ICONS

£7.95

METEOR'BRITAIN’S FIRST JET-POWERED COLD WAR WARRIOR'

METEOR | 3

Cover Caption: The Gloster F Mk 4 demonstrator, G-AIDC, pictured off the south coast of England in September 1946. The aircraft was ‘pranged’ by a Belgian pilot in 1947 but was rebuilt as the T Mk 7 demonstrator G-AKPK. Aeroplane

Britain’s � rst jet fighter METEOR

T HE STORY of the Gloster Meteor is one of the greatest in the history of the aviation industry and one we generally take for granted. This pioneering aircraft was not

particularly advanced, was given very little chance to prove itself in combat but, as a ‘fi rst-generation’ jet, its arrival launched the RAF into a new era.

Development of the jet engine, thanks to the eff orts of Frank Whittle, began in 1936, and as with all military projects, the outbreak of the Second World War saw his work accelerate to the point of the fi rst fl ight of the E.28/39 from Cranwell in May 1941. Less than two years later, the F.9/40 was off the ground and, by August, the fi rst Meteor F Mk 1s were entering service with 616 Squadron. This was an incredible achievement which saw the Meteor poised to re-equip a host of RAF squadrons during the immediate post-war era. By 1950, the best of the day fi ghter breed had arrived in the shape of the F Mk 8 and, for the next fi ve years, over 30 operational units were fl ying the type, up until the arrival of the ‘second-generation’ Hawker Hunter.

The ubiquitous T Mk 7 saw hundreds, if not thousands, of potential pilots experience their fi rst taste of jet fl ying and,

sadly for many, their last. Approximately 890 Meteors were lost in RAF service, resulting in the deaths of 434 pilots; and this was during peace-time. The period during 1950 and 1953 was so bad (150 losses in 1952 alone) that the whole method of fl ying training was being questioned but the bottom line was that the Meteor was not a diffi cult aircraft to fl y although it was certainly not ‘viceless’. It was a challenging machine, especially when fl own asymmetrically, when airspeed was critical and the brute strength required on the rudder pedal to keep the beast straight was considerable. It was in this confi guration that many pilots were caught out and those who survived their training to serve on an operational squadron were advised not to practice the technique because it was generally described as ‘too bloody dangerous!’

Regardless, the Meteor was a huge success story for the Gloster Aircraft Company and the

industry as a whole. Armstrong Whitworth benefi tted enormously from sub-

contracts and later production orders for all of the night-fi ghter variants.

Overseas orders were healthy as well with all marks,

from the F Mk 3 onwards, seeing

AcknowledgementsTony Buttler (Contributor)Claire Chorlton (Proofi ng)

Owen Cooper (Contributor)Derek D Dempster (Contributor)

Andy Hay (Artwork)Tony Haig-Thomas (Contributor)

Peter Heath (Contributor)Sue Keily (Ad Sales Manager)Mark Lambert (Contributor)

Tim Mason (Contributor)Dennis Newton (Contributor)

Zoe Tabourajis (Art Editor)R G Worcester (Contributor)

service across the globe. It was with foreign air forces that the Meteor saw more action with coups and revolutions in Argentina and the Suez campaign for the Egyptian NF Mk 13s. It was the F Mk 8s of 77 Squadron, RAAF in Korea that chalked up the highest operational combat record, fl ying 4,836 sorties, shooting down six Mig-15s albeit for the loss of 30 of its own. Hopelessly outclassed by the Mig-15, the Korean War was the type’s only full opportunity to show its metal but, by 1950 the type was being superseded by the world’s swept wing jets.

Today, any self-respecting aviation museum has at least one Meteor of some description on display but considering nearly 4,000 were built, a mere fi ve remain airworthy. In Britain, we are lucky that four of them live here, two of them, WA638 and WL419, both T Mk 7/F Mk 8 hybrids, still work for a living with Martin-Baker at Chalgrove. Also, NF Mk 11 WM167 (G-LOSM) and recently restored Meteor T Mk 7 WA591 (G-BWMF) are both operated by Air Atlantique’s Classic Aircraft Trust. Overseas, only one Meteor is still fl ying and this is ex-RAF ex-VZ467, an F Mk 8 which is displayed in the colours of 77 Squadron, by the Temora Aviation Museum in New South Wales.

Martyn Chorlton July, 2012

WL419, A T Mk 7/F Mk 8 hybrid, has been serving Martin-Baker since 1964 and continues to do so. Martin-Baker has been using Meteors since 1945. WL419 is its ninth and along with WA638 will inevitably be their last. Martin-Baker via Martyn Chorlton

Published by Kelsey Publishing Ltd. Printed at William Gibbons & Sons Ltd on behalf of Kelsey Publishing Ltd, Cudham Tithe Barn, Berry's Hill, Cudham, Kent TN16 3AG. Tel: 01959 541444. Fax: 01959 541400. Email: kelseybooks@kelsey.co.uk. Website: www.kelsey.co.uk. ©2012 ISBN: 978-1-907426-47-6

6-11 ‘No airscrew fitted with this method of propul-sion’ - Gloster -The First Ten Years

14-19 The pioneering Gloster E.28/39

24-25 The First Meteor Drawings by Tony Buttler

28-31 The backbone of RAF Fighter Command by Owen Cooper

34-37 Flying the Meteor F Mk 8 by Derek D Dempster

4

Contents42-47 The nocturnal ‘meat-box’

– The NF Mk 11 to NF Mk 14

50-53 More about the Meteor T Mk 7 Trainer

56-59 The FR Mk 9 and PR Mk 10 by Martyn Chorlton

62-63 ‘Ace in the hole’ by Martyn Chorlton

66-69 The eight-gun Meteor by Tony Buttler

METEOR | 5

70-71 Pushingtheenvelope–apictorialhistoryofsomeoftheMeteortest-beds

74-77 MeteoricRecordsbyGpCaptPeterHeath

80-83 MeteortalesbyTonyHaig-Thomas

84-87 FlyingtheTrentMeteorbyRGWorcester

90-95 RAAFMeteoroperationsinKoreabyDennisNewton

98-101 PronePilotbyMarkLambert

102-105 DroningovertheFensbyTimMason

110-115 Massed‘Meat-Box’ProductioncompiledbyOwenCooper

116-121 Thevariants–TheF.9/40throughtotheNFMk14

124-129 Theunits–CompiledbyMartynChorlton

HISTORY WAS MADE on the evening of May 15, 1941, at RAF Cranwell, with the fi rst fl ight of the Gloster-Whittle E.28/39 jet-propelled monoplane. This article, which marks the tenth anniversary of that fl ight, describes the background of development which led up to it and some of the progress it made possible.

Cranwell airfi eld, close to the Lincoln fen country and scene of so many notable fi rst fl ights, because of its great runway, did not have good weather on May 15, 1941. But by the evening the clouds had lifted and the weather became, if not ideal for a fi rst test fl ight, at least possible. Down in one corner of the airfi eld, ‘Jerry’ Sayer, who was then Gloster’s Chief Test Pilot, climbed into the cockpit of a small green and brown monoplane and, at 20 minutes to eight, lifted it gently from the grass runway.

The fl ight lasted 17 minutes and was uneventful apart from some trouble in locking the nose wheel down for the landing. Before he could leave the cockpit, Sayer was being congratulated by the small group who had witnessed the fl ight, among them Frank Whittle and George Carter. And, later, when he prepared his Test Flight Report, he wrote, among much else: ‘No airscrew fi tted with this method of propulsion.’

Those eight words, which ten years later have an almost naive quality, in fact defi ned the essential revolution which the fl ight represented. It was the fi rst time a British aeroplane had fl own without an airscrew and the success of that fl ight marked both an end and a beginning. For Whittle, then only 33 years of age and a Squadron Leader, it was the end of the long struggle to perfect his aircraft gas-turbine and the even more diffi cult task of convincing the sceptics-and they were many-that

‘No airscrew � tted with this method of propulsion’

Gloster Aircraft Company - Ten Years of Jet Progress – The Aeroplane, 11 May 1951

his engine was suitable for aircraft propulsion. George Carter, who had designed the aircraft, saw in its successful fi rst fl ight the beginning of a new era in which the jet engine would supersede airscrew propulsion in many important applications.

That successful fi rst fl ight of the E.28/39 at Cranwell in fact marked the fusion of two lines of development; engine and airframe. Before we go any further we shall record the main features in these developments, which have had such a far-reaching eff ect on the progress of modern civil and military aviation.

Most credit must clearly go to Frank Whittle (now Air Commodore Sir Frank Whittle, OM, KBE, CB, FRS, Hon FRAes), whose inventive genius not only foresaw the possibilities of the gas-turbine for aircraft propulsion, but also turned the possibility into fact.

The full story of Whittle’s early work has been told at various times and in various places. In particular, we would refer readers to Whittle’s own paper, presented to the Institute of Mechanical Engineers in 1945 as the fi rst James Clayton Lecture and printed in The Aeroplane for October

The Gloster E.28/29 W4041/G gently lifts from Cranwell’s main runway during   ight testing. This photo was taken later during

the test program because the aircraft is � tted with auxiliary � ns to improve stability at high speeds. Via Aeroplane

Flt Lt P E G ‘Gerry’ Sayer OBE who piloted Britain’s � rst jet powered aircraft into the air from Cranwell on May 15, 1941. Sadly, he went missing during a Hawker Typhoon gun sight test from Acklington on October 21, 1942. Via Aeroplane

Gp Capt (later Air Cdre) Frank Whittle OM, KBE, CB, FRS, Hon FRAes, the father of jet propulsion. Via Martyn Chorlton

19, November 2 and November 9, 1945, for a full account.January, 1930, is the date which can most conveniently

be considered as that on which the idea of the aircraft gas-turbine took definite shape. Previously, Whittle had considered the possibilities of jet propulsion and of gas turbines, without linking the two, but by the beginning of 1930 he had perceived that the gas-turbine could be used for jet propulsion and applied for his first patent along these lines in January of that year. For a period, lack of financial support prevented anything other than paper work, but Whittle was finally able to start practical development of his engine in 1936, when Power Jets Ltd. was formed with a capital of £2,000 to foster his idea.

The first engine, although designed to be suitable for flight, was not actually intended as a flight engine. Its basic design was simple, comprising a single-stage centrifugal compressor, a single combustion chamber and a single-stage turbine coupled directly to the compressor. Each of these major organs represented a big advance in engineering practice, however; for instance, the compressor was to have a pressure ratio of about 4:1. In a single stage; the combustion intensity was considerably greater than anything previously attempted and a turbine wheel of about 16ins. diameter had to produce over 3,000 s.h.p. Whittle was especially concerned with the combustion problem and when the first engine, known as the W.U. (Whittle Unit), began running on April 12, 1937, it became clear that this problem was far from being solved. Initially, the combustion chamber was in the form of a large semi-circular loop between the compressor and turbine; a later reconstruction used a single straight combustion chamber but was again not completely successful. The W.U. was finally constructed with ten separate combustion chambers and took on a shape recognizably similar to that of the later engines.

Needless to say, combustion was not the only problem encountered, but it was upon the solution of this problem that the eventual success of the engine

depended so largely. Other important problems which required a great deal of attention at this time included the air flow through the engine and notably, the design of the turbine disc itself. In its third reconstruction, the W.U. engine finally proved the success of the principle beyond reasonable doubt, although the two year period following the first run in this form in October, 1938, was actually one of the most difficult of all for Whittle and his team. Although the arrangement of the combustion chambers was to prove successful, attempts to use a system based on pre-vaporization of the fuel had to be abandoned at the end of two years’ intensive research as impracticable.

This particular problem was only resolved when Mr I. Lubbock, of the Shell Petroleum Co. Ltd., whose resignation was announced recently, produced an alternative design of combustion chamber using atomized spray injection. This was an important turning-point in the development of the Whittle engine. Before the W.U. was finally wrecked on February 22, 1941, by turbine disc failure, several non-stop runs of up to 10 hours were completed at a cruising speed of 14,000rpm. Work on a second engine had begun under Air Ministry contract in the summer of 1939, this being intended to power an experimental aeroplane, the design of which was initiated concurrently by Gloster Aircraft Ltd. As this engine, the type W.l, progressed, certain parts were rejected as un-airworthy. These were used, together with certain spare components made for the W.U., to complete an engine known as the W.1X, intended as an early edition of the W.l.

The W.1X was completed in November, 1940; it resembled the W.U. in layout, but was a considerable improvement. Apart from providing useful information for improvement of the W.l itself, the W.1X was used in the Gloster E.28/39 for preliminary taxing trials at Brockworth, during which three short hops

The 850lb thrust Whittle W.1 engine which powered the E.28/29. Via Martyn Chorlton

Gloster IVA seaplane N222, which travelled to Venice for the 1927 Schneider Trophy event but was held back in reserve to the Mk IVB. It was later used as a high-speed trainer for the 1929 and 1931 races. Aeroplane

The Grebe was developed into the Bristol Jupiter powered Gamecock and 90 served the RAF but it was withdrawn early following a high number of accidents. Via Martyn Chorlton

METEOR | 9

were, in fact, made on April 8, 1941.Subsequently, the E.28/39 was moved by road to

Cranwell, the W.l engine was fitted, and the first flight was made, as already recorded, on May 15. The W.l was very similar in design to the W.U. in its third form, but was lightened wherever possible. The design of the auxiliary drive box was altered considerably and the number of turbine blades was increased to 72.

A design maximum speed of 17,750rpm was used for the W.l but it was actually cleared for flight at the lower rating of 16,500rpm, at which speed a static thrust of 850lb was obtained. The first run of the engine was made on April 12, 1941 and the teething troubles experienced were comparatively few, as a result of experience gained on the W.1X. In fact, Power Jets succeeded in completing a 25-hour special category test, installed the engine in the E.28/39 and accomplished 10 hours of flight testing within 46 days of the first run.

History of the Gloster Company Origins of the company which produced the first British jet aeroplane can be traced back to the 1914-18 War; historically it has several claims to fame prior to the advent of the jet engine. Aircraft production in the First World War demanded the co-operation of many wood-working companies, of which concerns H. H. Martyn and Co. were typical. In 1915, this well-established Cheltenham company of architectural engineers formed the nucleus of the Gloucestershire Aircraft Co.

Throughout the War, the company was occupied in sub-contract work, including the manufacture of DH.4 and D.H.6 fuselages and complete Bristol Fighters. In 1920, the decision was made to proceed with original aircraft design and the services of Mr H. P. Folland were obtained, first as consultant and later as chief engineer and designer.

Mr Folland had previously been responsible for the designs of the British Nieuport Co., and the first

Gloucestershire aircraft were recognizably based on these designs, the former company being no longer in existence. Thus appeared the first of the Mars series, the Mars 1, also known as the Bamel. The Mars 1 was entered in, and won, the 1921 Aerial Derby and repeated this success in 1922 and. 1923. On October 4, 1922, it established an unofficial record with a speed of 212.15 mph. The company’s aircraft have, since that date, continued in the high-speed tradition and the jet-propelled E.28/39 and, later, the Meteor, were both in accord with this tradition.

In 1921, Mr Hugh Burroughes’ joined the board of the company, a director of which he has been ever since. While production activities were concentrated upon Sparrowhawk two-seat fighters for the Imperial Japanese

Navy, the company’s design staff turned their attention to a study of high-speed wing sections, seeking in particular a section suitable for high-speed single-seat biplanes. Using one such wing section, the Grebe was developed and became the first of a long line of Gloucestershire fighters produced for the RAF.

Another important phase of the company’s activity began in 1923 when the Gloster I racing monoplane was converted to a seaplane for competition in the first post-war Schneider Trophy Contest. Gloucestershire seaplanes competed in 1925, 1927 and 1929 and, on September 10 in 1929, the Gloster VI, which was also the company’s first monoplane, established a World speed record of 336.31mph.

By this time, the company had moved to Brockworth Aerodrome, which it still occupies and the name had been changed to Gloster Aircraft Co. Development of the Grebe which, in its later versions achieved 160mph, resulted in the Gamecock, also produced for the RAF.

In 1927, the company absorbed the Steel Wing Company and thus acquired extensive experience in the application of steel strip to aircraft construction. Conversion to metal aircraft led to a large-scale reorganization of the works layout and for a long time Gloster Aircraft produced more metal structures than any other British aircraft constructor.

Following the company’s introduction to metal construction with the Gorcock and Goldfinch in 1928, attention was directed to the production of single-seat fighters with increased armament. The S.S.18 and S.S.19 six-gun fighters resulted, and led to the introduction of the Gauntlet and the most famous of all Gloster biplane fighters, the Gladiator.

