agri-science art of application: bioinformatics and ......agri-science art of application:...
TRANSCRIPT
![Page 1: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/1.jpg)
Agri-Science Art of Application: Bioinformatics and Agricultural
Sciences Education
David Francis Horticulture and Crop Sciences [email protected]
![Page 2: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/2.jpg)
One of the best ways for kids to learn science: by doing it. Eva Emerson, Editor in Chief Science News Magazine
Inquiry based learning: posing questions, problems or scenarios rather than presenting facts.
![Page 3: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/3.jpg)
Inquiry is a process of asking and answering questions about the natural world and is the foundation of science. Investigate an answerable question through valid experimental techniques. Conclusions are based on evidence and are repeatable.
![Page 4: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/4.jpg)
Bioinformatics is a scientific field that develops methods and software tools for storing, retrieving, organizing and analyzing biological data. These tools allow users to pose questions and seek answers. Introduce resources Types of data and repositories Introduce tools Distributed resources for bioinformatics Usually available through the same sites as data Talk about the types of questions students can ask
![Page 5: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/5.jpg)
Example Learning Objectives Find, access, critically evaluate, and use information Integrate quantitative and qualitative information to reach defensible and creative conclusions Standards (biological sciences) Students will understand that genetic information coded in DNA is passed from parents to offspring by sexual and asexual reproduction. The basic structure of DNA is the same in all living things. Changes in DNA may alter genetic expression. • Summarize how genetic information encoded in DNA provides instructions for
assembling protein molecules. • Describe how mutations may affect genetic expression and cite examples of
mutagens.
![Page 6: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/6.jpg)
Information for producing proteins and reproduction is coded in DNA and organized into genes in chromosomes. This elegant yet complex set of processes explains how life forms replicate themselves with slight changes that make adaptations to changing conditions possible over long periods of time. The genetic information responsible for inherited characteristics is encoded in the DNA molecules in chromosomes. DNA is composed of four subunits (A,T,C,G). The sequence of subunits in a gene specifies the amino acids needed to make a protein. Proteins express inherited traits (e.g., eye color, hair texture) and carry out most cell function. Describe how DNA molecules are long chains linking four subunits (smaller molecules) whose sequence encodes genetic information. Illustrate the process by which gene sequences are copied to produce proteins. Cells use the DNA that forms their genes to encode enzymes and other proteins that allow a cell to grow and divide to produce more cells, and to respond to the environment. Explain that regulation of cell functions can occur by changing the activity of proteins within cells and/or by changing whether and how often particular genes are expressed.
![Page 7: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/7.jpg)
Question: “why are tomatoes red?” Answer: “because of their genes” A more detailed answer requires that we review: • DNA and genes • Proteins • Biochemical Pathways • Vitamins • How Changes in DNA affect Proteins,
Biochemical Pathways, and Vitamins • Eating your vegetables • Listening to your parents
![Page 8: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/8.jpg)
DNA RNA Protein
General
DNA makes RNA, RNA makes proteins, proteins do things (like make pigments)
Central dogma of molecular biology
Let’s start with the basic idea of DNA, and how it works…. DNA makes RNA and RNA makes Protein (genes are made of DNA; one gene, one protein) (proteins do things!)
DNA: Large molecules inside the nucleus of living cells that carry genetic information. The scientific name for DNA is deoxyribonucleic acid.
![Page 9: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/9.jpg)
DNA is composed of adenine, guanine,
cytosine and thymine (abbreviated A,
G, C, T). REMEMBER THIS!
Orientation is described relative to the
position of the phosphate and the OH
on the ribose that forms the backbone.
A pairs with T (two hydrogen bonds)
and G pairs with C (three hydrogen
bonds).
Strands are anti-parallel (opposite).
![Page 10: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/10.jpg)
DNA RNA Protein
DNA RNA Protein
Remember:
Changes in DNA can change a protein;
Changes in transcription can change how much protein;
These changes can cause a difference (like why a tomato is red or
orange).
Why should we care about DNA?
DNA to DNA: replication DNA to RNA: transcription RNA to protein: translation
![Page 11: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/11.jpg)
The “promoter” regulates where, when, and how much RNA to produce. The promoter is next to the gene, on the 5’ side.
Promoter Coding Sequence (ORF) = Gene
Transcription (DNA > RNA)
5’ 3’
5’ 3’
![Page 12: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/12.jpg)
Translation: RNA to Protein, It’s a CODE!
