAL) classification4 for T-/Null-cell ALC lymphoma. B- cell ALC lymphoma is recognized by the updated Kiel-classification as an established entity: whereas it is recognized by the REAL classification as a variant of diffuse large B-cell lymphoma.

probes specific for 3' ALK sequences. We used an isotopic in situ hybridization procedure for these studies with extended autoradiographic exposure times to achieve a maximum of sensitivity for the detection of even low transcript copy numbers. Corroborating evidence for the specificity of the p b e s came from analysis of t(2;5)-bearing cell lines, all of which displayed ALK RNA expression, and sequence determination of both probes. Additional validation of our in situ hybridization was provided by immunostaining results obtained with an antibody specific for epitopes in the ALK kinase domain, showing full congruence of labeling results independently obtained with both methods. This antibody was previously shown to precipitate the p80 NPM-ALK protein and to react exclusively with cell lines and Au3 lymphomas harboring hPM-ALK chimaeric mRNA tra"~ripts.'~*''

Expression of ALK gene products was restricted to primary non-B cell ALC lymphomas of predominantly young patients. These cases showed the morphology of common- type ALC lymphoma, and most of them represented primary lymphonodal disease. However, primary extranodal tumors were also found among ALK-positive ALC lymphomas. All cases of secondary ALC lymphomas, HD-like ALC lymphomas, and ALC lymphomas of B-cell phenotype did not display expression of ALK gene products. ALK-negative and -positive ALC lymphomas of common type were morphologically indistinguishable. Judging from cytogenetically analyzed cases, ALK-positive, ie, t(2;5)-bearing cases, are likely to represent a clinically distinct group of ALC lymphomas with good response to chemotherapy."'o Thus, ALK expression seems to characterize a distinct subset of ALC lymphomas and may warrant its recognition as a separate group among ALC lymphomas. In consequence, determination of ALK expression may prove useful in the diagnostic evaluation of ALC lymphomas.

In agreement with cytogenetic dat.a,'"'3.30 all of our HD cases as well as HD-like types of ALC lymphomas did not express ALX gene products coded for by the 3' portion of the gene at levels detectable by our in situ hybridization





procedure. The HD cases comprised all histologic types as well as cases of B-, T- and “Null”-cell phenotype and also included Epstein-Barr virus-positive and -negative cases. Case number and intrinsic variability of the present HD series seem to rule out inadvertent exclusion of a putative t(2;5)-positive subgroup of HD that, in analogy to ALC lymphomas, eg, may have comprised cases with T-phenotype in young patients.

The distribution of the t(2;5) is controversial. Recently published studies cover a limited number of ALC lymphomas and HD cases subjected to molecular t(2;5) analy-

found NPM gene rearrangements in one ALC lymphoma of B-cell phenotype and in two HD cases, one of which was of lymphocyte predominance histotype (HDlp). This is in- teresting because this histotype of HD differs from classical HD in many aspects and is now considered to represent a B-lymphoid disorder distinct from the other types of HD? However, it is possible that the NPM gene rearrangements in these cases were not caused by the t(2;5), but reflected other aberrations not involving the ALK gene. This interpretation is supported by the previous observation of one HD case with aberrations within the 5q35.30 More controversial are the data showing presence or absence of NPM-ALK chim- eric RNA by RT followed by PCR (RT-PCR) in HD. Lada- nyi et a l l s did not observe such transcripts in any of 40 HD cases. At variance with these and our data, Orscheschek et a l l 9 found NPM-ALK transcripts in 11 of 13 HD cases. Unfortunately, phenotypic and other characteristics of the NPM-ALK-positive HD cases were not reported in the latter study, so the reason for the discrepancies are not clear. At balance, however, current evidence suggests that transcripts representing part of the ALK gene are found, if at all, in only occasional cases of HD.