Throughout the company’s history, the emphasis has always been upon racing aircraft and single and two-seat

The Jaguar or Jupiter powered Gloster Mars VI Nighthawk, of which 29 were ordered for the RAF and 25 more serve the Greek Air Force. Via Martyn Chorlton

The RAF’s first new post-First World War One fighter was the Gloster Grebe, a development of the Grouse. The little fighter served the RAF from 1923 to 1928 and the RNZAF until 1938. Via Martyn Chorlton

The wonderful Gloster Gladiator, which was the ultimate in 1930s biplane fighter design, entered RAF service at a time when the new-generation monoplanes such as Hurricane and Spitfire were also beginning to appear. Regardless, 747 were built and many were flown against far superior aircraft during the early years of the Second World War. Aeroplane

fighters and major production activities have always been concerned with the latter class of aircraft. Some interesting prototypes were also built in the inter-war period, however, including the Gannet lightplane, the Guan for high-altitude research, the Goral and Goring bombers, the A.S.31 air survey biplane and a large four-motor bomber and troop transport. The company which Mr W. G. Carter joined in 1937 as Chief Designer was thus well suited to undertake pioneering work. Long experience of the development of high-speed and racing aeroplanes, large-scale production of fighters for the RAF, techniques of metal construction and design of high speed wing sections all served Gloster Aircraft well in their development of jet aircraft

Mr George Carter himself also had a versatile background, including much experience of fighter design. He had been Chief Draughtsman with Sopwith Aviation Co. and later Chief Designer when the company became Hawker Engineering, Ltd. Joining de Havillands, he was responsible for completion of the D.H.72 heavy-bomber design, the construction of which was in fact completed by Glosters. Then followed a period with A. V. Roe on Manchester design, prior to joining Glosters.

The first Gloster design by Mr Carter was itself noteworthy, as it was one of the first British twin-engined single-seat fighters, to specification F.9/37. Prototypes with Peregrine and Taurus engines were built, but this particular class of fighter was only to come into its own when the jet engine became reality. When it did so, Carter was again the first to use two of the new engines for a single-seat fighter, and the Meteor resulted.

Before Meteors were seen in the shops at Brockworth, however, Gloster Aircraft were to complete their wartime task of producing 2,750 Hurricanes and 3,330 Typhoons, while the design staff occupied itself exclusively with the development of the jet-propelled aeroplane.

Development of the MeteorBefore the E.28/39 began to take shape in the factory, the Air Ministry was already planning for the use of jet-propelled fighter aircraft, which they hoped would be in operation before the end of the War. These preparations were considered justified in view of the successful bench running of the early Whittle engines. Thus, early in 1940, Power Jets were authorized to start development of the advanced W.2 engine (from which developed the Rolls-Royce Welland and Derwent), and Gloster Aircraft received a contract for the design of a twin-engine interceptor fighter to Specification F.9/40. George Carter was thus able again to

give his attention to the particular concept of the fighting machine which he had previously used in the design of the Gloster F.9/37. The design was built around the use of two engines, each giving 2,000lb.s.t. and in most respects, the F.9/40 followed conventional practice for a twin-engined aircraft. Early in 1941, Glosters received a contract for the construction of 12 prototypes, followed in September (by which time the E.28/39 had flown for 10 hours) by a production order. The name Thunderbolt was chosen, but was amended to Meteor when the Republic P-47 Thunderbolt appeared.

Again, little time was wasted and the first F.9/40 airframe was ready for flight in July, 1942. Engine development had not kept pace, however, and the two Rover-built W.2B units fitted in the first airframe were giving only 1,000lb at 15,000rpm instead of the designed 1,800lb. With these engines, the aircraft was taxied, on July 10, 1942, on the 3,000yd runway at Newmarket Heath, but a flight was not attempted. ‘Jerry’ Sayer did this taxying trial, but he was killed before the first flight could be made. Michael Daunt thus became responsible for further development flying of the F.9/40, assisted by John Crosby Warren and John Grierson.

Before the W.2B reached a suitable stage for flight in the F.9/40, examples of the Halford H.1 engine (prototype of the de Havilland Goblin) became available, and two were installed in one of the F.9/40s (DG206/G). This aircraft was taken to Cranwell, where taxying trials began on March 3, 1943, at an all-up weight of 11,500lb, 1,500lb more than the W.2B version. Daunt made the first flight on March 5, with tanks half full and engine speed limited to 8,000 rpm, at which the power was about 1,500lb.s.t.

From this point on, development of the prototypes (only eight of which were ultimately completed) progressed rapidly. Rolls-Royce W.2B engines became available and were flown in three of the aircraft; a second airframe was devoted to Halford H.1 engines, another was fitted with Metrovick F.2 axial-flow engines (DG204) slung beneath the wings, yet another was flown with Power Jets W.2/500 and later W.2/700 engines, and the last of the eight took the air in the Summer of 1944 with prototype Rolls-Royce Derwent engines.

In the course of development flying with these aircraft, various problems were encountered, in particular engine

Built to specification F.9/37, only two of these cannon-armed

fighters were constructed. The design was eventually superceded

by the Beaufighter and the Mosquito. Aeroplane

The first Gloster F.9/40 (Meteor) to fly was DG206 by Michael Daunt from Cranwell on March 5, 1943. Aeroplane

The Metrovik F.2 ‘Freda’ powered Meteor DG204/G which first flew on November 13, 1943. The F.2 engines initially produced 1,800lbs of thrust which was increased to 2,000lbs. Not deemed as reliable enough for production, the knowledge gained from the F.2 was later used in the Armstrong Siddeley Sapphire engine. Via Martyn Chorlton

Gloster Meteor F Mk Is of 616 (South Yorkshire) Squadron pictured at Manston having first received the new type on July 12, 1944. Via Martyn Chorlton

surge, a phenomenon of jet operation, as well as aileron instability and flutter at altitude. The aileron problem was eventually solved by the substitution of flat-sided, internally balanced ailerons.

The contribution made by the prototype F.9/40s to knowledge of jet aircraft and engine operation was considerable. From the outset, the airframe proved a reliable mount in which the test pilots quickly gained confidence and it was possible to gain a tremendous amount of experience on the operation of all the early types of British gas-turbines in these airframes.

The F.9/40 was, however, designed as a fighter and all the time the development flying was going on, the production models were being brought forward to an operational status. By this time, too, much had happened in the way of engine development and Rolls-Royce had begun quantity production.

The first Rolls-Royce production engine was the Welland, originally known as the W.2B/23, being derived from the Power Jets original W.2 design. This engine was used to power the first production model of the Meteor (the F Mk 1), 20 of which were built. Many of these were used for special investigations, and the first production aircraft, EE210, went to the V.S.A.

On July 21, 1944, however, 616 Squadron, based at Manston and under command of Wg Cdr McDowell, DFM and Bar, received two non-operational Meteor F Mk Is, the first delivery of jet aircraft to an RAF Squadron. Wg Cdr H. J. Wilson was attached to the Squadron on detachment from Farnborough to help the pilots ‘work up’ on the Meteor. Five operational Mk Is were delivered on July 23, and within ten days the Squadron was flying operationally against V-1 ‘Flying Bombs.’ On the first encounter between a Meteor and a V-1, three of the four 20mm cannon jammed, and on the next encounter, on August 4, 1944, Fg Off Dean had the same trouble. However, he closed with the bomb and ‘toppled’ it with his wing tip, claiming the first success in operation with an Allied jet aircraft. Later on the same day, Fg Off Rogers shot down a V-1 with gunfire and thereafter the squadron gained numerous victories with its Meteor F Mk Is.

Between June 29 and August 17, 1944, with twelve Mk 1 aircraft, 616 Squadron flew 481hrs 45mins, indicative of the ease with which this radical new type was brought into service. General improvement of the airframe led to the Meteor F Mk 3, with increased fuel tankage. The Meteor F Mk 2 was a proposed production version with Goblin engines but did not materialize. The first 15 Meteor F Mk 3s had Welland engines, after which the Derwent was used.

By May, 1945, 616 Squadron, equipped with 15 Meteor F Mk 3s, was with the 2nd T.A.F., based in Germany and engaged on ground strafing in support of the advancing armies. Each aircraft with the squadron averaged 15-20hrs flying during that month but did not encounter any enemy jets.

A proven test-bedAlthough other jet aircraft were then flying in this country and the U.S.A., the Meteor, because of its proven qualities, continued to serve as a test-bed for many problems

concerned with the progress of high-speed flight. For instance, when Rolls-Royce modified the Derwent to drive an airscrew and so produced the first British airscrew-turbine, the Trent, a Meteor F Mk 1, was used to make the flight trials. The first flight by Eric Greenwood on September 20, 1945, was itself an historic event.

Apart from the various operational variants culminating in the private-venture ground-attack Meteor based on the F Mk 8, the airframe also is in continuous use for engine development. The Metrovick Beryl, Rolls-Royce Avon and Armstrong Siddeley Sapphire have all been fitted in special installations, and re-heat on Derwents in the Meteor F Mk 4 is being investigated. A number of problems concerned with the development of special equipment and special techniques, such as the use of petrol in place of paraffin, have been or are being investigated in Meteor airframes.

Thus, in the ten years since the Gloster E.28/39 made its first flight, the Gloster Aircraft Company has made a vital contribution to the development of the jet-propelled aeroplane in Britain. At the end of that ten years, the Meteor, having in the course of its life given so much valuable data on airframe and engine design and operation, is still the mainstay of the RAF Fighter Command interceptor squadrons and its background of development has kept it in the forefront of the world’s jet fighters up to the present day. Doubtless the whole of the ten years’ experience will be used by George Carter in designing a Gloster successor to their Meteor. ✤

From left to right; John Crosby-Warren (Test Pilot), Michael Daunt (Test Pilot), F McKenna, Frank Whittle and George Carter (Gloster’s Chief Designer) in front of DG205. Aeroplane

The private-venture ground-attack ‘Reaper’ which was based on the F Mk 8 airframe. Russell Adams via Martyn Chorlton

The first production Meteor F Mk 1 EE210/G, which was first flown by Michael Daunt, on January 12,

1944. By March the fighter was shipped out to the USA for

comparison testing with the YP-59A Airacomet, making its

first flight from Muroc Flight Test Centre, California on

April 15, 1944. Andy Hay/www.flyingart.co.uk

12

METEOR | 13

The Gloster E.28/39 W4041/G, over the RAF College at Cranwell in Lincolnshire, by Kenneth McDonough. The E.28/39 was never of� cially

named but has retrospectively been referred to as the ‘Whittle’, ‘Pioneer’ and the G.40. Kenneth McDonough

14

The pioneering Gloster E.28/39

The unremarkable (on the outside) E.28/39 was the perfect platform for Frank Whittle’s jet engine – Aeroplane May 1951

High subsonic speci� cationAn order for the Whittle W.1 engine was placed by the Air Ministry on July 7, 1939 and, in September of that year, Glosters were approached with a request that they should undertake the design of an aeroplane in which the engine could be fl own. By this time the company had become a member of the Hawker Siddeley Group. It is only right that we should record here how much the success of Gloster’s jet aircraft developments owes to the foresight and energetic enthusiasm of the Group’s directors. Sir Frank Spencer Spriggs, KBE, managing director of the group, has been chairman of Glosters since 1934. Mr T O M Sopwith, who had seen the engine running in 1939, was tremendously impressed.

A specifi cation, E.28/39, was drawn up for an aeroplane which would basically be of fi ghter layout, armed with four guns and designed for fl ight at high subsonic speeds at high altitudes. The requirement to test the power plant came fi rst and, in fact, neither of the E.28/39 prototypes ever fl ew with their armament fi tted. That they were designed from the outset as fi ghters is noteworthy, considering the radical change in the design of the power plant. Glosters received the contract for construction of two E.28/39s on February 3, 1940, by which time, preliminary layout design had been completed. Considering the time taken to bring many aircraft from design to fi rst fl ight, the achievement of the Gloster/Whittle team in getting the fi rst E.28/39 airborne 15 months later was remarkable, especially in view of the many unknown factors relating to the design.

Clean linesIn appearance, the E.28/39 was an exceptionally clean low wing monoplane, with the pilot mounted well forward of the wing. The jet arrangement was ‘straight through,’ air being taken in through a nose orifi ce, passing on each

METEOR | 15

(main) Very rare colour photo, most likely a still taken from a

cine � lm of the � rst E.28/29, W4041 making a low pass over

Edgehill in Oxfordshire. Aeroplane

W4041 at Brockworth � tted with an un-airworthy W.IX engine, the

� rst taxy run was made by ‘Jerry’ Sayer on April 7, 1941.

Aeroplane

side of the cockpit to the engine in the rear fuselage, and out through the extreme rear of the fuselage. The engine itself was of the ‘reverse-fl ow’ type.

Construction of the aircraft was metal throughout and followed orthodox practice, with a two-spar cantilever wing in two parts joined on the centre line of the monocoque fuselage, all with stressed-skin covering. Control surfaces were fabric covered, with automatic balance tabs in the ailerons, and split trailing-edge fl aps were operated hydraulically by a hand-pump in the cockpit.

The Dowty undercarriage took full advantage of the absence of an airscrew and was one of the fi rst retractable tricycle undercarriages used in a British aeroplane. The nosewheel was steerable and all three units retracted backwards hydraulically, for which there was an accumulator that was rechargeable in fl ight.

Total fuel capacity was 81 gallons in a single tank between the pilot and the engine. This tank, in practice, gave enough fuel for a fl ight of about one hour’s duration at altitude with the W.1 engine. Initially, two radiators were mounted in the air intake ducts, for water used to cool the rear engine bearing; in fact, only one radiator was ever used and eventually air was bled from the compressor to meet this cooling requirement.

Construction of the E.28/39 was started in the Brockworth factory but before completion the prototype was moved to a small garage in Cheltenham to reduce the risk of damage in an air raid. Upon completion in these unpretentious surroundings, W4041, the fi rst E.28/39, was moved back to a hangar at Brockworth. With an un-airworthy W.IX fi tted, the fi rst engine run was made in the hangar, on April 6, 1941. More engine runs, this time with the water cooling system connected, followed the next day, and just after eight o’clock that evening, the late Flt Lt P E G ‘Jerry’ Sayer, OBE, Gloster’s Chief Test Pilot, did the fi rst taxying.

16

Debut in Lincolnshire skiesFor the first flight, Cranwell had been selected for a number of reasons. The long runway was one of the best in the country, with uninterrupted approaches and the airfield was secluded. The fact that Whittle had conceived the jet propulsion engine while at Cranwell, made the choice of airfield most appropriate although this connection was coincidental rather than deliberate.

With the W.1 engine fitted, taxying trials at Cranwell were made on May 14, with 50 gallons of fuel in the tank. Sayer found that acceleration on Cranwell’s smooth, level, grass surface was 100% better than the acceleration experienced during the taxing trials at Brockworth. The following day, the first flight was made. With 50 gallons of fuel, the estimated all-up weight was 3,441lb, and at 16,500 r.p.m the W.1 was giving 860lb.st. The E.28/39 was taken off, with flaps up, on the feel of the elevators, not on air speed, and lifted from the runway after a run of 500 to 600 yds. Sayer wrote: ‘Although the fore and aft control was very sensitive at very small movements, the flight was continued.’

Climb was slow until the undercarriage was raised at 1,000ft, after which it improved, at 16,000 rpm. Gentle turns were made to left and right, but a 2-G limitation on the engine had to be observed. A maximum speed of 240 mph ASI was reached and Sayer reported: ‘The engine ran well and the temperature appeared satisfactory up to the engine revolutions reached.’ The only real criticisms on that flight concerned sensitivity of elevators and slight

Period colour imagery of any British aircraft is rare but the E.28/39 was a little bit more special than the rest. This view of the air intake shows the bifurcated section which directed cold air past the cockpit, en route to the compressor. Aeroplane

fore-and-aft instability.Sayer lowered the undercarriage at 120 mph ASI and

had to use the hand pump to lock the nosewheel down. Flaps were lowered at 100 mph and the approach was made at 90 mph, touching down slightly on the main wheels first. The landing was straightforward and the landing run with the use of brakes was quite short.

Considering the novelty of the power plant and the speed of development of the airframe, this flight cannot be regarded as, an outstanding success. In fact, no major snags were experienced with either engine or airframe during completion of the ten-hour test programme. W4041 made 15 flights between May 15 and May 28, totalling 10 hours 1 minute in the air. In the course of these flights, a height of 25,000ft and a speed of 300 mph ASI were reached.

Upon completion of the 10 hours flying, W4041 returned to Brockworth for modification and installation of a new engine. This was the W.1A, similar to the W.1 but incorporating, for advance testing, certain features of the new W.2 then under design. Other modifications included removal of the water coolant radiators, pressurization of the fuel system, substitution of wings with high-speed G.W.2 section in place of NACA 230-series section, fitting of ground-set trim tabs on the rudder and rearrangement of the instrument panel, etc.

In this form, taxying trials began on February 15, 1942, this time at the RAF airfield at Edgehill. Sayer made the first flight on February 16, again with 50 gallons of fuel and at an all-up weight of 3,476lb. The engine speed was

METEOR | 17

17,000 rpm and 20° of fl ap was used for the take-off . On the second fl ight of this series, 300 mph ASI was attained and the aircraft handled well in manoeuvres up to the limit of 3G. For the next fl ight, Power Jets fi tted an expansion joint between the exhaust cone and jet pipe. Measured level speed on this fl ight was 296mph ASI at 5,000ft at 16,500 rpm.