Image from http://en.wikipedia.org/wiki/Genetic_code Under Creative Commons Attribution License
Methionine Threonine Glutamic Acid
.
.
.
Proteins are formed from 20 building blocks called amino acids; three of the DNA bases code for an amino acid.
![Page 13: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/13.jpg)
Translation: RNA to Protein, It’s a CODE!
Image from http://en.wikipedia.org/wiki/Genetic_code Under Creative Commons Attribution License
Image from http://www.americanscientist.org/issues/pub/2004/6/ode-to-the-code American Scientist, November-Dec. 2004
![Page 14: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/14.jpg)
Illustration from Insuk Lee, Michael Ahn, Edward Marcotte, Seung Yon Rhee Carnegie Institution for Science. Available from Science 18 February 2011: vol. 331 no. 6019 848-849
Now we know how RNA makes Protein, but how do proteins do things? Proteins are organized into biochemical pathways…
![Page 15: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/15.jpg)
Now we know how RNA makes Protein, but how do proteins do things? Proteins are organized into biochemical pathways…
![Page 16: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/16.jpg)
Phytoene (Yellow) Cis-lycopene (Tangerine/Orange) Lycopene (Red) Beta-Carotene (Orange)
Another answer to our question “why are tomatoes red?” is “because they have lycopene and β-Carotene”
Simplified biochemical pathway (arrows are proteins that convert one pigment into another)
![Page 17: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/17.jpg)
Think about a pipeline….
IN HERE
OUT HERE
OR HERE
![Page 18: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/18.jpg)
The role of proteins in a biochemical pathway (pipeline): regulate flow (valves) help provide energy turn on/off (master switch)
![Page 19: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/19.jpg)
Biochemical pathways convert one compound into another Lycopene and Beta-Carotene are both pigments that give tomato its color Lycopene is red and Beta-Carotene is orange Our bodies use Beta-Carotene to make Vitamin A
![Page 20: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/20.jpg)
Naturally occurring variation in the biochemical pathway leads to variation in carotenoid pigments
![Page 21: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/21.jpg)
DNA RNA Protein
DNA RNA Protein
Remember:
Changes in DNA can change a protein;
Changes in transcription can change how much protein;
These changes can cause a difference (like why a tomato is red or
orange).
Why we should care about DNA?
DNA to DNA: replication DNA to RNA: transcription RNA to protein: translation
![Page 22: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/22.jpg)
Where can we find DNA? How do we find genes in DNA?
![Page 23: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/23.jpg)
DNA is in the nucleus of every cell!
![Page 24: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/24.jpg)
![Page 25: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/25.jpg)
![Page 26: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/26.jpg)
>PSY1
TATTCTCTAGTGGGAATCTACTAGGAGTAATTTATTTTCTATAAACTAAG
TAAAGTTTGGAAGGTGACAAAAAGAAAGACAAAAATCTTGGAATTGTT
TTAGACAACCAAGGTTTTCTTGCTCAGAATGTCTGTTGCCTTGTTATG
GGTTGTTTCTCCTTGTGACGTCTCAAATGGGACAAGTTTCATGGAAT
CAGTCCGGGAGGGAAACCGTTTTTTTGATTCATCGAGGCATAGGAAT
TTGGTGTCCAATGAGAGAATCAATAGAGGTGGTGGAAAGCAAACTAA
TAATGGACGGAAATTTTCTGTACGGTCTGCTATTTTGGCTACTCCATC
TGGAGAACGGACGATGACATCGGAACAGATGGTCTATGATGTGGTTT
TGAGGCAGGCAGCCTTGGTGAAGAGGCAACTGAGATCTACCAATGAGTTAGAAGTGAAGCCGGAT
The DNA sequence of the tomato Phytoene Synthase gene
(PSY1) depicted in FASTA format:
>name
DNA sequence
![Page 27: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/27.jpg)
>PSY1
TATTCTCTAGTGGGAATCTACTAGGAGTAATTTATTTTCTATAAACTAAG
TAAAGTTTGGAAGGTGACAAAAAGAAAGACAAAAATCTTGGAATTGTT
TTAGACAACCAAGGTTTTCTTGCTCAGAATGTCTGTTGCCTTGTTATG
GGTTGTTTCTCCTTGTGACGTCTCAAATGGGACAAGTTTCATGGAAT
CAGTCCGGGAGGGAAACCGTTTTTTTGATTCATCGAGGCATAGGAAT
TTGGTGTCCAATGAGAGAATCAATAGAGGTGGTGGAAAGCAAACTAA
TAATGGACGGAAATTTTCTGTACGGTCTGCTATTTTGGCTACTCCATC
TGGAGAACGGACGATGACATCGGAACAGATGGTCTATGATGTGGTTT
TGAGGCAGGCAGCCTTGGTGAAGAGGCAACTGAGATCTACCAATGAGTTAGAAGTGAAGCCGGAT
This sequence is a ‘string’: A set of consecutive characters
containing information. The information in DNA is:
Bi-directional 5’-TATTCTCTA-3
3’-ATAAGAGAT-5
5’-TATTCTCTA-3’ and 5’-TCGAGAATA-3’
In six frames
![Page 28: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/28.jpg)
>PSY1
TATTCTCTAGTGGGAATCTACTAGGAGTAATTTATTTTCTATAAACTA