Therefore, the t(2;5) is unlikely to be the oncogenic princi- ple common to the broad spectrum of CD30+ lymphomas. The molecular pathogenesis of typical HD and ALK-expressing common-type ALC lymphoma seems to be distinct, de- spite the numerous cytomorphologic and immunophenotypic parallels documenting the close relationship between these entities. The NPM-ALK product p80 apparently interferes at a pivotal point with intracellular signal transduction pathways generating an activated CD30+ phenotype. In this cellular context CD30 expression may be secondary and paracrine stimulatory effects such as CD30KD30-ligand interaction may not be required for cellular growth. In typical HD, on the other hand, paracrine mechanisms between CD30 and other growth factor receptors and their ligands seem to be relevant to maintain H-RS cells in an activated state. This interpretation is in keeping with the previously noted stimulatory effects of CD30-ligand for HD-derived cell lines, but of inhibitory effects for ALC lymphoma celk3’ Differ- ences between typical HD and common-type ALC lymphomas are also reflected by their growth patterns in lymphore- ticular tissue. Before destroying the tissue by direct tumor growth, primary ALC lymphomas infiltrate lymph nodes in a pattern simulating the distribution of CD30+ antigen-activated extrafollicular blasts. In contrast, typical HD lesions are not the result of direct, destructive H-RS cell growth but

sis.14,16-19 At variance with our present data, Bullrich et a l l 6

rather due to architectural reorganization likely to be caused by abnormal cytokine secretion.’ Further analysis of the NPM-ALK fusion protein and its substrates may be expected to shed light on intracellular signal transduction pathways leading to the CD30+ activated phenotype. Although present in only a subgroup of ALC lymphomas and obviously irrele- vant for the majority of HD cases, the t(2;5) aberration and the resulting p80 phosphoprotein may hold the key to a better understanding of the biology and molecular pathogenesis of all CD30+ lymphomas.

ACKNOWLEDGMENT

The authors are grateful to U. Tank and H. Protz for excellent technical assistance, and to L. Oehring for help with the photos.

REFERENCES

1. Stein H, Mason DY, Gerdes J, O’Connor N, Wainscoat J, Pallesen G, Gatter K, Falini B, Delsol G, Lemke H, Schwarting R, Lennert K. The expression of Hodgkin’s disease-associated antigen Ki-l in reactive and neoplastic lymphoid tissue. Evidence that Reed- Sternberg cells and histiocytic malignancies are derived from activated lymphoid cells. Blood 66:849, 1985

2. Stein H, Dallenbach F Diffuse large cell lymphomas of B- and T-cell type, in Knowles DM (ed): Neoplastic Hematopathology. Baltimore, MD, Williams & Wilkins, 1992, p 675

3. Stansfeld AG, Diebold J, Noel H, Kapanci Y, Ftilke F, Keltnyi G , Sundstrom C, Lennert K, van Unnik JAM, Mioduszewska 0, Wright DH: Updated Kiel classification for malignant lymphomas. Lancet 1:292, 1988

4. Harris NL, Jaffe ES, Stein H, Banks PM, Chan JKC, Cleary ML, Delsol G, De Wolf-Peters C, Falini B, Gatter KC, Grogan TM, Isaacson PG, Knowles DM, Mason DY, Muller-Hermelink HK, F’ileri SA, P i n s MA, Ralfkiaer E, Warnke RA: A revised European- American classification of lymphoid neoplasms: A proposal from the International Lymphoma Study Group. Blood 84:1361, 1994

5. Herbst H, Dallenbach F, Hummel M, Niedobitek G, Rowe M, Young LS, Muller-Lantzsch N. Stein H: Epstein-Barr virus DNA and latent gene products in CD30-positive anaplastic large cell lymphomas. Blood 78:2666, 1991

6. Le Beau MM, Bitter MA, Larson RA, Doane LA, Ellis ED, Franklin WA, Rubin CM, Kadin ME, Vardiman JW: The t(2; 5)(p23; q35): A recurring chromosomal abnormality in Ki- 1 -positive anaplastic large cell lymphoma. Leukemia 3:866, 1989

7. Kaneko Y, Frizzera G, Edamura S, Maseki N, Sakurai M, Ko- mada Y, Sakurai M, Tanaka H, Sasaki M, Suchi T, Kikuta A, Wakasa H, Hojo H, Mizutani S: A novel translocation, t(2;5)(p23;q35) in childhood phagocytic large T-cell lymphoma mimicking malignant histiocytosis. Blood 73:806, 1989