On this series of trials, troubles were experienced with the engine for the fi rst time. On March 14, after a fl ight of 32 minutes, the exhaust cone was found to be wrinkled and the clearance between the turbine disc and shroud ring was less than required.

The engine was returned to Power Jets, overhauled and re-installed by March 24. On the second fl ight on that day, however, during an attempted climb to 30,000ft, a turbine blade broke. This was the fi rst time such a thing had happened and it is interesting to record Sayer’s description. ‘At 3,000ft a very sudden change of note occurred followed by serious engine vibration. The engine was immediately throttled back to the idling position. All the engine instruments were very rapidly checked and no erratic readings were observed.’ It was considered that as the instruments (particularly the turbine exhaust pyrometer) were not indicating abnormal fi gures that an attempt could safely be made to force land at Edgehill rather than at a strange RAF aerodrome ten miles east of Edgehill and this was satisfactorily accomplished on the fi rst runway which could be reached. The engine revolutions were kept down to 10,000 as above this fi gure the vibration was bad. ‘On investigation it was found that half of one turbine blade had broken off , causing damage to some

METEOR | 17

vibration. The engine was immediately throttled back to the idling position. All the engine instruments were very rapidly checked and no erratic readings were observed.’

The � rst E.28/39 in its purest, un-modi� ed form during � ight trials at Edgehill. During this period the aircraft was given the code name Tourist 1. Aeroplane

Jerry Sayer’s Test Flight Report for the � rst � ight of the E.28/39 W4041 on May 15, 1941 at 1940hrs for just 17 minutes. In the entry for

‘Airscrew: Type and No.’, Sayer has typed ‘No airscrew � tted with this method of propulsion’. Aeroplane

of the adjacent blades.’After repair by Power Jets, the engine was re-installed

and another climb to 30,000ft was attempted on June 3, 1942. A faulty barostat control valve cut off the fuel supply above 12,500ft, however. On June 6, Sayer fi nally did get to 30,000ft, taking 28 mins 25 secs from 1,000ft, but the engine failed after 2 mins level fl ight at that height

because the oil froze and starved the gearbox and front and rear bearings. Sayer successfully force-landed at Edgehill with the engine off .

A new W.1A was installed for the next tests, which began at Edgehill in September 27, 1942. Immediately after take-off , the high oil pressure dropped, and the engine had to be throttled back. Sayer did a masterly job in getting the E.28/39 round to land back on the airfi eld, although one wing-tip touched the ground and was slightly damaged. Less than a month later, ‘Jerry’ Sayer was killed while fl ying a Typhoon and Britain lost one of her fi nest test pilots.

From record breaker to museum pieceUp to that time, Sayer alone had been responsible for all jet development fl ying in this country and his concise and detailed reports were of immeasurable value in those early days. The E.28/39 had by then been proved, however, and it’s subsequent testing was of a more routine nature. Certain dates are worth recording, however. Michael Daunt recommenced the tests on November 6, 1942, and at the end of that month, W4041 was moved by road to Farnborough, where the fi rst fl ight was made on December 12. On December 24, 340mph ASI was reached in a dive and level speed tests were made at 30,000ft on December 29, measured speed being 188mph ASI.

On March 1, 1943, John Grierson made the fi rst fl ight of W4046, the second E.28/39, at Edgehill. This was fi tted with the 1,220lb thrust Rover W.2B engine and had the NACA 230-series wings, as did W4041 originally. Later, the 1,400lb Rolls-Royce W.2B/23 engine was fi tted, Michael Daunt making the fi rst fl ight on April 16. Immediately following this, the fi rst cross-country fl ight was made, in order that the E.28/39 might be displayed before the Prime Minister at Hatfi eld.

This aircraft was eventually written off on June 30, 1943, in a crash from 33,000ft after the ailerons had jammed on a fl ight from the RAE. This was not before it had reached the greatest speed of either prototypes, however, 466 mph achieved on the 1,526lb thrust of a new W.2B engine.

Meanwhile, W4041 had been re-engined again, with the third Power Jets W.2/5000, and now weighed 4,180lb. Tailplane incidence was increased, fi xed trimming tabs fi tted to each elevator, the rudder tab replaced by channel-section strips down one side and an R-type automatic observer fi tted.

Michael Daunt made the fi rst fl ight at Brockworth on May 23, 1943, beginning the fi nal series of Gloster tests on

Rear fuselage detail of W4041/G, following additional � ns being � tted on the tail plane, to improve stability at high speeds. The ‘G’, stood for ‘Guard’ and indicated how sensitive this aircraft was. Aeroplane

because the oil froze and starved the gearbox and front and rear bearings. Sayer successfully force-landed at Edgehill with the engine off .

installed for the next tests, which began at Edgehill in September 27, 1942. Immediately after take-off , the high oil pressure dropped, and the engine had to be throttled back. Sayer did a masterly job in getting the E.28/39 round to land back on the airfi eld, although one wing-tip touched the ground and was slightly damaged. Less than a month

Typhoon and Britain

METEOR | 19

the type. During June, John Grierson persistently attempted to reach 40,000ft in W4041. On June 4, a transparent panel in the cockpit cracked at 34,500ft and a careful descent had to be made.

After breathing pure oxygen for 30 minutes, Grierson took off on June 24 and in a climb lasting 27 minutes, reached 41,600ft (42,170ft asl), the highest altitude reached with a British jet up to that time. Fuel shortage prevented speed measurement at that altitude but Grierson noted the rate of climb at 38,000ft as 800ft/min. The E.28/39 was then transferred to the RAE for a fi nal series of tests, completed early in 1944, since which time it has been carefully preserved, as befi ts an aircraft of such a historic nature. The fi rst opportunity for public inspection of the type came in June, 1945, when it was displayed in the ‘Britain’s Aircraft’ exhibition in London. On April 27, 1946, it was installed in the Science Museum where it now rests, a pioneer among pioneers. ✤

Technical DataPOWERPLANT: One 750lb Power Jets turbojet for ground use only; One

860lb Power Jets W.1; one 1,160lb W.1A; 1,700lb (later 1,760lb) Power Jets W.2/500 turbojet; One 1,200lb Rover W.2B and fi nally one 1,526lb Rover W.2B turbojet (W4041).

FUEL/OIL: Fuel, 81 gal; Oil 1 gal.

DIMENSIONS: Span, 29ft; Length, 25ft 3¾in; Height 9ft 3in; Wing Area, 146.5 sq ft; Track 7ft 10in.

WEIGHTS: Empty, 2,886lb; Loaded, 3,748lb.

PERFORMANCE: Max Speed 466 mph at 10,000ft; Landing speed, 86 mph; Climb rate to 30,000ft, 22min; Service ceiling, 32,000ft.

PRODUCTION: Two F.28/39s (W4041 and W4046) built by Gloster Aircraft Co. Ltd, Hucclecote, Glos in 1941 and 1942.

Engine access of the E.28/39 was excellent; the whole rear fuselage could be removed for major servicing and changes. This technique was later adopted by a range of American-built � ghter jets, beginning with the F-86 Sabre. Aeroplane

The prototype Gloster E.28/39 W4041/G which has been on display in the Science Museum, Kensington since April 28, 1946. Andy Hay/www.fl yingart.co.uk

20

After several teething problems with its Metropolitan-Vickers F.2/1 engines, F.9/40 DG204G was � rst � own at Farnborough by Wg Cdr H J Wilson on November 13, 1943. Prior to this, the aircraft spent a great deal of time at Glosters’ little known Bentham experimental department where it is pictured outside the facility’s single hangar, tethered to the ground, ready for another engine test. Via Martyn Chorlton

METEOR | 21

22

Gloster Chief Test Pilot, Eric Greenwood, at the controls of Meteor F Mk 3, EE230 which � rst � ew in September 1943. 210 F Mk 3s were built, all at Hucclecote, between November 1944 and December 1946. Aeroplane

METEOR | 23

24

Britain’s � rst twin jet � ghtersMost new civil and military aircraft pass through a series of design confi gurations before reaching a fi nal and (hopefully) satisfactory layout, which will then be selected for construction. The Meteor jet fi ghter was one type to go through this route and recently two drawings have been uncovered at the British National Archives which reveal confi gurations considered long before the fi nal prototype design had been established. They make interesting viewing and can certainly be considered the start point for the Meteor story, since they are undoubtedly the fi rst twin jet fi ghter projects to have been drawn in this country.

The fi rst design (drawing number ZC.26194 dated March 13, 1940) shows an aircraft with the engine nacelles placed very close to and almost blended into the fuselage. Powerplant would have been two Whittle

The First Meteor DrawingsBy Tony Buttler

AMRAeS

jet engines but such is the condition of the original drawing it is no longer possible to tell what type had been specifi ed. Alternative armaments are illustrated – the port wing has three cannon with an assisted belt feed while the starboard wing has a single cannon inboard and then a battery of fi ve machine guns outboard. This fi ghter had a span of 46ft 0in (14.02m) and a length of 42ft 4in (12.90m) and the drawing has the number F.9/40 written on in crayon (this specifi cation was eventually drawn up to cover the Meteor but was not issued until November 29, 1940, so it would not have been in existence when the drawing was prepared).

The wing on the second design (drawing ZC.26728 of April 8, 1940) has the engine nacelles a little further out, thereby providing space for six of the eight cannon carried by the aircraft to be mounted in the very thick inner wings.

The First Meteor Drawings

Reproduction by Chris Gibson of Gloster drawing ZC.26194, dated March 13, 1940. The original forms � le Avia 30/1751 in the National Archives. Chris Gibson

Chris Gibson’s reproduction of the second jet � ghter drawing

ZC.26728, which is dated April 8, 1940. File Avia 30/1752 is the

original. Chris Gibson

METEOR | 25

The other pair went in the lower nose and the powerplant was two Whittle Series II engines. Here the span is 43ft 0in (13.11m) and length 42ft 4in (12.90m).

On each layout the cockpit canopy in particular and some of the fuselage have much in common with the Gloster Reaper twin-piston engine fi ghter project from mid-1940 which was designed as a night fi ghter. Each of these jet fi ghters has a beautiful elliptical wing shape quite unlike that used on the Meteor (this is most pronounced on the second), while the empennage was in due course revised with the horizontal tailplane being moved further up the fi n (based on Spitfi re experience, would these elliptical wing shapes have been more diffi cult to manufacture than a Meteor wing?). Both designs also have a modern tricycle undercarriage, but with quite large wheels.

SpeculationSince there is currently no documentation to go with these projects one is left to speculate what thoughts might have been going through the head of Gloster designer George Carter and the planners. Eight cannon made for a formidable set of weaponry, as did the cannon and machine gun mix which was far more powerful than contemporary piston fi ghters (it is assumed that the cannon would be the Hispano). Indeed, when it fi rst fl ew in August 1942 the Martin Baker M.B.3 with its six 20mm Hispanos was at that time considered to be particularly heavily armed. Back in 1940, it is understood that the thinking was that the higher speeds off ered by jet engines

would permit less fi ring time at an opponent, so more guns would provide a greater likelihood of hitting a target a suffi cient number of times to bring it down. If the fi ghter was overtaking a relatively slow bomber target at high speed there would be a very limited time for engagement, so the more shells fi red per second the better. In fact it was calculated that rate of fi re was important because a higher overall rate increased the pattern density, and thus at long range the chance of a hit. Most current and forthcoming piston-powered cannon fi ghters, however, (for example the Westland Whirlwind) had just four cannon while the Meteor itself was originally slated to carry six, but two of these were subsequently deleted.

A further question is why both designs have two crew when the Meteor prototypes were all single-seat? The Hispano cannon on early Bristol Beaufi ghters had 60-round drums which could be changed in fl ight by the radar operator (he could also clear some stoppages), and in addition, Spitfi res with the earliest version of the cannon also had a drum feed. So would the second crewman on these aircraft have been required to keep the Hispanos loaded (although on the fi rst design this would not have been possible with the positioning of the guns)?

These drawings were made over seventy years ago but they are priceless in fi lling another gap in the background to Britain’s fi rst jet aircraft.

AcknowledgementsThanks to Chris Gibson, Anthony Williams, and the staff of the National Archives for their help with this article. ✤

Gloster Meteor prototype DG202/G. Via Tony Buttler

For comparison, this view shows production Meteor F Mk I EE211. Via Tony Buttler

26

Two Meteor F Mk 4s of 266 (Rhodesia) Squadron and RA481, in the distance, from 222 Squadron. While the fate of ‘W’ in the foreground is unknown, VT114 beyond became one of the many Meteor loss statistics of the early 1950s. Whilst serving with 205 AFS at Middleton St George, both of VT114’s engines cut on approach, forcing the pilot to crash land short of the runway. The pilot walked away, but VT114 would never fly again. Aeroplane

METEOR | 27

28

The backbone of RAF Fighter Command

The day fi ghter variants of the Meteor gave the RAF the jet aircraft they so desperately needed as the Cold War began to gain pace during the late 1940s and 1950s. Owen Cooper summarises the Meteor F Mk 1 to F Mk 8.

The fth of 20 Meteor F Mk 1s built was EE214 which never entered operational service instead, it spent most of its � ying career with the RAE and Defford. Via Martyn Chorlton

Another auxiliary unit that operated the F Mk 3 was 504 (County of Nottingham)

Squadron, from Colerne, later detached to Andrews Field and Lübeck. EE317 was one

of the early Meteors that served the squadron from April to August 1945.

Via Martyn Chorlton

METEOR | 29

Second World War debutDuring the summer of 1944, Britain was being relentlessly attacked by waves of V-1 Flying Bombs and, despite the best efforts of the ground defences, it was up to the RAF to deal with them. It was in this unique theatre of war that the RAF introduced its new jet fighter and its first success came without firing a shot. Fg Off T D ‘Dixie’ Dean, in Gloster Meteor F Mk 1 EE216 of 616 (South Yorkshire) Squadron, closed in on a lone V-1 over Kent on August 4, 1944. On pressing the fire button, his 20mm Hispano failed to fire but, determined to stop the flying bomb from reaching London, Dean closed, on his prey at 400 mph. Side by side, Dean gently tipped the V-1 over sending it plunging into the Kent countryside. Only a few minutes later, Fg Off J K Roger became the first pilot to successfully shoot down a V-1 with cannon fire. Within weeks, the V-1 threat had subsided as their launching sites were overrun by the Allies.

Meteor Early DevelopmentThe Meteor story began in 1940 with the issue of Air Ministry specification F.9/40 for a Frank Whittle W 1 turbojet powered fighter. Delivering just 860lbs thrust, the new design warranted a twin engine layout because a single turbojet would fall short of the performance needed for the new fighter. Eight prototypes were ordered followed by 20 production aircraft in September 1941, initially called the ‘Thunderbolt’ which was later changed to Meteor in March 1942 to avoid confusion with the P-47.

In the meantime, the Air Ministry must have placed great faith in the Gloster engineers because the experimental E.28/39, W4041, had only just made its first flight at Cranwell on May 15, 1941. Britain’s first jet

powered aircraft, flown by Flt Lt P E G Slayer, went on to achieve a very productive and successful flight programme, laying the foundation blocks for the new Meteor.

DG202 was the first Meteor completed, powered by Rover-built W 2B turbojets which, at 1,000lbs thrust each, were not powerful enough to get the new aircraft off the ground! Therefore, DG202 was relegated to taxying trials and the honour of the first flight fell to the fifth prototype, DG506. In the hands of Michael Daunt, DG506 first flew, once again from Cranwell, on March 5, 1943 powered by a de Havilland Halford H1 engines, developing a more respectable 2,000lbs of thrust. DG207 also took to the air fitted with a pair of Halfords, while the remaining prototypes flew versions of the Whittle W 2 and W 2B. The exception was DG204 which was powered by a pair of Metropolitan-Vickers (Metrovick) F 2 axial-flow turbo-jets.

Engines were obviously key to the success of the Meteor and while the prototypes were busy exploring new envelopes of flight, the manufacture, crucially, of the Whittle engine moved from Rover to Roll-Royce. As a result, the W 2B/23 Welland was produced at 1,700lbs thrust, first flying with DG205 in June 1943. It was this engine which was selected for the production version of the Meteor, the F Mk 1.

F Mk 1 to F Mk 4The first production F Mk 1, EE210, made its maiden flight on January 12, 1944 from Gloster’s own airfield at Moreton Valence. The performance of the F Mk 1 could not be classed as scintillating with a maximum speed of 385mph at sea level rising to 410mph at 30,000ft; about the same pace as a Griffon-engined Spitfire. Its armament was four

The Meteor F Mk 3 served with 616 Squadron from January to August 1945, then again from January 1949 to May 1951. EE234, the 5th production F Mk 3, was one of the aircraft that saw service during the closing months of the Second World War. Andy Hay/www.flyingart.co.uk

Rare view of F Mk 3 EE303 whilst serving with 245 Squadron for a second time, at Lübeck, on October 29, 1946. The fighter was wrecked on December 18, 1947 when it ran out of fuel in poor weather and force landed at Horsford in Norfolk. The pilot escaped without injury. Via Martyn Chorlton

20mm Hispano Mk III cannon mounted in pairs on each side of the forward fuselage. EE210 was sent to the USA in exchange for a P-59 Airacomet which arrived at Moreton Valance in September 1943. Technical information had already been traded with the US but exchanging aircraft was taking it to a new level.