AGTAAAGTTTGGAAGGTGACAAAAAGAAAGACAAAAATCTTGGAATT
GTTTTAGACAACCAAGGTTTTCTTGCTCAGAATGTCTGTTGCCTTGTT
ATGGGTTGTTTCTCCTTGTGACGTCTCAAATGGGACAAGTTTCATGG
AATCAGTCCGGGAGGGAAACCGTTTTTTTGATTCATCGAGGCATAGG
AATTTGGTGTCCAATGAGAGAATCAATAGAGGTGGTGGAAAGCAAAC
TAATAATGGACGGAAATTTTCTGTACGGTCTGCTATTTTGGCTACTCCATCTGGAGAACGGACGATGACATCGGAACAGATGGTCTATGATGTG
In six frames (due to the fact that each amino acid will
be coded by three nucleotides and the information is
bi-directional): Three forward; Three reverse
![Page 29: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/29.jpg)
>PSY1
TAT TCT CTA GTG GGA ATC TAC TAG GAG TAA TTT ATT TTC TAT
AAACTAAGTAAAGTTTGGAAGGTGACAAAAAGAAAGACAAAAATCTTGG
AATTGTTTTAGACAACCAAGGTTTTCTTGCTCAGAATGTCTGTTG
>PSY1
T ATT CTC TAG TGG GAA TCT ACT AGG AGT AAT TTA TTT TCT ATA
AACTAAGTAAAGTTTGGAAGGTGACAAAAAGAAAGACAAAAATCTTGGA
ATTGTTTTAGACAACCAAGGTTTTCTTGCTCAGAATGTCTGTTG
>PSY1
TA TTC TCT AGT GGG AAT CTA CTA GGA GTA ATT TAT TTT CTA TAA
AACTAAGTAAAGTTTGGAAGGTGACAAAAAGAAAGACAAAAATCTTGGA
ATTGTTTTAGACAACCAAGGTTTTCTTGCTCAGAATGTCTGTTG
In six frames (three, shown above)
![Page 30: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/30.jpg)
~420,000 Pages
We can present all the information in the DNA of tomato as a “string” organized into 12 large chapters (for each of the 12 chromosomes).
![Page 31: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/31.jpg)
Can DNA tell me why a tomato is red? First, we have to find the gene(s). Consider the gene “Lycopene Beta-Cyclase” “CrtL” in bacteria (converts Lycopene into Beta-Carotene)
Lycopene (Red) Beta-Carotene (Orange)
![Page 32: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/32.jpg)
Find 1 gene (1 sentence) in 450,000 pages
Problem solving strategies: 1) Take a big problem and break it up into smaller parts: What chromosomes have genes involved in fruit color (1-12)? Where on a chromosome is the gene (top, bottom, middle)? 2) Find a simple system, and ask if it works the same: E. coli (bacteria) 4.6Mb Arabidopsis thaliana 157Mb Solanum lycopersicum (Tomato) 950 Mb Paris Japonica (canopy plant) 150 Gb Some bacteria make carotenoid pigments. Number of pages of DNA is ~1,500 vs 420,000 for tomato 3) Compare (find the missing page, paragraph, sentence) Red tomatoes and orange tomatoes Red bacteria vs white bacteria
![Page 33: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/33.jpg)
Chromosome 6 ~30,000 pages “long arm” ~20,000 pages*
*26-27 Harry Potter books
![Page 34: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/34.jpg)
1) How can we find a sentence in 20,000 pages? 2) Keep narrowing the pages down 3) Can we find anything that looks like CrtL? This might be what we want
![Page 35: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/35.jpg)
Normal Very Red Very Red
Normal Very Red Very Red
htt
p:/
/ww
w.e
bi.a
c.u
k/To
ols
/msa
/clu
stal
w2
/
Compare
![Page 36: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/36.jpg)
To find the part of the sequence that codes for a protein (the gene), we look for “open reading frames” (ORFs)
Open Reading Frame Finder: http://www.ncbi.nlm.nih.gov/gorf/gorf.html
![Page 37: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/37.jpg)
Tomato with Lycopene (Red) and Beta-Carotene (orange) Tomato with Lycopene (Red) and no Beta-Carotene
Hypothesis: Deletions (mutations) in the Lycopene Beta-Cyclase gene lead to more lycopene, because the enzyme cannot convert Lycopene to Beta-Carotene
Red orange
Red X
Compare
![Page 38: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/38.jpg)
Introduction to resources NCBI (National Center for Biotechnology Information) http://www.ncbi.nlm.nih.gov/ EMBL (European Molecular Biology Laboratory) http://www.ebi.ac.uk/
Tools BLAST http://blast.ncbi.nlm.nih.gov/Blast.cgi ORF Finder http://www.ncbi.nlm.nih.gov/gorf/gorf.html Multiple Sequence alignment http://www.ebi.ac.uk/Tools/msa/clustalw2/ http://www.ebi.ac.uk/Tools/msa/clustalo/
![Page 39: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/39.jpg)
What Question? 1) How many versions (alleles) of gene x can we find in the database? Do different alleles at the DNA level translate into different proteins? 2) What is the closest wild relative of (the domestic cat)? (can substitute any animal, plant, fungi, bacterium, virus, etc… here) What Gene(s)? Most eukaryotes have nuclear and mitochondrial inheritance. Mitochondrial inheritance is almost always maternal. Nuclear inheritance is maternal or paternal. When there are sex determining chromosomes (X and Y in mammals) , we can also separate paternal and maternal inheritance. The question “what is the closest wild relative of the domestic cat? “ can be addressed with genes from the mitochondria and from the Y chromosome.