8. Bitter MA, Franklin WA, Larson R A , McKeithan T W , Rubin CM, Le Beau MM, Stephens JK, Vardiman J W : Morphology in Ki-l (CD30)-positive non-Hodgkin’s lymphoma is correlated with clinical features and the presence of a unique chromosomal abnormality, t(2;5)(p23;q35). Am J Surg Pathol 14:305, 1990

9. Rimokh R, Magaud JP, Berger F, Samarut J, Coffier B, Ger- main D, Mason DY: A translocation involving a specific breakpoint (q35) on chromosome 5 is characteristic of anaplastic large cell lymphoma (“Ki-l lymphoma”). Br J Haematol 71:31, 1989

10. Mason DY, Bastard C, Rimokh R, Dastague N, Huret JL, Kristofferson U, Magaud JP, Nezelof C, Tilly H, Vannier JP, Hemet J, Warnke R: CD30-positive large cell lymphomas (“Ki-l lymphoma”) are associated with a chromosomal translocation involving 5q35. Br J Haematol 74:161, 1990

11. Cabanillas F, Pathak S, Trujillo J, Grant G , Cork A, Hage-




1700 HERBST ET AL

meister FB, Velasquez WS, Maclaughlin P, Redman J, Katz R, Butler JJ, Freirekh El: Cytogenetic features of Hodgkin’s disease suggest possible origin from a lymphocyte. Blood 71:1615, 1988

12. Schouten HC, Singer WC, Duggan M, Weisenburger DD, MacLennan KA, Armitage J O Chromosomal abnormalities in Hodgkin’s disease. Blood 73:2149, 1989

13. Tilly H, Bastard C, Delastre T, Duval C, Bizet M, Lenormand B, DaucC JP, Moncondiut M, Piguet H: Cytogenetic studies in un- treated Hodgkin’s disease. Blood 77:1298, 1991

14. Moms SW, Kirstein MN, Valentine M B , Dittmer KG, Sha- piro D, Saltman DL, Look AT Fusion of a kinase gene, ALK, to a nucleolar protein, NPM, in non-Hodgkin’s lymphoma. Science 263:1281, 1994

15. Shiota M, Fujimoto J, Semba T, Satoh H, Yamamoto T, Mori S: Hyperphosphorylation of a novel 80 kDa protein-tyrosine kinase similar to Ltk in a human Ki-l lymphoma cell line, AMS3. Oncogene 9: 1567, 1994

16. Bullrich F, Moms SW, Hummel M, Pileri S , Stein H, Croce CM: Nucleophosmin (NPM) gene rearrangements in Ki-l-positive lymphomas. Cancer Res 542873, 1994

17. Shiota M, Fujimoto J, Takenaga M, Satoh H, Ichinohasama R, Abe M, Nakano M, Yamamoto T, Mori S : Diagnosis of t(2;5)(~23;q35)-associated Ki-l lymphoma with immunohistochem- istry. Blood 84:3648, 1994

18. Ladanyi M, Cavalchire G, Moms SW, Downing J, Filippa DA: Reverse transcriptase polymerase chain reaction for the Ki-l anaplastic large cell lymphoma-associated t(2; 5 ) translocation in Hodgkin’s disease. Am J Pathol 145:1296, 1995

19. orscheschek K, M a H, Hell J, Binder T, Bards H, Feller AC: Largeell anaplastic lymphoma-specific translocation (t[2;5]Cp23;q35]) in Hodgkm’s disease: indication of a common pathogenesis? Lancet 34587, 1995

20. Lopategui JR, Sun LH, Chan JK, Gaffey MJ, Frierson HF Jr, Glackin C, Weiss LM: Low frequency association of the t(2;5)(p23;q35) chromosomal translocation with CD30+ lymphomas from American and Asian patients. A reverse transcriptase-polymerase chain reaction study. Am J Pathol 146328, 1995