Only 20 F Mk Is were built and it was an auxiliary unit, 616 (South Yorkshire) Squadron, which was the first to receive the new aircraft on July 12, 1944 at Culmhead. The squadron moved to Manston,

flying the Meteor’s first operational sortie, chasing V-1s, from this airfield on July 27.

An all-Meteor unit by the end of August 1944, the squadron was now looking towards the air war over Europe and the increased activity of the Luftwaffe’s own jet, the Me262. It was impossible to practice jet-on-jet fighter combat owing to the fact that the Meteor was the only allied jet in service, but exercises between USAAF fighters such as the P-47 and P-51 taught them how best to attack or defend against a jet. In January 1945, 616 Squadron moved to Colerne, except one flight which

joined the 2nd Tactical Air Force, moving to Melsbroek near Brussels. These few aircraft became the first jet fighters to serve on the continent, although it was not until April 17, 1945 that the first operational sorties were flown. No Luftwaffe jets were ever encountered but the squadron was credited with destroying 46 German aircraft on the ground with the loss of just two aircraft.

By this time, 616 Squadron were flying the Meteor F Mk 3, which first flew on the September 11, 1944. The first batch of 15 F Mk 3s were still powered by a modified Welland engine. The rest, which amounted to a total production run of 210 aircraft, introduced the more powerful Rolls-Royce W.2B/37 Derwent I engine which still only developed 2,000lbs of thrust. However, speed at 30,000ft now rose to just under 500mph and a ceiling of over 40,000ft could be attained. Other changes included a much, improved rear-sliding clear one-piece canopy compare to F Mk 1s clumsy side-opening type. This new canopy was a by-product of the Meteor F Mk 2, of which only one, DG207, was built. Another significant improvement was increased fuel capacity. The F Mk 3 went on to serve with 18 RAF Squadrons during the immediate post-war period, helping to bolster Britain’s air defence network and keeping an uneasy peace on the Continent.

Engine development was progressing considerably faster during the immediate post-war years and Rolls-Royce in particular were moving on in leaps and bounds. Their latest engine, the Nene, was too big to fit into a Meteor nacelle but a scaled version, known as the

30

Two of the Meteor F Mk 4s 20mm Hispano Mk V cannons with

access panels removed. Aeroplane

F Mk 4 VT242 would have appeared in many pilot logbooks having served with 43 Squadron, 63 Squadron (shown here), 226 OCU, 203 AFS and 8 FTS. The fighter was SOC November 11, 1954. Andy Hay/www.flyingart.co.uk

Derwent V, would. Developing 3,500lbs of thrust, F Mk 3 EE360 first flew with the new engines on August 15, 1945 with Eric Greenwood at the controls. EE360 effectively became the F Mk 4 prototype and the new engines turned the Meteor into a completely different aircraft. Pilots suddenly experienced proper acceleration and, in no time at all, the new F Mk 4 was pushing 585mph at sea level. The F Mk 4 also benefitted from a pressurised cockpit, lighter ailerons and, later, the ability to carry under wing stores including a large ventral fuel tank which would be adopted for all future marks of the Meteor.

The first F Mk 4s to enter RAF service were EE454 and EE455 which joined the RAF High-Speed Flight in late 1945. 535 F Mk 4s entered RAF service, the first, in December 1947, arrived at Horsham St Faith to equip 74, 245 and 263 Squadrons. 24 front line squadrons went to be equipped with the F Mk 4, the last being delivered in April 1950 and they continued to serve on the front line until late 1954.

The Meteor F Mk 8The development of the Meteor day fighter had now reached a crucial stage and Hawker were now making rapid advances over Gloster with the Hunter now taking over the mantle of the RAF’s main interceptor. As early as 1947, the Gloster design team was looking at the ‘second generation’ aircraft which would evolve into the Meteor F Mk 8. A development of the F Mk 4, the new mark was a more attractive machine, with its lengthened fuselage, slightly longer nose, redesigned tail unit and bubble canopy. The longer fuselage allowed for an additional 95 gallon fuel tank and significantly more power was provided by a pair of Derwent 8s, developing 3,600lbs of thrust. One of the most significant additions that came with the new mark was the fitment of a Martin-Baker ejection seat, which provided the pilot with a greater reassurance of actually surviving if something went wrong, compared to earlier marks were escape, except at high altitude, was near impossible. Thanks to the Derwent 8, the Meteor F Mk 8’s performance was pushed up to just less than 600mph at 10,000ft and the modified design meant that the aircrafts handled was also greatly improved.

The prototype F Mk 8 was VT150 which first flew on October 12, 1948, although F Mk 4 RA382, with the new mark’s lengthened fuselage, had already proved that the design worked well in late 1947. The F Mk 8 first entered service with 245 Squadron at Horsham St Faith on June 29, 1950 in place of the F Mk 4. 1,090 (590 built by Gloster and 500 by Armstrong Whitworth) F Mk 8s were eventually delivered to the RAF between December 10, 1949 and April 1954, replacing the F Mk 4 and Vampire FB Mk 5 throughout Fighter Command.

During the Coronation Review in 1953, 216 F Mk 8s flew in formation for the Queen as she took the salute at RAF Odiham. The following year, the F Mk 8 made its presence felt at the Battle of Britain flypast but, by 1955, the age of the Hunter had already arrived and Meteor numbers began to decline rapidly.

The Meteor F Mk 8 served 31 front line RAF squadrons (including ten Royal Auxiliary Air Force squadrons) until 1961 and almost as many training units during the type’s long career. Several went on to be modified to TT Mk 8s and served for many years later towing target banners using a towing hook installed in the ventral tank. One aircraft, VZ467 remained in this role with the TWU at Brawdy until 1977.✤

METEOR | 31

(top) The very first production F Mk 8, VZ438, which only ever served with the RAE, pictured at Moreton Valence in November 1949. Via Martyn Chorlton

(above) A fighter squadron through and through, 19 Squadron operated the Meteor F Mk 8 from April 1951 to January 1957 from Church Fenton, North Yorkshire. Aeroplane

32

The Meteor F Mk 8 was a very popular aircraft which featured, amongst many things, a Martin-Baker ejection seat and more responsive Derwent 8 engines. The latter made formation � ying much easier as demonstrated by 19 Squadron out of Church Fenton in 1952. Aeroplane

METEOR | 33

34

Progressive developmentNearly five years ago the late Sqn Ldr ‘Wimpey’ Wade, then on the staff of The Aeroplane, writing of the flying qualities of the Meteor F Mk 4, said of its remarkable performance: “.... it is virtually impossible to use full throttle without exceeding the structural limitations of the airframe.

No reflection on the Meteor F Mk 4’s construction should be read into this statement but the significance of present day engine development cannot be more easily realized than by appreciating this fact. As anyone whose job it is to overcome this difficulty realizes only too well, in the Meteor F Mk 4 we have reached a limit in conventional airframe design.”

We have now come to 1951 and Meteor T Mk 7s, F Mk 8s, FR Mk 9s, PR Mk 10s and NF Mk 11s are being turned out in great numbers, each with a different role to fulfil. This does not imply that Sqn Ldr Wade was wrong. On the contrary, later marks of Meteor have certainly been refined and improved but their performance has not drastically changed and cannot be expected to increase much in the future.

Future fighters will have to incorporate new structural and aerodynamic design and, needless to say, work is going ahead on such aircraft. For all that, however, the Meteor F Mk 8 is a very fine aircraft and one that will

Flying the Meteor F Mk 8 By Derek D Dempster - The Aeroplane – May 11, 1951

43 Squadron four-ship, which operated the Meteor F Mk 8 out of Leuchars between September 1950 and September 1954. The ‘SW’ code was only used up to April 1951 which gives us a good idea of when the photo was taken. Nearest the camera is VT256 which previously served with 266 Squadron and then after 43 Squadron service was transferred to 63 Squadron, 233 OCU and finally 215 AFS before conversion to a U.15 drone. The aircraft was SOC in Australia on May 14, 1959. Aeroplane

continue to play an important part in military aviation for some time to come. Recently we were given the opportunity to fly one and to gain some first-hand impressions of its performance and handling characteristics.

The Meteor F Mk 8 is a progressive development of the F Mk 4 with the forward fuselage lengthened by 30 ins., to make way for an enlarged fuselage fuel tank carrying 325 gallons. The tail unit has been modified in outline with square tips to the tailplane; straight leading and trailing-edges to the fin and rudder; and elimination of the under-keel surface and tail skid. The cockpit canopy is a single-piece moulding, the whole thing sliding back and forth on rails and electrically operated, which is a great improvement.

A great many other improvements have also been made, principally the fitting of an ejector seat. Most notable of other, smaller, refinements is the repositioning of the ground/flight switch and the starter-battery cable socket, which are now forward of the retractable step. No longer do the ground staff have to grovel under the port wing looking for the switch in the murky darkness of the wheel bay.

Pre-flightAccess to the cockpit is by way of two fixed footsteps covered by spring-loaded flaps. The upper of these incorporates a hand-hold. There is also a retractable footstep, lowered by pulling an external lowering handle, which retracts automatically when the undercarriage selector lever is moved to the ‘up’ position.

Climbing in and out of the Meteor cockpit with a parachute alone is fairly easy, but if a K-type dinghy is attached to the seat pack, the manoeuvre becomes extremely awkward. Installation of a Martin Baker Mk 3 seat with fitted dinghy and parachute which enables the pilot to get in and out of the cockpit with agility will be a welcome improvement.

The Martin Baker Mk 1 ejector seat is a standard fitting to all F Mk 8s and is fired by pulling out a large, red handle

WH347 was one of a batch of 200 Meteor F Mk 8s that were delivered to the RAF between September 1951 and February 1952. The fighter only served with the CGS and was lost on April 13, 1953 after structural failure caused it to violently crash one mile east of Skirlaugh, Yorkshire. The 21-year old pilot, Fg Off I Tacchi, was killed. Aeroplane

METEOR | 35

immediately above the head-rest. This handle draws out from the head-rest a flexible face blind, which protects the occupant from the effects of the airstream at high speed. Knee guards are fitted to the seat pan to prevent the knees from fouling the cockpit side during an emergency exit, and with foot rests to hold the feet and legs firm at the moment of ejection. Chutes allowing the feet to slide direct from the rudder pedals to the foot-rests without raising them off the floor (which would be almost impossible if the aircraft was subject to positive acceleration at the moment of escape) are also provided.

As already mentioned, the single-piece moulded Perspex canopy with its metal rear portion is electrically operated. It can, however, be pushed back by hand from the outside of the aircraft, after it has been released from its operating mechanism by turning the external release handle, which frees the clutch. From the inside, the hood is operated by two push buttons situated beneath the cockpit coaming on the starboard side. The closing button operates immediately but there is a time lag on the opening button, to allow the pressure seal to deflate.

Pressurization of the cabin is automatic if the selector lever is in the appropriate notch. An automatic valve starts to increase the pressure at 7,000ft and at 24,000ft the full differential pressure is 3lb per sq in. Cabin altitude at 10,000ft, 20,000ft, 30,000ft and 40,000ft is 7,500ft, 13,000ft, 17,000ft and 23,000ft respectively. Cabin temperature is automatically controlled by a thermostat. Cockpit layout is traditionally Meteoric with everything coming easily to hand but positioning of switches and levers gives the impression of being rather haphazard, although no doubt there are good reasons for the various locations. Low and high-pressure pumps are situated on each side of the seat pan, moving in a vertical plane. The throttles, as on other Meteors, are mounted on a rail on the port side of the cockpit and have built in friction. The starboard engine throttle lever incorporates the radio transmit button.

Below the throttles is the dive-brake lever and just forward, on the port side of the instrument panel, are the undercarriage and flap levers. These have been extended to

allow the occupant, who is seated farther aft than in previous Meteors, to reach them without difficulty. Trimmer controls and the fuel-balance cock are somewhat awkwardly placed to the left of the seat pan and access to them is obstructed by the knee guards of the ejector seat. However, as changes in trim in general flying are negligible and the balance cock is infrequently used, the positioning is of minor importance and regular pilots of the type will soon accustom themselves to the peculiarity. The rudder trimmer is a small knob but is quite adequate for the job.

A G.4.F compass is fitted in place of a directional gyro on the instrument panel, which is quite conventional. Above the panel is a retractable gun sight and below are the oil pressure gauges, the phase meter and three fuel gauges, one for each tank. On the starboard side are the engine fire extinguisher buttons, pitot head heater switch, G.4.F compass switch and other switches.

All emergency operating levers, including the emergency undercarriage handle, are on the right-hand side of the seat. The canopy jettison handle is below the cockpit coaming on the right-hand side also. The stick type control column has a pistol grip, which incorporates the bomb release and rocket firing buttons. The brake lever is mounted forward and, to my mind, is rather awkward to operate in the event of having to apply the brakes hard after landing. It is difficult to reach with the fingers while holding the stick back.

For engine starting, the action is first to have the ground crew turn on the ground/flight switch, ensure that the throttles are fully closed and then turn on the booster pump of the required engine and press the starting button. The rest can be left to the main starter, which energizes the automatic starting equipment in the aircraft.

There is a pause of about five seconds before the rpm indicator starts climbing and at 1,000 rpm. the high-pressure cock lever is eased slowly down to the half-way mark. As the rpm increases it is moved to its full extent and when the engine reaches the idling speed of 3,000 rpm the other engine may be started.

To move the aircraft forward, about 8,000 rpm are

Dramatic four-ship, line astern, going over the top, by four Meteor F Mk 8s of 65 Squadron, then operating from Duxford. The squadron flew the Meteor F Mk 8 from February 1951 through to February 1957, replacing the Gloster fighter with the Hunter from November 1956. Aeroplane

36

required, but once safe taxying speed is reached the throttles may be closed right down. There is enough thrust at idling rpm to propel the aircraft over smooth surfaces. The use of brakes at all times while taxying is recommended except when negotiating sharp corners, for which alternate engines can be used.

Visibility forward and to the side is excellent and the only disturbing feature of the windscreen is the de-mister filaments that run parallel horizontally. Rearward vision, on the other hand, is very bad because of the metal rear portion of the hood. Obviously there is much room for improvement here; rearward vision is of paramount importance in a fighter.

On the ground the aircraft moves with extreme smoothness and the manoeuvrability of a high-powered car. Brakes are good and effective and it is possible to pull up in a very short space in the event of an emergency.

Communication by RT is clear but at the time of my flight, Gloster’s frequency seemed to have a built-in background of news bulletins and musical programmes which, at high altitude, gave the impression of proximity to harps and angels.

For take-off, elevator and rudder trimmers are set to neutral, the flaps raised, unless required for a short runway take off for which they are lowered a small amount and the dive-brakes housed. Pitot-head heater, heated windscreen panel and G.4.F compass switches should also be turned on. The windscreen panel switches are not grouped together which is rather unsatisfactory. One of them is on the windscreen frame and the other on the starboard side of the cockpit. Prior to take-off, the aircraft is taxied forward to straighten the nosewheel. This done, the brakes are fully applied and the throttles are opened

gently to 12,000-13,000 rpm, whereupon the aircraft will start to creep against the brakes. (If it starts to creep before the rpm reach 12,000, the flight should be abandoned until the brakes are adjusted.)

AirborneOn releasing the brakes, the aircraft moves forward with considerable speed and as the throttles are opened to the full extent, acceleration is very marked. There is no tendency to swing whatsoever. At 80 knots the nose wheel eases off the ground and before 120 knots are reached, the aircraft unsticks-all with slight coaxing from the pilot. One has to be quite smart in retracting the undercarriage once the aircraft is airborne, as the speed starts to build up very rapidly. I had the ASI registering 170 knots by the time I crossed the Moreton Valence aerodrome boundary.

Undercarriage retraction, which is very much slower on the F Mk 8 compared with previous Meteors, causes no apparent change in trim. The reason for extending the time for retraction and extension is to prevent overstraining and breaking the hydraulic jacks, which have, in the past, been common Meteor faults.

After take-off I stooged around the circuit getting the feel of the controls while waiting for Sqn Ldr Waterton, Gloster’s Chief Test Pilot, to take off in a T Mk 7 with our photographer. In comparison with the ‘Seven’, the controls as a whole are far lighter and answer to movements of the stick with greater rapidity, especially in the case of the ailerons which are delightfully light. Rolling is a sheer joy and I was tempted to devote most of the flight to indulging in the strenuous art of jet aerobatics.