![Page 40: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/40.jpg)
1) How many versions (alleles) of gene x can we find in the database?
Do different alleles at the DNA level translate into different proteins? We can find several versions of the tomato “lycopene beta cyclase” in the NCBI nucleotide database. Do these different DNA sequences translate into different proteins?
![Page 41: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/41.jpg)
http://www.ncbi.nlm.nih.gov/
![Page 42: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/42.jpg)
Databases (two examples) Nucleotide = the “gold standard”, often referred to as non-redundant nucleotide database EST = expressed sequence tags are short sequences generated from messenger RNA (mRNA). These represent a snap shot of the genes that are transcribed from a given organism and tissue.
![Page 43: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/43.jpg)
NCBI can be searched using classic Boolean operators. See the following for a quick guide: http://www.lib.berkeley.edu/TeachingLib/Guides/Internet/Boolean.pdf
![Page 44: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/44.jpg)
![Page 45: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/45.jpg)
NCBI can be searched using classic Boolean operators. See the following for a quick guide: http://www.lib.berkeley.edu/TeachingLib/Guides/Internet/Boolean.pdf
![Page 46: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/46.jpg)
![Page 47: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/47.jpg)
Note: you may want to edit this .txt “FASTA” file. Use “edit find” or “ctrl F” to search for the “>” symbol and add spaces in order to separate sequences
![Page 48: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/48.jpg)
![Page 49: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/49.jpg)
![Page 50: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/50.jpg)
![Page 51: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/51.jpg)
![Page 52: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/52.jpg)
BLAST = Basic Local Alignment Search Technique Efficient algorithm for finding DNA matches in a database of for comparing two sequences
http://blast.ncbi.nlm.nih.gov/Blast.cgi
![Page 53: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/53.jpg)
http://blast.ncbi.nlm.nih.gov/Blast.cgi
![Page 54: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/54.jpg)
http://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=blast2seq&LINK_LOC=align2seq
![Page 55: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/55.jpg)
Cut and paste sequence, enter GI number, or upload a FASTA text file Select a database Select a BLAST algorithm Hit the “BLAST” button
![Page 56: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/56.jpg)
![Page 57: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/57.jpg)
![Page 58: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/58.jpg)
![Page 59: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/59.jpg)
Tomato with Lycopene (Red) and Beta-Carotene (orange) Tomato with Lycopene (Red) and very little Beta-Carotene
Hypothesis: Deletions (mutations) in the Lycopene Beta-Cyclase gene lead to more lycopene, because the enzyme cannot convert Lycopene to Beta-Carotene
Red orange
Red X
Compare
![Page 60: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/60.jpg)
![Page 61: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/61.jpg)
BLAST can allow you to Search an “unknown sequence” against a database in order to determine the closest matches. These matches may suggest a likely function. Compare two sequences to identify differences. Quantify those differences. ORF Finder can tell you whether those differences affect the structure or the protein sequence
![Page 62: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/62.jpg)
2) What is the closest wild relative of (the domestic cat)? (can substitute any animal, plant, fungi, bacterium, virus, etc… here) What Gene(s)? Most eukaryotes have nuclear and mitochondrial inheritance. Mitochondrial inheritance is almost always maternal. Nuclear inheritance is maternal or paternal. When there are sex determining chromosomes (X and Y in mammals) , we can also separate paternal and maternal inheritance. The question “what is the closest wild relative of the domestic cat? “ can be addressed with genes from the mitochondria and from the Y chromosome.