21. Diehl V, Kirchner HH, Bunichter H. Stein H, Fonatsch C, Gerdes J, Schaadt M, Heit W, Uchanska-Ziegler B, Heintz F, Sueno K Characteristics of Hodgkin’s disease-derived cell lines. Cancer Treat Rep 66:615, 1982

22. Jones DB, Furley AJW, Gerdes J, Greaves MF, Stein H, Wright DH Phenotypic and genotypic analyses of two cell lines derived from Hodgkin’s disease tissue biopsies. Recent Results Can- cer Res 117:62, 1988

23. Kamesaki H, Fukuhara S , Tatsumi E, Uchino H, Yamabe H, Miwa H, Shirakawa S , Hatanaka M, Honjo T: Cytochemical, immunologic, chromosomal and molecular genetic analysis of a novel cell line derived from Hodgkin’s disease. Blood 68:285, 1986

24. Fischer P, Nacheva E, Mason DY, Shemngton D, Hoyle C, Hayhoe FGJ, Karpas A A Ki-l (CD30)-positive human cell line (Karpas 299) established from a high-grade non-Hodgkin’s lymphoma, showing a 2 5 translocation and rearrangement of the T-cell receptor &chain gene. Blood 72:234, 1988

25. Wasik MA, Sioutos N, Tuttle M, Butmarc JR, Kaplan WD, Kadin ME. Constitutive secretion of soluble L - 2 receptor by a human T-cell lymphoma xenografted into SCID mice. Correlation of tumor volume with concentration of tumor-derived soluble IL- 2R in body fluids of the host mice. Am J Pathol 144:1089, 1994

26. Gogusev J, Barbey S , Nezelof C: Genotype markers and proto-oncogene analysis in the CD30-positive “malignant histiocytosis” DEL cell line with t(5;6)(q35;p21). Int J Cancer 46:106, 1990

27. Hecht BK, Epstein AL. Berger CS, Kaplan HS, Hecht F: Histiocytic lymphoma cell lines: Immunologic and cytogenetic studies. Cancer Genet Cytogenet 14:205, 1985

28. de Breuil R M , Pate1 JM, Mendelow BV: Quantitation of p- actin-specific mRNA transcripts using xeno-competitive PCR. PCR Methods Appl 3:57, 1993

29. Herbst H, Steinbrecher E, Niedobitek G , Young LS, Brooks L, Muller-Lantzsch N, Stein H: Distribution and phenotype of Ep- stein-Barr virus-harboring cells in Hodgkin’s disease. Blood 80:484, 1992

30. Ladanyi M, Parsa NZ, Offit K, Wachtel S , Jhanwar SC: Clonal cytogenetic abnormalities in Hodgkm’s disease. Genes Chromosom Cancer 3:294, 1991

31. GNSS HJ, Boiani N, Williams DE, Armitage RJ, Smith A, Goodwin R G Pleiotropic effects of the CD30 ligand on CD30-expressing cells and lymphoma cell lines. Blood 83:2045, 1994




1995 86: 1694-1700

H Herbst, J Anagnostopoulos, B Heinze, H Durkop, M Hummel and H Stein diseaseALK gene products in anaplastic large cell lymphomas and Hodgkin's

http://www.bloodjournal.org/content/86/5/1694.full.htmlUpdated information and services can be found at:

Articles on similar topics can be found in the following Blood collections

http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requestsInformation about reproducing this article in parts or in its entirety may be found online at:

http://www.bloodjournal.org/site/misc/rights.xhtml#reprintsInformation about ordering reprints may be found online at:

http://www.bloodjournal.org/site/subscriptions/index.xhtmlInformation about subscriptions and ASH membership may be found online at:

Copyright 2011 by The American Society of Hematology; all rights reserved.Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American


http://www.bloodjournal.org/content/86/5/1694.full.html

http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests

http://www.bloodjournal.org/site/misc/rights.xhtml#reprints

http://www.bloodjournal.org/site/subscriptions/index.xhtml





alk gene products in anaplastic large cell lymphomas and hodgkin's

Documents