Formation on the photographic machine was quite easy, but Bill Waterton decided to take over the positioning to enable the photographer to get some really close shots. On completion of the photographic interlude, I opened the taps fully and climbed to 27,000ft. To get the best rate of climb with full power, a speed of 285 knots should be assumed, decreasing by two knots every 1,000ft above 10,000ft, three knots per 1,000ft, above 20,000ft and four knots per 1,000ft above 30,000ft. Climb on the Machmeter is recommended and the settings, when no wing tanks are carried, should be: 0.5 IMN (Indicated Mach Number) from sea level to 10,000ft, 0.55 from 10,000 to 20,000ft, 0.6 from 20,000 to 30,000ft, 0.65 above 30,000ft and 0.70 above 40,000ft.

When climbing at full power one has to be far more jet-pipe temperature conscious than rpm conscious, and it is advisable to keep an eye on the temperature gauges all the way up. At 14,600, or peak rpm, the temperatures are

Six Meteor F Mk 8s of 245 Squadron, a unit which was reformed at Colerne with the F Mk 3 on August 10, 1945. After several moves, the unit settled in Norfolk at Horsham St Faith from late 1947, later receiving the F Mk 8 from June 1950. Aeroplane

Meteor F (TT) Mk 8 WH291of 79 Sqn/229 OCU turning on the finals at Chivenor after returning from a target towing sortie during November 1973. The Meteor is still extant today in component form! Aeroplane

Meteor F Mk 8s viewed from the control tower at Duxford in the mid-1950s. In the foreground is WK887, which originally served with 64 Squadron (stationed at Duxford) before becoming part of the station flight. The aircraft went on to serve with 65 Squadron, 228 OCU, 29 Squadron, Geilenkirchen station flight and finally 85 Squadron. The busy fighter saw out its days at Manston for fire practice in the early 1970s. Aeroplane

Exercise ‘Ardent’ – The biggest air exercise ever to be held in peacetime is now taking place over the United Kingdom. The object of the exercise will be to subject the UK Air Defences to intensive operations such as might be experienced in war. Aircraft involved will fly several thousand sorties to test the defences and will try out a variety of methods of attack. A pair of 600 (City of London) Squadron scramble from Biggin Hill on October 10, 1952. Aeroplane

METEOR | 37

in the region of 640°C. The maximum engine limitation for the climb at full throttle is 15 minutes, and the temperatures should at no time be allowed to exceed 680°C. Care must be taken to avoid exceeding the engine limitations at high altitudes.

Aircraft attitude in the climb is extremely steep and it is hard to believe that it can be sustained. All the same, the high angle of the nose is maintained all the way up. It is quite amusing to watch the altimeter rapidly unwinding itself as fast as it can go and the VSI (Vertical Speed Indicator) needle practically round the dial. The present VSI seems quite inadequate for the job in hand and a new one could well be designed for fast-climbing aircraft.

Time taken to 27,000ft from 5,000ft, where I left the photographic machine, took about 5 minutes 45 seconds. This more or less agrees with the climb performance graph for the ‘clean’ aircraft. At height, as at low level, longitudinal changes in trim are slight. The ailerons are effective but increase in heaviness as speed is increased. The rudder is powerful and effective but heavy and very sensitive to trim at high speeds. While at height, I opened up to try out the effects of compressibility. At 0.78 IMN there is a slight nose-up change in trim but considerably less than on the T Mk 7. It is unadvisable to trim forward, as the nose will go down quite rapidly the moment power output is reduced. Slight snaking is apparent but on the whole the aircraft is very steady and provided the rudder is held firm the aircraft is a good gun platform at these high speeds. Above 0.78 IMN, I pushed on to 0.82, the starboard wing starts to drop and the aeroplane tends to yaw to starboard, the out-of-trim force increasing quite rapidly. Immediately the throttles are closed full control is regained.

The dive-brakes, fitted above and below the wing centre section, between the engine nacelles and the fuselage, are effective in the extreme and may be used right up to the aircraft’s limiting speed. In a dive from 20,000ft they will hold the aircraft well within the limiting speeds. The Meteor F Mk 8 presents no problems in the stall. Warning of its approach is given by slight elevator buffeting some 10 knots before it occurs. This becomes more pronounced as the stall approaches and slight fore-and-aft pitching is accompanied by vibration. At the stall, which occurs at 100 knots indicated, the aircraft ‘wallows’ and does not seem to want to drop its nose. It does go down eventually after a little persistent hauling on the control column. Either wing may drop, but not very much.

With dive-brakes extended, the stalling speed increases by some two or three knots, but with flaps and undercarriage lowered it decreases by about eight knots. The use of medium power reduces the speed by a further three knots. The same warning characteristics apply to all types of stall. Buffeting in the stall is so strong that the instruments on the sprung panel become a complete blur. Recovery in all cases is rapid and straightforward.

Single-engined performance is exceptionally good and ‘flying on one’ presents no difficulties. At cruising rpm at 5,000ft a speed of 260 knots can be maintained quite easily, while the rudder trimmer holds the aircraft straight. I was

told that it was possible to fly right down to the stall on one engine, but I found that in practice it was very difficult indeed. One needs the foot strength of an Arsenal footballer to keep the aircraft straight at speeds below 120 knots.

As I said earlier, aerobatics in the F Mk 8 are a sheer joy, although manoeuvres in the looping plane tend to cause considerable popping in the ears. It is not exceptional to start a loop at 10,000ft and to go over the top at 16,000ft.

RecoveryFor the approach and landing following the cockpit check, the turn into wind should be made at approximately 130-140 knots. The approach speed should then be gradually reduced during finals, reaching 110 knots on crossing the boundary. Throttles closed, the aircraft settles down on to the main

wheels and remains in the tail down attitude until the elevator becomes ineffective. The nose wheel then drops gently on to the ground and the use of fairly coarse brake brings the aeroplane to a standstill. Finally, to stop the engines the high-pressure cocks are turned off, in addition to all switches and appropriate knobs.

In the event of a baulked landing, depending on the fuel available, the throttles should be fully opened, the undercarriage raised once airborne again and the flaps progressively raised. Once the ASI needle registers 155 knots, start to climb and repeat the exercise. A minimum of 40 gallons should be allowed for an overshoot on every flight.

After my final landing at Moreton Valence, I was very gratified to hear the controller come over with, ‘Very smooth...’ on the RT. A little self-flattery perhaps on my part, if the message was intended for me.

To sum up, the Meteor F Mk 8 has an outstanding performance for an aeroplane of its class. This performance, accompanied by many docile characteristics, ample warning at each end of the speed range, higher critical Mach number and improved all-round manoeuvrability at high, as well as low, speeds, is proving valuable to the RAF and to the air forces of the Commonwealth and of other nations.

Little more can be expected from an aircraft of this generation of fighters, than that already available in the Meteor F Mk 8. It represents a tremendous achievement and it is doubtful whether it will be bettered until newer designs come into service. ✤

‘……..aerobatics in the F Mk 8 are a sheer joy, although manoeuvres in the looping plane tend to cause considerable popping in the ears. It is not exceptional to start a loop at 10,000ft and to go over the top at 16,000ft.’ Aeroplane

38

A Meteor T Mk 7 tucks-up its undercarriage very early as it takes off from RAF Dumfries, then only the home of 1 Gliding School and a RAF Regiment Training School. Aeroplane

METEOR | 39

40

Superb eight-ship formation of Meteor NF Mk 11s of 29 Squadron, operating out of the famous Battle of Britain station, at RAF Tangmere. From left to right are WD641, WD715, WD598, WD605, WD762, WD792, WD597 and WD602. Via Martyn Chorlton

METEOR | 41

The nocturnal meat-box

The Armstrong Whitworth Meteor NF Mk 11 to NF Mk 14From The Aeroplane

42

The world’s only airworthy Meteor night � ghter of any mark is The Classic Aircraft Trust’s NF Mk II WM167 (G-LOSM) based appropriately, at Coventry (Baginton) Airport. The

aircraft served with 228 OCU on two occasions and Colerne CS before being converted into a TT Mk 20. Service was with

the A&AEE, FRL and RAE Llanbedr. The aircraft was put out to grass on January 9, 1976. Via Martyn Chorlton

Proposing the night-fighterAlthough the RAF pioneered the operational use of jet-powered day fighters in July 1944 (when 616 Squadron joined the running battle with German V-1 flying bombs over South East England) it was not until early 1951 that 29 Squadron became the first to receive jet night fighters.

From May 1942, the ubiquitous Mosquito generally replaced Havocs and Beaufighters in service and it reigned supreme as the RAF’s standard night fighter in the immediate post-war years. It was in January 1947, exactly a year after English Electric had received a contract for four prototype A.1 (later Canberra) bombers, that the Air Ministry issued Specification F.44/46 which led, by default, to the development of the two-seat night fighter version

of the Gloster Meteor.Glosters had earlier produced a number of schemes for

two-seat day and night interceptors, including one for naval use which featured folding wings and rear fuselage, a butterfly tail unit and Rolls-Royce AJ.65 engines and another, delta-winged design, powered by Metropolitan Vickers F.9 engines and armed with four 30mm guns but none had gone beyond the drawing board or brochure stage. The introduction of jet bombers gave a much needed impetus to the nightfighter programme and although

several manufacturers, including Gloster and Hawker, submitted proposals to Spec. F.44/46, which called for a two-seat twin-engined all-weather fighter, none of their designs measured up to the requirements. Thus, through their failure and as an interim measure, it was decided to develop the Meteor for this role.

In a Gloster design brochure dated October 1948, the introductory paragraphs by R. W. Walker, Chief Designer, read, ‘The night fighter outlined is intended to satisfy an Air Ministry requirement for a radar-equipped night fighter to be used as an interim replacement of the Mosquito with considerably improved performance. Such a fighter would have to suffice, pending the delivery to the Services of the more advanced nightfighter types now being planned, and the interim design would have to be suitable for quantity production in the shortest possible time. The scheme proposal entails the conversion of a

METEOR | 43

Meteor T Mk 7 to a nightfighter version with Derwent V engines, and has been planned with a view to reducing modifications to the absolute minimum’.

The brochure goes on to describe some of the equipment to be carried, among it the 28in diameter radar scanner and the Mk IXB aircraft interception gear. Although it was originally planned to provide local pressurisation of this AI equipment ‘to allow of aircraft operations at heights up to 35,000ft’, the cockpits were not to be pressurised and there was no provision for ejection seats!

The choice of the two-seat Meteor T Mk 7 was an obvious one, as it was the only two-seat variant and required the least modification to fit it for the nightfighter role. A 5ft extension of the front fuselage was planned to accommodate the scanner and AI gear. The design brochure stated that, ‘It will be necessary to fit extension planes to the Meteor F Mk 3, giving 43ft (full span) wings.’ It was also intended to move the normally nose-mounted armament of four 20mm guns to the outer wings, leaving the fuselage nose free for the AI installation.

At that time, no decision had been made regarding the design of tail unit to be used, the choice lying between the standard ear-shaped Mk 4 or 7 type and the more angular type used on the Gloster E.1/44, which was then about to be test flown on a Meteor F Mk 4. The general arrangement drawing in the brochure shows this latter design and it was this one which, ultimately, was chosen for the Meteor nightfighter. The estimated weight of’ this version, with full 325gal internal fuel tanks, was 15,2001b, some 600lb more than the Mk 4. Because of the increased length of the fuselage nose, it was expected that both longitudinal and directional stability would be affected. The loss of longitudinal stability was to be partly offset by adding some 3801b of lead ballast to the aircraft to produce a c.o.g. slightly aft of that of the Mk 4 and Mk 7, while the directional stability, though reduced, was still reckoned to be within acceptable limits.

Fuel capacity was the same as that for the Mk 4 and 7, namely 325gal internal, 180gal in the ventral tank, and two 100gal underwing drop tanks. This was calculated to be sufficient to give the Meteor nightfighter prototype a two-hour endurance at 30,000ft, plus 15min at combat

A wooden mock-up of the prototype Meteor NF Mk 11 with the real thing behind; the part converted VW413. Armstrong Whitworth/Gloster via Martyn Chorlton

VW413 began its flying career as the fourth production Meteor T Mk 7 before being converted into the prototype NF Mk 11. Aeroplane

Gloster Meteor NF11 VW413 Long Nose prototype Andy Hay/www.flyingart.co.uk

rating at this height after allowance for take-off and climb. Maximum level speeds for a clean aircraft were estimated to be 435kt at sea level and 0.80M from 20,000ft up to the 35,000ft ceiling. The addition of external tanks, however, reduced these figures to 350kt and 0.70M.

First of a new breedThis, then, was Gloster’s proposal for a nightfighter which embodied a good deal of design experience gained with earlier Meteor variants and from some extensive tests with the Central Radar Establishment of the AI radar in the single-seat F Mk 3 EE348 during 1946-47. It was, however, a stop-gap design intended to provide improved night and all-weather defence until the more advanced D.H.110 and/or GAS designs came to fruition.

De Havilland had also been busy on the design of the D.H.113, a private venture two-seat side-by-side nightfighter version of the Vampire but this was intended for export. It was not until the ban on the shipment of arms to Egypt in 1950 that it became ‘surplus’ and went into limited RAF squadron service. Again, jet nightfighters by default!

The acceptance of this basic design for development was almost a foregone conclusion; nevertheless, it posed a problem for Gloster, whose design office was already heavily overloaded with work on the Meteor F Mk 8 and the Javelin. Fortunately, Armstrong Whitworth Aircraft, one of Gloster’s sister companies in the Hawker Siddeley Group, was involved in the Meteor production programme and in 1949 it was decided that development and production responsibility for the nightfighter Meteor should be transferred to Armstrong Whitworth.

The aerodynamic configuration of this Meteor variant, now designated NF Mk 11, was flight tested on the fourth production T Mk 7, VW413, which first flew in October 1949. The major structural modifications involved the fitting of the angular E.1/44 and Meteor F Mk 8 tail unit, the long span wings of the F Mk 3 and, of course, the 5ft

extension to the nose simulating the AI radar bay and radome. Armament was not fitted in this prototype.

By the time Armstrong Whitworth’s own design brochure on the Meteor NF Mk 11 was produced in February 1950 (still bearing on its cover the quaint description of the company as ‘designers and constructors of metal aircraft’), some fundamental design changes had been made and equipment specified.

The four 20mm Hispano Mk V guns, each belt-fed through a Martin-Baker flat feed from an ammunition tank with 160 rounds, were re-positioned in the wings outboard of the Derwent 8 engines, which delivered 3,5001b thrust. The need for quick and easy access to the armament made large 30in square access doors essential. Because of their size and location they were part of the wings’ stressed structure and were of patented construction to withstand heavy loads, thus maintaining the stiffness and strength of the outer wing.

Another important modification was the introduction of the pressurised cabin, which was achieved by sealing all the structure of the front fuselage between the nosewheel-carrying bulkhead and the front spar bulkhead. This also involved sealing the large Meteor T Mk 7-type sideways opening canopy covering the pilot’s and radar operator’s cockpits. Pressurisation was obtained by tapping the engine compressor casing, which provided the two crew with 24,000ft cabin conditions at 40,000ft.

Installation of the 28in diameter radar scanner posed a problem, for when the main fuselage lines had been decided, it was found that the lower bearing bracket carrying the scanner protruded below the under-surface of the nose! A good deal of flight test work eventually produced an aerodynamically suitable nose shape. The power demand on the electrical system was considerably more than on other Meteor variants, the power source being two 28-volt 6KW engine-driven generators charging two 12 volt accumulators. The equipment thus powered included the Mk 10 AI radar, VHF radio, IFF, Gee and an AYF radio altimeter.

Exposed view of the Meteor night fighters weapon of choice, the 20mm Hispano Mk V cannon, which were positioned outside of the Derwent 8 engines. Via Martyn Chorlton

(above, right) Eric Franklin during early flight testing of the first ‘true’ Meteor NF Mk 11 prototype WA546 pictured on August 28, 1950. Charles E Brown via Martyn Chorlton

Meteor NF Mk 11 ‘6’ from CEV, Bretigny was one of the chase aircraft during the early flights of Concorde 001 from Toulouse. Concorde 001 is pictured on its first flight on March 2, 1969. Via Aeroplane

44

The NF Mk 11Three prototypes, WA546, WA547 and WB543 were ordered under Contract No 6/ACFT/3433 CB.5(b). The initial flight of WA546, the first true prototype NF Mk 11, built to meet Spec. F.24/48, was made on May 31, 1950, from Baginton, piloted by Eric Franklin, Armstrong Whitworth’s chief test pilot.

With characteristic thoroughness and speed, initial flight trials were pushed ahead by AWA, and it soon became apparent from work with the prototypes that the performance predicted by Gloster would be improved upon. This was particularly apparent for the take-off and landing modes and the handling characteristics at altitude. Ultimately, WA546 and WA547 went to the Aeroplane and Armament Experimental Establishment at Boscombe Down for extended flight tests; WB543 was attached to the Telecommunications Research Establishment and to the Royal Aircraft Establishment at Farnborough for further flight trials of radar and other equipment.