![Page 63: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/63.jpg)
Species list (NCBI Taxonomy): Felis catus Felis silvestris Lynx rufus Lynx lynx
Sequences (FASTA format)
Pairwise comparisons (BLAST)
Multiple sequence alignment Similarity matrix
![Page 64: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/64.jpg)
What is the closest wild relative of the domestic cat? • Find a gene or genes that are present in a large number of closely
related species. (This step may require some exploration and/or iteration)
• Retrieve sequences from as many relatives as possible • Edit those sequences to the same length (Blast 2 Sequences is
useful to define common length) • Run multiple sequence alignments. • Cluster the alignments (data reduction and visualization) • Scientific rigor can be improved by having more than one sequence
of a species (allows us to assess variation in the data; do independent sequences from the same species cluster together?)
• Scientific rigor can be improved by comparing more than one gene (do we see the same pattern of clustering?)
![Page 65: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/65.jpg)
http://www.ncbi.nlm.nih.gov/
![Page 66: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/66.jpg)
Database: Nucleotide ENTREZ search: SRY AND felis or SRY AND felis [orgn]
![Page 67: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/67.jpg)
http://www.ncbi.nlm.nih.gov/
![Page 68: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/68.jpg)
![Page 69: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/69.jpg)
![Page 70: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/70.jpg)
![Page 71: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/71.jpg)
For SRY sequences the original alignment suggests some improvements can be made to our FASTA file to improve interpretation …
Trim sequences to the same length (some alignment and clustering programs consider these “tails” to be a differnence).
Re-order the name so that the alignment can be interpreted more easily
![Page 72: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/72.jpg)
![Page 73: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/73.jpg)
![Page 74: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/74.jpg)
16S sequence cluster SRY sequence cluster
![Page 75: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/75.jpg)
Felis libyca and Felis silvestris are the closest wild relatives based on the 16S comparison (maternal inheritance). Felis libyca is the closest wild relative based on the SRY comparison (paternal inheritance). The results could indicate: • An ancestor not present in the sequence data set. • Mixed ancestry (i.e. both Felis libyca and Felis silvestris contributed, but in
different proportions to the male and female ancestry). • Felis lybica, the African wild cat is also known as Felis silvestris lybica, so
maybe the ambiguity is trivial. To remove ambiguity and test our hypothesis: • Add sequence data (more potential ancestors, more samples per ancestor,
and more genes) • Use “bootstrapping” statistics to test the strength/validity of each node
![Page 76: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/76.jpg)
Things you can try at home: Search for other sequences to add to these FASTA files and re-cluster the data. Identify other genes to study
![Page 77: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/77.jpg)
Things you can try at home: Search for other sequences to add to these FASTA files and re-cluster the data. Identify other genes to study
![Page 78: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/78.jpg)
Things you can try at home: Search for other sequences to add to these FASTA files and re-cluster the data. Identify other genes to study
![Page 79: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/79.jpg)
Further information
http://www.extension.org/pages/32521/
![Page 80: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/80.jpg)
http://www.youtube.com/watch?v=hqp2UE1j550
![Page 81: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/81.jpg)
Further information
![Page 82: Agri-Science Art of Application: Bioinformatics and ......Agri-Science Art of Application: Bioinformatics and Agricultural Sciences Education David Francis Horticulture and Crop Sciences](https://reader034.vdocuments.us/reader034/viewer/2022051810/601a3ed7c68e6b5bec07f178/html5/thumbnails/82.jpg)
Further information