Production, too, got underway at Baginton and the first production Meteor NF Mk 11, WD585, made its first flight on March 13, 1950. It was delivered early in 1951 to No 29 Squadron at Tangmere. This squadron flew its NF Mk 11s until it re-equipped with Javelin F(AW) Mk 4s. A total of 341 NF Mk 11s, including the three prototypes, were built in two main batches by AWA. They served with 5, 11, 25, 29, 39, 68, 85, 87, 96, 125, 141, 151, 219, 256 and 264 Squadrons and 228 OCU.

In the spring of 1952, Denmark ordered 20 NF Mk 11s (51-501-520, re-serialled H-501-520, ex-RAF WM384-403). On December 1, 1953, 723 Sqn was transferred to Aalborg where the first three NF Mk 11s were received; by March 1953 all 20 were delivered. Due to the low serviceability of the radar sets, the squadron seldom had more than four

operational aircraft. In July 1958, the first F-86D Sabres arrived and on May 31, 1959, all remaining Meteor NF Mk 11s were phased out. Six of them, serialled H-504, 508, 512, 517, 518 and 519 were converted to TT Mk 20 target towers by Armstrong Whitworth. In August 1962, 508, 512, 517 and 519 became SE-DCH, ‘F’, ‘G’ and ‘I’ respectively, and were operated by Swedair Ltd for target towing. Later in 1969, ‘F’ and ‘H’ were sold to West Germany, where they were reported to have been broken up. France bought 41 ex-RAF NF Mk 11s, with deliveries to the French Air Force taking place between January 1953 and April 1955. They were flown by 30th Fighter Squadron, France’s first all-weather fighter unit to receive jet aircraft. One was later used to test fly two SFECMAS 5-600 ramjets while other NF Mk 11s flew on various duties at Centre d’ Essais en Vol, Britigny. In 1957, ECN-30 was re-equipped with the Vautour IIN but 25 NF Mk 11s were still in service in January 1958, and they were transferred to EICN-346 at Tours (Escadron d’ Instruction a la Chasse de Nuit).

In April 1958, five NF Mk 11s were transferred to the CEV and five NF Mk 11s went to the CTB (Centre de Til’ et de Bombardment) at Cazaux. In Algeria a few flew with ECN1171 at Bone (along with MD315R Flamants and Invaders) but in 1964 the remaining six NF Mk 11s of the Armee de Air’ were withdrawn from use. However, the CEV still use (as of 1975) a few NF Mk 11s at Bretigny and Cazaux. One aircraft, NF Mk 11, was still in service in June 1975. An NF Mk 11 from Bretigny, serialled ‘6’, was one of the chase aircraft for the first flight of Concorde 001 at Toulouse on March 2, 1969. Belgium, too, bought ex-RAF NF Mk 11s; twelve were delivered to 10 Squadron in 1952, and another dozen went to 11 Squadron in 1956. Both squadrons, belonging to 1 Fighter Interceptor Wing at Beauvechain, flew their Meteors, serialled ENI-24, until they were withdrawn from use on October 31, 1958.

METEOR | 45

Meteor NF Mk 12 WS897 which externally differed from the previous variant by having a longer nose to accommodate the APS.21 radar. The night fighter is pictured serving with 25 Squadron; service with 72 and 60 Squadron followed before the aircraft was retired in late 1959. Via Martyn Chorlton

Armstrong Whitworth Meteor NF Mk 12 WS697 in the markings of 25 Squadron, operating from Waterbeach, north of Cambridge. Andy Hay/www.flyingart.co.uk

In 1959, nine were sold to COGEA as target tugs, being registered OO-ARO, ARP, ARQ, ARR, ARS, ARW, ARX, GEV and GEZ. Their use by Denmark and Belgium followed, naturally, their air forces’ equipment with Meteor F Mk 4s and F Mk 8s two years earlier.

Because of its high performance and structural strength, its two-seat pressure cabin and ability to carry considerable external loads and nose-mounted electronic gear, some 30 NF Mk 11s were used in a variety of experimental programmes. These included radar and radome trials by Ferranti and the TRE, Fairey Aviation’s and de Havilland’s Fireflash and Firestreak air-to-air missile trials, test work on the EMI-Vickers Blue Boar weapons system and radar dart target trials at the A&AEE. In addition, 20 aircraft were converted for RN use as target towers. Only a handful of NF Mk 11s now remain either as gate guardians or in aircraft collections.

Meteor NF Mk 12The Meteor NF Mk 12 was a progressive development of the earlier variants. It featured a 17in longer, nose of improved aerodynamic shape, housing the US-built APS.21 AI radar. To balance this extra keel surface forward, a larger fin was created with the addition of small fairings to the upper and

lower fin at their junction with the tailplane. Derwent 9 engines, delivering 3,800lb thrust each, replaced the Derwent 8s, and the NF Mk 12s wings were strengthened to meet the demands of a higher performance in which the limiting Mach number was raised to 0.81.

An NF Mk 11 airframe, WD687, was used as the prototype NF Mk 12. The first production aircraft was WS590, flown for the first time from Baginton by Eric Franklin on April 21, 1953. 100 NF Mk 12s were produced to Contract 6/ACFT/6412 CB.5(6), with deliveries to the RAF starting late in 1953, when WS590 arrived at 238 OCU. Ultimately, nine squadrons, 25, 33, 46, 64, 72, 85, 152, 153 and 264, and 228 and 238 OCUs flew this variant.

Meteor NF Mk 13The Meteor NF Mk 13, which ante-dated the NF Mk 12, was a tropicalized version of the NF Mk 11 and only 40 were built, under Contract 6/ACFT/61411 CB.5(6). Basically, it differed from the NF Mk 11 only in some modifications for service in hot climates. These included wing mounted distance-measuring equipment, a radio compass with a loop on the rear fairing of the canopy and cold air inlets on the fuselage sides forward of the ventral fuel tank position. Later production aircraft had an additional flap area

46

Very rare air to air photograph of a 219 Squadron Meteor NF Mk 13 out of Kabrit in 1953. Just 40 NF Mk 13s were produced, the majority only serving with 39 and 219 Squadron’s in the Middle East. Via Martyn Chorlton

25 Squadron, based at Waterbeach, only operated the NF Mk 14 from July 1958 to April 1959 when it was superseded by the Javelin. This is WS733 which was transferred to 64 Squadron, another unit which replaced the ‘nocturnal meat-box' with Gloster’s big delta. Via Martyn Chorlton

Only two RAF units, 39 and 219 Squadrons flew the NF Mk 13 operational. This NF Mk 13 WM308 of 39 Squadron, which operated from Kabrit, Luqa and Nicosia before it was disbanded on June 30, 1958. Andy Hay/www.flyingart.co.uk

outboard of the engine nacelles to compensate for the extra 450lb weight of the NF Mk 13. The production prototype, WM308, made its first flight on December 23, 1952, piloted by J. O. Lancaster, an AWA test pilot and, incidentally, the first in the world to save his life through the use of an ejector seat.

The only two RAF squadrons to be equipped with NF Mk 13s were 39 and 219 of the Middle East Air Force. Subsequently, Egypt, Israel and Syria each bought six ex-RAF NF Mk 13s and France bought two aircraft which served with the CEV. Three aircraft were delivered to Israel before the Suez campaign of October-November 1956, and three more after. There were reports that RAF Canberras and Valiants had been attacked by Egyptian Meteor nightfighters during the campaign but it is not certain whether Meteor ever opposed Meteor in the air.

Meteor NF Mk 14The final production version of the Meteor was the NF Mk 14, which was also the last of the Meteor line. It was a development of the NF Mk 12 and the major external difference between it and earlier variants was the two-piece blown cockpit canopy replacing the heavy framed hood used hitherto. Less apparent changes were a revised windscreen to match the new canopy and an even longer nose, giving an overall fuselage length of 51ft 4in, spring

tab ailerons and an auto-stabiliser. The prototype, WM261, was a converted NF Mk 11 and was flown for the first time on October 23, 1953 by AWA test pilot Bill Else. 100 NF Mk 14s were built under Contract 6/ACFT/ 6412 CB.5(b), the first production aircraft being WS722. They were operated by 25, 33, 46, 60, 64, 72, 85, 96, 152, 153, 165 and 213 Squadrons, 228, 238 and 264 OCUs and 2 ANS. This latter unit flew the NF(T) Mk 14, a variant modified for navigational training flying and from which the armament had been removed.

The last production Meteor nightfighter, and the last Meteor to be built, was delivered on May 26, 1955, but within a year, NF Mk 14s were beginning to be replaced by the Javelin. However, the type remained in service overseas, until August 1961, when the last squadron to be equipped with Meteor nightfighters, 60 of the Far East Air Force based at Tengah, converted to Javelins.

Two ex-RAF NF Mk 14s were sold to France, serving with the CEV as NF.14-747 and NF.14-796, and WS829 was flown by Rolls-Royce with the civil registration G-ASLW. Another, WM261, became G-ARCX in service with Ferranti. A small number of NF Mk 14s are still extant but, in the main, they either do duty as gate guardians at RAF stations or are part of or destined for collections.

It is interesting to reflect that for more than 17 years, Meteors of one type or another flew in front line service with the RAF, operated in two wars and served on five continents in the colours of 15 air forces. ✤

Ex-WS829 NF Mk 14 which was registered as G-ASLW with Rolls-Royce Ltd from September 9, 1963. Andy Hay/www.flyingart.co.uk

METEOR | 47

The prototype NF Mk 14 WM261 (ex NF Mk 11) at Bitteswell on July 29, 1953. The unpainted surfaces give a good idea of how different the variant is from earlier marks. Via Martyn Chorlton

48

METEOR | 49

Royal Danish Air Force Meteor NF Mk 13 501 and 502 awaiting delivery at Bitteswell in November 1952. 20 NF Mk 11s were diverted from an RAF

contract for the RDAF, Nos. 501 to 520 were delivered to 723 Squadron between November 1952 and March 1953, replacing that unit’s F Mk 4s.

Via Martyn Chorlton

An art that conceals artGloster has completed the prototype Meteor T Mk 7 trainer a few weeks ago, and on May 1 at Moreton Valence. It was its fi rst public demonstration in Dockers scarlet fi nish. A number of VIPs and others have been given rides in the rear seat and, as most of them are only accustomed to 300 mph, they duly reported that the 585 mph maximum level speed of the trainer was much more brutal than they expected; and yet they agreed that the actual motion of fl ight in the aircraft seemed eff ortless and smooth. The job of fl ying very high-speed aircraft looks deceptively simple from the back seat but in reality, it is an art that conceals art.

The most important thing that Glosters have found out from the aircraft is that it meets the estimated performance fi gures and the smoother shape of the cockpit delays the critical Mach number by a small amount. True Mach numbers of up to 0.82 have been recorded on the T Mk 7 aircraft (Glosters place little faith

50

in Indicated Mach numbers and consider that normal service pilots should be taught not to read an instrument so much as to recognize the signs of compressibility by the feel, irrespective of attitude or altitude). It is to be expected that the Mach number would be higher on the trainer than on the F Mk 4, since one of the local causes of compressibility is the buff et on the tailplane and the airfl ow in this region is obviously related to the shape of the cockpit.

Bulging order booksGlosters have about 500 Meteors to build for British and foreign orders. The types to be produced will be a mixture of F Mk 4s, T Mk 7 trainers and long-nosed F Mk 8 aircraft. The diff erent variants in each case lend themselves to easy production as the assemblies can be bolted together, thus complete components can be sub-contracted.

The aircraft are assembled at Brockworth and fl own

Meteor T Mk 7s of 203 AFS (Advanced Flying School), ex-226 OCU (Operational Conversion Unit) operating out of Drif� eld during the early 1950s. Aeroplane

More about the Meteor Trainer

The Aeroplane - May 21, 1948

METEOR | 51

from the single airstrip there to make their fi rst landing at Morton Valence where subsequent fl ight trials are carried out. There are a number of other curious things about the trainer. For example, its rate of climb is confi rmed as 7,900 ft/min, which must be the greatest rate of any jet aircraft; it is superior to the F Mk 4 in this respect because it is lighter. The aircraft is also lighter because additional structure has been fi tted and the ballast has merely been reduced, or nearly eliminated. Thus, the fi rm have really got an extra seat (or, in later aircraft, an extra fuel tank) for nothing. The extra 30 inches in nose length of the T Mk 7 is built in the same way as the long-nosed F Mk 8 fi ghter.

Besides the 325 gallons of fuel carried internally, there is provision for 180 gallons in a ventral drop tank and two ‘airship’ type drop tanks carried under the extension planes with 100 gallons in each (making 705 gallons in all). All the external tanks feed into the main tank. With the ventral and wing drop tanks the limits are a Mach number of 0.7 or 400 mph IAS, whichever the aircraft reaches

The prototype Meteor T Mk 7 was a private venture by Glosters, hence the civilian registration G-AKPK. Aeroplane

Hundreds of RAF pilots went solo on the Meteor T Mk 7 during the 1950s, a period that saw 500 hundred of the Gloster-built trainer enter service. Aeroplane

52

fi rst. Near the ground the speed restriction is imposed, while at altitude the compressibility limit is reached. The aircraft has fl own up to a Mach number of 0.74 with all tanks and it was observed that lateral eff ects were felt at 0.72; the present fi gures have been fi xed to provide a reasonable safety margin.

G-AKPKThe Meteor G-AKPK has had a varied career. Originally Glosters had a single-seat demonstration aircraft which was broken by a Continental pilot last year and pieces of which were salvaged, where possible, for the construction of a ‘private venture’ trainer. This was completed before the fi rst MoS (Ministry of Supply) production aircraft. Although G-AKPK is Gloster’s own idea of a two-seater, it has been built to the Ministry specifi cation. The instrumentation in the rear seat is comprehensive, but Glosters may fi t further equipment. It was fi rst fl own in its present form by Gloster’s chief test pilot, Sqn Ldr W A Waterton, AFC, on March 19, who has since done preliminary contractor’s trials to determine what diff erences, if any, there are between the handling of the new aircraft and the standard fi ghter. Bill Waterton reports that it handles in much the same way as the production aircraft (a report of the unc1ipped F Mk 4 was fi rst published in THE AEROPLANE of July 5, 1946). The aircraft is shortly to be taken on a tour of Turkey; it will be fl own out by Sqn Ldr Waterton, with the extra fuel tanks, in four or fi ve stages. The aircraft has an endurance of 2.7 hours at 30,000ft, so it should have no diffi culty in getting there.

Compressibility eff ects of the Meteor trainer are much the same as the ordinary aircraft, at about 410 knots IAS slight changes in trim can be felt which can be trimmed out until about 430 knots IAS is reached, the aircraft then suff ers from progressively increasing instability until one wing drops at about 450 knots IAS at 10,000ft.

The ever adaptable MeteorOn the F Mk 4, compressibility has been thoroughly explored by Bill Waterton’s team of test pilots at Morton Valence and also at the service establishments. The Meteor has easily recognizable characteristics at high Mach numbers, and although the eff ects can be severe, the basic design could not be described as a dangerous one if

pushed up to, or beyond its limit.The Meteor trainer is obviously going to be a very

popular aircraft all over the parts of the World where Meteors are fl own. The Meteor is not a diffi cult aircraft to fl y, it does not swing on take-off like many large piston-engined twins, but there is a defi nite technique in fl ying very high-speed aircraft with a terrifi c rate of climb and a short endurance; so wherever there are T Mk 4s there ought to be T Mk 7 trainers close behind them, helping the pilots through the transitional period. This even applies to the R.A.F., who have other types which could be used as trainers but it applies even to countries like Argentina and Holland, who have numbers of 400 mph aircraft mixed with the Meteor F Mk 4s. The gap of some 200 mph is too large to be bridged comfortably by pilots in a small air force.

It is also, fundamentally, a sound idea to have two-seat versions of our operational single-seaters available whenever it is practical. It is thus fortunate that the Meteor lends itself to this adaptation. ✤

The heyday of the Meteor T Mk 7 was between 1950 and 1954 when it equipped nine � ying schools, stationed at Drif� eld, Finningley, Full Sutton, Merry� eld, Middleton St George, Oakington, Tarrant Rushton, Weston Zoyland and Worksop. The OCUs at Bassingbourn, Chivenor, Leeming and Stradishall also operated the trainer. Aeroplane

Canadian-born Sqn Ldr W A Waterton AFC who served as Gloster’s Chief Test Pilot from 1946 to 1954. Aeroplane

METEOR | 53

Gloster Meteor T Mk 7 WA669 which served with 203 AFS, RAFFC, TTCCS, SF Handling Squadron, TWU and 1 TWU before joining the CFS as one half of the Vintage Pair. The aircraft was lost in a mid-air collision with Vampire T Mk 11 ZH304 at Mildenhall on August 21, 1986. Andy Hay/www.fl yingart.co.uk

54

Based on the Meteor F Mk 8, the FR Mk 9 retained the 20mm armament and was � tted with a universal camera mounting in the nose. A single F.24 camera was remotely controlled by the pilot. Aeroplane

METEOR | 55

56

Photographic face lift

Designed to supersede the Spitfi re in the photographic reconnaissance

role, the Meteor FR Mk 9 and the PR Mk 10 saw the RAF through the 1950s.

Martyn Chorlton details the ‘recce’ aircraft and the units they operated

with, from 1950 to 1961.

FR Mk 9s, VW368, VZ578 and VZ606 of 208 Squadron practise aerobatics over Abu Sueir. VW368 was abandoned after an engine caught � re over Thumeir, Aden on March 24, 1957; VZ578 was SOC on February 11, 1958 and VZ606 was SOC on February 21, 1958. Aeroplane

METEOR | 57

Replacing the SpitfireUp to 1950, the RAF were still heavily reliant on the Spitfire to carry out both short and medium range photographic reconnaissance duties at home and overseas. The Spitfire FR Mk 18 was used for armed reconnaissance operations while the Spitfire PR Mk IX and the Mk XIX were employed for unarmed strategic reconnaissance.

The first attemptIn late 1948, a single Meteor F Mk 4, VT347, the last of a batch of 200 built by Glosters at Hucclecote was removed from the production line for a one off conversion. This experimental prototype was to be modified as fighter-reconnaissance version of the F Mk 4 and was re-designated the FR Mk 5.

Glosters had already, unsuccessfully, carried out camera installation tests in the F Mk 3 and F Mk 4, the main problem being that the camera windows iced although there were other technical problems. VT347 was fitted with vertical cameras in the rear fuselage and oblique cameras in the nose.

The first flight of VT347 was made from Moreton Valance by Gloster test pilot Rodney Dryland DFC* on June 15, 1949. It is not clear at what stage of the flight Dryland was at, but after making a high speed pass of the airfield, followed by a high ‘g’ pull up, the aircraft disintegrated. The cause was a failure of the centre section tank bay side skin. While the FR Mk 5 never entered production, the accident brought about a number of design changes and strengthening modifications to all subsequent Meteors.

*Dryland served with 3 Squadron during the Second World War flying the Hawker Tempest. He was credited with shooting down 21 V-1 rockets (five of these were shot down in a single sortie) and a share in shooting down a Me262. He was shot down on December 24, 1944 near Malmedy by ground fire but managed to escape captivity.

(top, left) Gloster test pilot Rodney Dryland who was killed whilst flight testing the sole Meteor FR Mk 5 on June 15, 1949. Via Martyn Chorlton

(top) Nose detail of an early production Meteor FR Mk 9. Aeroplane

WB139, one of a batch of 24 FR Mk 9s delivered between April 1951 and January 1952 is captured here during a production test flight. WB139 only served with 79 Squadron from late 1951 until it was lost on July 22, 1952 after both engines failed on approach to Gütersloh. Sadly, Fg Off L J T O’Sullivan initiated the ejection sequence too late and was killed. This was one of six aircraft lost by the RAF that day, three of them were Meteors! Aeroplane

One of the busiest FR Mk 9s built, VZ603 first joined 2 Squadron at Bückeburg in early 1952. It then went on to serve with 79, 208, 8 and the FR (Fighter-reconnaissance) Flight before being SOC on May 9, 1950. Andy Hay/www.flyingart.co.uk

58

The FR Mk 9 only served, operationally, in West Germany with the 2nd TAF (Tactical Air Force) (2 and 79 Squadrons) and the Middle East Air Force with 8 and 208 Squadrons and FR Flight in Aden. The latter, being formed from ‘C’ Flight of 8 Squadron, at Khormaksar on August 1, 1959, with four FR Mk 9s. It was this flight that was destined to be the last operational unit to fly the FR Mk 9 into the early 1960s before they were replaced by Hunter FR Mk 10s.

A few FR Mk 9s also saw service with the air forces of Ecuador, Israel and Syria and several were used for development flying. This included VW360 which was later converted to F Mk 8 standard and employed for HVAR (High Velocity Air Rocket) projectile trials; VW362 was used for gun and camera-heating trials, then served with Ferranti and was modified with large spotlights mounted in the wing tip fairings; and VW364 was used for ejector seat trials.

One well known FR Mk 9 that survives today at the Newark Air Museum is VZ608. Delivered to Rolls-Royce at Hucknall in March 1951, the aircraft was fitted with a variety of jet engines including the RB.108 used in the Short SC.1. In June 1955, this engine was fitted into the aircraft’s centre section, replacing the main fuel tank and its exhaust projected out of the bottom of the Meteor. Fuel for the RB.108 was carried in under wing tanks which only gave VZ108 an endurance of only 30 minutes. The RB.108 was later fitted into the vertical position as well with the modification work being carried out by Miles Aircraft Ltd. To carry out these flight tests, an intake almost identical to the SC.1’s was mounted onto the top of the centre section.

The Meteor FR Mk 9The armed Spitfire FR (Fighter Reconnaissance) Mk 18 was the first aircraft to be tackled by Glosters who proposed a fighter-version of their Meteor. Designated the FR Mk 9, the new aircraft was basically a F Mk 8, which was already serving with Fighter Command in high numbers and its introduction would not cause any significant maintenance issues.

The main difference between the FR Mk 9 and the pure fighter variant was the addition of a universal camera mounting in the nose, which was nine inches longer than the F Mk 8. A single F.24 camera was positioned on Type 25 mountings to the nose wheel bulkhead. The camera was remotely controlled by the pilot with a Type 48 Controller. The modified nose had two large camera windows on either side and, circular window mounted in the extreme nose. Camera heating was produced via hot air diverted from the compressor casing of the starboard Derwent 8 engine.

Specifically designed to operate at low level, the FR Mk 9 retained the original fighters 20mm Hispano cannons in the nose.

The prototype FR Mk 9, VW360, was first flown on March 22, 1950 by Gloster’s Chief Experimental Test Pilot, Jan Zurakowski. By July 1950, the aircraft was at the A&AEE, Boscombe Down for handling trials and function checks of the F.24 camera.

126 FR Mk 9s were built for the RAF in the serial ranges VW360 to VW371, VZ577 to VZ611, WB113 to WB143, WH533 to WH557, WL255 to WL265 and WX962 to WX981, all delivered between July 1950 and August 14, 1952, the last to 2 FU (Ferry Unit) aka 187 Squadron.

FR Mk 9, VZ608 which spent its entire flying career with Rolls-Royce. The aircraft is preserved at the Newark Air Museum. Andy Hay/www.flyingart.co.uk

(top, right) The prototype Meteor PR Mk 10, VS968 which, unlike many prototypes, actually saw operational service with 541 Squadron. The aircraft was then involved in trials flying with the RAE before being SOC on November 11, 1958. Aeroplane

An RAF ACF (Air Camera Fitter) demonstrates how the single F.24 camera was installed into the nose of a Meteor PR Mk 10. Aeroplane

METEOR | 59

RAFOperational 2 Sqn Dec 1950 to Jun 1956 (Bückeburg,

Gütersloh, Wahn, Geilenkirchen)8 Sqn Jan 1958 to Aug 1959 (Khormaksar) 79 Sqn Nov 1951 to Aug 1956 (Gütersloh,

Laarbruch, Wunstorf)208 Sqn Jan 1951 to Mar 1958 (Fayid, Kabrit,

Nicosia, Abu Sueir, Hal Far, Akrotiri, Ta Kali)FR Flight Aden (aka Aden Protectorate

Reconnaissance Flight)Second Line2 FU/187 Sqn; 2 Gp CF; 226 OCU; A&AEE; AIEE; CFE; CSDE; Ferranti; MoS; RAE and SF Khormaksar

EcuAdORTwelve FR Mk 9s were ordered to equip a single squadron because of the presence of Meteors in Argentina. The order was met by refurbishing ex-RAF aircraft and re-serialled as 701 to 712 they were shipped to Ecuador in 1954 and 1955.

IsRAElISeven ex-RAF FR Mk 9s were prepared by Flight Refuelling Ltd and delivered between 1954 and 1956. syRIAA pair of ex-RAF FR Mk 9s delivered in 1956 PR Mk 10 unITs RAFOperational2 Sqn Mar 1951 to Jun 1951 (Bückeburg) 13 Sqn Dec 1951 to Aug 1956 (Kabrit, Eastleigh

(det), Abu Sueir, Akrotiri) 81 Sqn Jan 1954 to Jul 1961 (Seletar, Tengah)541 Sqn Dec 1950 to Sep 1957 (Benson,

Bückeburg, Gütersloh, Laarbruch, Wunstorf)

Second line2 Gp CF; 231 OCU; 237 OCU; A&AEE; NGTE; RAE; SF Bassingbourn and WL Laarbruch

The second (by a whisker) ‘recce’ Meteor, the PR Mk 10The PR Mk 10 was designed, in parallel with the FR Mk 9, to replace the Spitfire PR Mk XI and PR Mk XIX as a high-altitude photographic reconnaissance aircraft. To help achieve good performance at high-altitude the longer span wings (43ft 6in) and the tail assembly, fitted to the early F Mk 4s, were both employed but armament was removed.

The same camera installation fitted in the nose of the FR Mk 9 was used with the addition of a ventral camera installation in the rear fuselage. The latter consisted of a pair of F.52 cameras on Type 39 mountings, remotely controlled by the pilot via a Type 35 No.8 Controller, fitted in the position that was originally occupied by the gyro gun sight. Camera heating for the nose was the same as the FR Mk 9 while the ventral cameras were heated in a similar fashion from the port Derwent engine. The heat in the ventral bay was contained within the rear fuselage by a canvas curtain. The camera windows were protected during taxying and take-off from debris by jettisonable metal covers.

The prototype PR Mk 10 was VS968 and this was first flown by Jan Zurakowski on March 29, 1950. Handling trials with wing and ventral tanks were carried out at Boscombe Down during August.

Total production of the PR Mk 10 was 59 aircraft in the serial ranges VS968 to VS987, VW376 to VW379, VZ620, WB153 to WB181 and WH569 to WH573, the last of these being delivered in April 1952.

The PR Mk 10 entered service with 541 Squadron at Gütersloh, West Germany, in December 1950 followed by brief service with 2 Squadron, also based in West Germany, from March to June 1951. The type also served with 13 Squadron from December 1951 through to August 1956 and finally with 81 Squadron in the Far East at Tengah. It was with the latter unit that the PR Mk 10 was retired in July 1961, being replaced by the Canberra PR Mk 7. The RAF’s last PR Mk 10 sorties were flown by WB159 and WB166. ✤

Very rare view of the camera windows under the rear

fuselage of a Meteor PR Mk 10. The AcF is cpl A cowell

from cambridge. Aeroplane

FR Mk 9 units

The cockpit of the PR Mk 10 presenting a good view of the Type 35 no.8 controller fitted in the position originally occupied by the gyro gun sight. Aeroplane

(top, left) A unique photograph showing 2 squadron FR Mk 9, VZ611 and PR Mk 10, WB156 being led by a Belgian Air Force F-84G Thunderjet. 2 squadron only operated the PR Mk 10 for four months in 1951. Aeroplane

After service with 2 squadron, PR Mk 10 WB156 was transferred to 541 squadron and served with the West Germany-based unit until september 1957. Andy Hay/www.flyingart.co.uk

60

The Gloster E.1/44 came about because of the slow progress being made in producing the Rover-built Whittle engines. The solution was to build a single engined version of the Meteor called the GA.1 and later GA.2. This is TX148, believed to be at Hucclecote prior to being delivered to Boscombe Down for � ight testing in 1949. Aeroplane

METEOR | 61

62

Single engine tenderIt was back in 1942, while Rover was struggling to produce the Whittle W.2 turbojet engine, that the MAP (Ministry of Aircraft Production) published a tender under Specification E.5/42. This was for a single engine turbojet aircraft but, when Rolls-Royce took over production of the Whittle engine from Rover in late 1942, the specification was abandoned following successful test flights of the F.9/40.

Gloster continues developmentDespite the progression of the Meteor, Glosters continued to work on the idea of a single-engined fighter, by now

Ace in the holeA lack of productivity with the early Rover-built Whittle

engines brought about the single-engined Gloster E.1/44, as described by Martyn Chorlton

designed with a 2,300lb Halford H.1 or H.2 engine. Preliminary tests were carried out between April and August 1943, in the RAE’s low-speed wind tunnel using a 1:4.5 scale model of the E.5/42, fitted with one of the Halford engines.

By November 1943, a pair of Gloster GA.1 airframes was laid down at Bentham. The first of these was serialled SM801, designed to be nothing more than a basic flying airframe while the second aircraft, SM805, was to be the operational prototype. Both aircraft, which were to be built to a modified Specification E.5/42, were designed to be powered by a 5,000lb Rolls-Royce Nene engine. Following another revision of E.5/42 in 1944, work was halted on both airframes and then abandoned completely in favour of a third aircraft; GA.2 (aka ‘Ace’) SM809.

Robust designFollowing an already established Gloster pattern of construction, the E.1/44 was a very strong design which was all-metal, stressed skin, divided into large sub-assemblies to simplify potential sub-contracted production. The fuselage was made up of five sub-assemblies labelled as nose, front, centre, rear and tail sections. The wings were made up of four sections, broken down as two centre plane and two outer plane sections. The tail, with the exception of the upper fin which was made of wood, was an all-metal stressed skin construction. Controls were push rods and spring-tabs were attached to the elevators and ailerons while the rudder had a balance tab as well. The tricycle undercarriage had a very wide track and retracted hydraulically. Five internal fuel tanks were all contoured to fit within the aircraft’s fuselage.

During the construction of SM809, extensive model and full-scale testing proceeded at the RAE Farnborough. Longitudinal and directional stability measurements of the E.1/44 were carried out during February 1945 with five different thrust spoilers in the jet-pipe nozzle. All five

(top) TX148, the third GA.2, displaying the modified tail which was later adopted for the Meteor F Mk 8. Aeroplane

METEOR | 63

caused minimal changes of trim and stability. Wind tunnel experiments followed with another 1:4.5 scale model to test two different types of under wing fuel tanks. Ditching tests of the E.1/44 model in September 1945 showed that the aircraft displayed much better characteristics than the propeller-driven equivalent.

Highs and lowsSM809 was finished in July 1947 and prepared for its first flight at Boscombe Down. The aircraft was loaded onto a Queen Mary transporter but en route, the vehicle jack-knifed while travelling down a hill the aircraft was damaged beyond repair. Undeterred, Glosters set to work building a second aircraft, TX145, which was first flown from Boscombe Down on March 9, 1948 in the hands of Bill Waterton. Early handling trials were encouraging and, following a test of the hood jettison system, the aircraft was returned to the Gloster factory for a handful of modifications.

The E.1/44 performed as well as Gloster had hoped for, with a top speed of 620mph and a good rate of climb. However, with regard to handling, TX145 was a little disappointing and in an effort to rectify this, a new tail unit was designed. The new tail had a higher positioned tailplane, very similar to the Meteor and this was successfully tested in the wind tunnel at Farnborough. The new tail improved handling to such an extent that it was fitted to the third prototype E.1/44, TX148 which first flew from Boscombe Down in 1949.

The performance of TX148 was described as ‘satisfactory’ but it was the lack of development potential, compared to the Meteor that saw the abandonment of the E.1/44 while the fourth prototype, TX150 was close to being completed.

TX145 and TX148 continued to be flown by the RAE for several years, with which they performed a number of trials, including testing brake parachutes and new flying control systems. Both aircraft continued flying into the early 1950s, although only TX148 can be verified as still flying in 1951. ✤

Andy Hay/www.flyingart.co.uk

Technical Date for the Gloster E.1/44PowerPlant: �One�5,000lb�Rolls-Royce�Nene�II�

turbojet;�Fuel�428�gal;�Oil�1.25�gal;�Provision�for�a�pair�of�100�gal�underwing�fuel�tank.

Dimensions: �Span�36ft;�Length�38ft;�height�11ft�8in;�Wing�area�254�sq�ft;�Undercarriage�track�17ft�6in

weights: �Empty�8,260lb;�loaded�11,470lb

Performance: (Clean)�Max�speed�620mph�at�sea�level;�landing�speed�105mph;�Climb�to�40,000ft�in�12.5�min;�Service�ceiling�44,000ft;�Absolute�ceiling�48,000ft;�Duration�1�hr��at�30,000ft

armament: Four�20mm�Hispano�cannon�mounted�in�the�fuselage�nose��with�720�rounds�of�ammunition

ProDuction: �Six�prototypes�built�by�Gloster�Aircraft�Company�Ltd,�Hucclecote,�Glocs�between�1943�and�1949�as�follows:�two�E.5/44�(1943�&�1944)�and�four�E.1/44�(1944�to�1949)

The first Gloster GA.2 SM809 ‘Ace’, prior to its unfortunate road accident; pictured in July 1947. Aeroplane

GA.2 TX148, which first flew from Boscombe Down in 1949. Aeroplane

64

METEOR | 65

Meteor F Mk 4s of 66 Squadron carry out a mock attack on an Avro Lincoln during an RAF exercise in the late 1940s. The aircraft nearest

to the camera is VT139 which went on to serve with 226 OCU, 215 AFS, 207 AFS and was then converted into a U Mk 15 drone. Aeroplane

66

Gloster’s Eight-Gun Meteor Project

By Tony Buttler AMRAeS

The eight-gun Meteor was to utilize the wing and fuselage centre-section from the Armstrong Whitworth Meteor NF Mk 11. Via Martyn Chorlton

Never seen the light of dayLooking back nearly seventy years from its first flight, the Meteor now stands out as a hugely successful aeroplane in so many ways. It was built in a good number of versions and the airframe was adapted as a test bed for new engines on many occasions. However, it is a fact that an aircraft which sees such extensive service will also be proposed in other versions which never see the light of day, and in that respect the Meteor is no different. For example, in February 1950, its manufacturer, Gloster Aircraft, offered a version which brought together within one airframe elements of both of the primary service types, the day and night fighters. The outcome was a powerful jet fighter carrying eight Mk.5 20mm cannon, four in the nose and four in the wings and 1,420 rounds of ammunition (the normal Meteor day fighters had their four 20mm armament mounted in the sides of the nose, but on the night fighter, the nose radome meant the guns had to be moved out into the wings).

The eight-gun project brochure explained how this new model would take the standard F Mk 8 day fighter version’s front and rear fuselage and empennage and join them with the wings and fuselage centre-section designed for the NF Mk 11 night fighter. Meteor parts already in production or planned for future production variants were to be used in this latest type, while some undercarriage and type equipment modifications already

METEOR | 67

specified and agreed for the NF Mk 11 would also appear on this aircraft. Apart from its eight guns, provision was to be made to permit the new aircraft to carry either two 1,000lb (454kg) bombs or eight 95lb (43kg) rocket projectiles under the fuselage, along with wingtip tanks. This would provide a maximum fuel load of 620 gallons (2,819 litres) with 420 gallons (1,910 litres) carried internally. For long distance operations without any rockets or bombs on board, the fuel capacity could be increased again to 995 gallons (4,524 litres) by the carriage of external drop tanks under the wings and fuselage. This brought the maximum fuel load carried externally to 575 gallons (2,614 litres) and the two 100 gallon (455 litre) wingtip tanks could be carried in any flight configuration, something that was not possible on a standard Meteor F Mk 8.

F Mk 8/NF Mk 11 hybridThe design speed and strength factors for this new aircraft at its combat weight were expected to be the same as those for the Meteor F Mk 8, in other words N = 10 at speeds up to 500mph (805km/h) and then falling to 9 at an equivalent airspeed (EAS) of 600mph (965km/h); this was in conjunction with a limiting design Mach number of 0.82 true. (The strength or load factor N is the ratio of the lift of an aircraft to its weight and represents a measure of

The F Mk 8 day fighter Meteor combined with the wings of a NF Mk 11 is shown by Gloster drawing P.309, which was dated February 1950. Four 20mm cannon were housed in the nose and four more in the outer wings. Jet Age Museum via author

Drawing P.310 presents three service configurations for the eight-gun proposal. Top to bottom: (i) tip tanks plus two 1,000lb (454kg) bombs under the fuselage, (ii) tip tanks and rocket projectiles under the fuselage, and (iii) no weapons but tip tanks, underwing and underfuselage tanks. Jet Age Museum via author

Meteor NF Mk 11 WD597 provides underfuselage detail including the fuselage tank. Note the guns just outboard of the engine nacelle. Cyril Peckham via Martyn Chorlton

the aircraft a rate of climb at sea level of 6,400ft/min (1,951m/min), while at 30,000ft (9,144m) the figure was 2,400ft/min (732m/min). The maximum level speed at sea level was given as 515 knots (593mph/954km/h – Mach 0.78), and at 30,000ft (9,144m) 485 knots (558mph/898km/h – Mach 0.82), the absolute ceiling would be 48,000ft (14,630m), service ceiling with a 500ft/min (152m/min) climb rate 44,500ft (13,564m), and it was calculated that aircraft would take 7.3 minutes to reach 30,000ft (9,144m).

A potentially formidable weaponAs a design exercise, the eight-gun Meteor makes a fascinating read both for the enthusiast and historian alike, but one assumes that the task of blending elements of the F Mk 8 and NF Mk 11 airframes together would have required rather more effort than is apparent in the covering document. For example, one assumes that firing all eight guns together would have had quite an effect on the airframe – or would the pilot have had to be selective with which guns he fired at any one moment? Actually, for some aircrew an eight-gun Meteor might have been a rather dubious proposition anyway since the NF Mk 11 night fighter’s wing-mounted cannon were known to jam quite frequently after just the first rounds had been fired. The style of presentation of the eight-gun project brochure indicates pretty firmly that this proposed Meteor version was submitted to the Air Ministry for consideration but obviously it was not taken up. However, had it been built and made to work then one feels that this particular Meteor would surely have been a most formidable weapon.

AcknowledgementsThanks to Tim Kershaw of the Jet Age Museum for help with this article. ✤

In February 1950, in fact at the same time as the eight-gun proposal, Gloster also produced a brochure for a ground attack version of the normal Mk.8 Meteor. In this case a prototype was flown (in September 1950) which was given the unofficial name of ‘Reaper’ (a title often used by Gloster Aircraft). Besides the nose cannon this aircraft carried 100 gallon (455 litre) tip tanks and a heavy battery of rocket projectiles. In July 1951, the aircraft received Class B mark G-7-1, but production orders were never placed. Russell Adams via Martyn Chorlton

68

the stress or the load to which the aircraft’s structure is subjected.) The project brochure added that some local strengthening of the Meteor F Mk 8 fuselage and tail, and of the Meteor NF Mk 11 wings and centre-section fuselage, could well be necessary in order to achieve this level of strength, and in consequence the airframe weight would also rise by a small figure.

In this connection it was expected that the biggest difficulty in undertaking the project could be to increase the Meteor NF Mk 11 wing’s design speed from 500 to 600mph (805 to 965km/h) EAS. The present estimated limitation resulted from the aileron reversal speed as affected by the torsional stiffness of the wing, the current lower stiffness of the Meteor NF Mk 11 wings as compared to other Meteor versions being due to the need to have quickly detachable panels in the wing skin to access the armament. However, the brochure explained that the degree of modification required to increase the speed limit of the night fighter wings up to 600mph (965km/h) would be more clearly defined when full measurements of the Meteor NF Mk 11 wing stiffness had been completed, and when it was known how much the aileron reversal speed would be increased by fitting some spring tabs ailerons (which at the time were being designed for the night fighter Meteor).

At 43ft 0in (13.11m) the eight-gun fighter’s span was the same as the standard ‘long span’ F Mk 3 and F Mk 4 day fighter Meteors and all four night fighter versions (the F Mk 8’s wings were shorter); when the tip tanks were in place the span was 46ft 9.5in (14.26m). Gross wing area without tip tanks was 377sq.ft (35.06sq.m), the thickness/chord ratio over the centre section was 12%, and across the outer wings this fell from 12% to 9% at the tips. Length was 44ft 0in (13.41m) and the normal all-up-weight with a total of 370 gallons (1,683 litres) of fuel on board was expected to be 16,900lb (7,666kg). The powerplant was two 3,500lb (15.6kN) thrust Rolls-Royce Derwent engines and at this weight it was estimated that they would give

METEOR | 69

The private-venture ‘Reaper’ G-7-1 just about to begin a ‘Zurabatic Cartwheel’, as pioneered by Gloster test pilot, Sqn Ldr Janusz Zurakowski.

Via Martyn Chorlton

Pushing the envelope The Meteor proved to be a very adaptable test bed and from

1944 through to the early 1960s, the jet helped to deliver a huge amount of technical data to a host of aviation companies and military establishments.

Rolls-Royce DeRwent V with Re-heat

in a very early afterburner trial, the Rolls-Royce Derwent engine nacelles were extended rearwards on F Mk 4 Ra435. First flown in this configuration on June 10, 1949, it was displayed at that year’s sBac at Farnborough. Andy Hay/www.flyingart.co.uk

70

Rolls-Royce w.2B/37 DeRwent F Mk 1 ee223 was intensively tested by Rolls-Royce with a pair of w.2B/37 engines. trials flown during February and March 1945 gave the fighter a speed of 465mph at

16,000ft with the engines at 16,850 rpm and an a.u.w of 11,900lb. the aircraft was later passed on to Power Jets before being soc on april 28, 1946. Via Martyn Chorlton

Andy Hay/www.flyingart.co.uk

Metropolitan-Vickers BerylF Mk 4 ra490 had a pair of Beryl engines installed by Glosters in 1948 and first appeared in front of the public at the sBac in september. the aircraft then joined the nGte at Bitteswell in January 1949 for further development trials. the Beryl engine was a good performer, pushing ra490 to 40,000ft in 7½ minutes. Via Martyn Chorlton

rolls-royce nene deFlected-thrust ra490 was converted again in 1952 for jet deflection experiments, the

modifications being carried out by Westland. the Meteor was fitted with large engine nacelles which extended 8ft forward of the wing to

accommodate the 5,000lb nene Mk.3 engines. thrust could be directed at an angle of 60° out of the bottom of each exhaust and a pair of pr Mk 10 outer wings were also fitted, giving ra490 a span of 44ft 4in, making

it the largest Meteor ever built. the data gained proved very useful for the vertical take-off ‘Flying Bedstead’ and the Meteor, could fly as low

as 75mph with full power deflection. Aeroplane

deflector box detail underneath the rolls-royce nene. Via Martyn Chorlton

rolls-royce ra.2 aVonthe next F Mk 4 in line for conversion as a test-bed was ra491 which was fitted with a pair of 6,000lb ra.2 engines. First flown by Bill Waterton on april 29, 1949 in this configuration, the jet was capable of reaching 40,000ft in 2.7 minutes and 50,000ft in 3.65 minutes. Via Martyn Chorlton

arMstronG-siddeley sapphire in March 1950, a pair of 7,600lb sapphire axial engines were fitted to F Mk 8 Wa820 by Gloster

at Moreton Valence. the jet did not fly in this configuration until august 14 and initially was

flown on behalf of the engine manufacturer from Bitteswell. on august 31, 1954, armstrong-

siddeley test pilot r B prickett flew Wa820 from a standstill to 39,373ft in 189½ seconds, breaking the time-to-height record. Flight via Aeroplane

rolls-royce rB.93 soar F Mk 8, Wa982 became a four engined Meteor when it was used as a test bed for a pair of rB.93 soar missile engines mounted on the fighter’s wingtips. converted in 1954, the rB.93 was cancelled by 1956 and Wa982 was converted into a u Mk 16 drone the following year. Flight via Martyn Chorlton

Andy Hay/www.flyingart.co.uk

Meteor | 71

72

One of only two Meteors to be converted to four engines (the other was the French NF Mk 11 NF11-3 which was used to test a pair of SFECMAS ramjets), F Mk 8 WA982 was used to test a pair of Rolls-Royce RB.93 Soar engines on the wing tips. After loyal service with the RAE, A&AEE, Rolls-Royce and the NGTE, the aircraft was converted into a U Mk 16 drone for use at RAE Llanbedr. The Meteor was written off on May 11, 1961 when control was lost over Cardigan Bay, 22 miles south west of Llanbedr. Flight

METEOR | 73

74

Meteoric recordsOn November 7, 1945 a pair of Gloster Meteor F Mk 4s of the recently reformed RAF High Speed Flight raced back and forth between Herne Bay and Reculver, Kent in an attack on the world’s speed record. Group Captain Peter Heath, who was there in an offi cial capacity, tells the inside story.

While EE454 left the production line as a F Mk 3 and was converted retrospectively, EE455 was built to F Mk 4 standard before leaving the Hucclecote factory. The � ghter went on to serve with the ETPS and the RAE before being SOC January 1, 1954. Aeroplane

First post-war jet recordLate October is not the best time for messing about at the seaside, nor does it produce the best fl ying weather. To combine the two and try for the Air Speed Record at Herne Bay seemed a bit over-optimistic, but there were good reasons for having a shot at it just then. It was 1945, the war had just ended and Britain and the United States were the only two countries with any air forces left worth mentioning. Of the two, only Britain had any operational jet aircraft and it must have seemed the ideal moment for us to raise the record to a respectable new fi gure before anyone else could get organised.

The then existing regulations for a record attempt required three runs in alternate directions of a three kilometre course at under 200ft. These had been in

existence unaltered almost since fl ying began and were still acceptable, with the possible exception of the height limit, which was thought a bit dangerously low. However, there was no time to argue about that and it had to be accepted.

Two special aircraft were prepared, Meteor F Mk 4s with Derwent engines. One came from the RAF and was to be fl own by Gp Capt ‘Willy’ Wilson, an experienced test pilot then commanding the Empire Test Pilots School. The other was a private venture by Gloster Aviation, to be fl own by Eric Greenwood, their chief test pilot. In theory they were identical, except for colouring, but much nose-tapping and sly winking in the Gloster stable suggested knowingly that their entry had odd little refi nements which should give it a winning edge.

At that time I held the splendid sounding post of Staff

‘The record-breaker’. Gloster Meteor F Mk 4 EE454 pictured prior to its record breaking � ight in the hands of Gp Cpt H J ‘Willy’ Wilson on November 7, 1945. Aeroplane

METEOR | 75

Officer Administrative to the Controller of Research and Development, Ministry of Aircraft Production (SOA to CRD in MAP, for fairly short). I was, in fact, a medium placed ‘Dogsbody’, based in Millbank, London, looking after the administrative problems of the various experimental stations dotted about the land and any odd project that cropped up from time to time. Looking after the Herne Bay party dropped into my lap almost automatically. To someone almost pathologically averse to office work, the bait of a few weeks at the seaside compared to austerity-ridden London was irresistible and I packed my bags forthwith. So did my wing commander, MacGregor, though I cannot now imagine what his excuse was. We left a squadron leader to look after the shop, one or other of us nipping back occasionally when his cries for help became too plaintive.

Herne BayThe course had already been selected, running from Herne Bay pier eastwards to Reculver, a ruined fort-cum-church on the top of very low cliffs. At each end small huts with observation platforms on top were built to take the

cameras, timers and all the other paraphernalia of the boffins. All this was connected direct by landline to the National Physical Laboratory at Teddington, where all the calculations were carried out. This meant that we, on the spot, never had any real idea of the actual speeds attained on a run until a considerable time-hours sometimes afterwards. This was long before the days of land-line television, let alone video tapes or computers, and the best we could do was use stop watches in each observation post and shout “NOW!” down the telephone to each other as an aircraft entered or left the measured course. As an aircraft travelling at 600mph traversed the course in 110 seconds, the scope for error like this was enormous and the press scathingly christened it the ‘Egg-Timer Method.’

There were two more components to our forces. To mark the 200ft height limit, about ten small barrage balloons were strung out at intervals along the course, commanded by a magnificent character, Flt Lt Evanson, of very uncertain age. He had been qualified to pilot every known type of aircraft, ranging back through mere aeroplanes and airships to free balloons and even man-carrying kites and he had certificates to prove it. He had Christian names for each of his balloons. I can only remember ‘Geraldine’ who occupied a pitch near the western end of the course where the local air currents made her swing wildly round at the end of her cable when she was close hauled-once so violently that she bounced herself on the ground, to the alarm of a passing ‘crocodile’ of schoolgirls. Finally she disgraced herself completely, broke adrift one night and passed out of our lives. ‘Poor Geraldine,’ said her Uncle Evanson, ‘she always was a wayward child’.

Lastly, we had an Air-Sea Rescue Section whose launches and Walrus put to sea any time we had flying going on. Fortunately, we never needed them.

The Meteor was the star!Our aircraft were housed at nearby Manston in a small, highly guarded little hangar of their own. Beside the two ‘stars’ we had a hack Meteor used for practice but usually flown by Flt Lt ‘Nobby’ Clarke, who used it almost daily to sniff out the weather, check the course and the balloons and act as a target for the time-keepers testing their equipment.

Progress towards any serious attempt on the record was slow, chiefly because, in the light of existing knowledge, we were venturing into unknown territory. We were approaching - though nowhere near as yet -

Gloster Chief Test Pilot, Eric Greenwood (left) and Gp Capt ‘Willy’ Wilson self-consciously pose for the camera in front of EE454, during the pre-record build-up. The Meteor was christened ‘Britannia’ for the record attempt and was later painted in a high-gloss yellow. Aeroplane

Another view of EE454 being pampered and prepared during the long wait for the weather to break in late 1945. Aeroplane

76

the speed of sound, and the mysterious ‘Sound Barrier’. Pilots were reporting serious buffeting at increasing speeds, controls were stiffening up, aircraft were becoming unaccountably nose-heavy; there seemed to be all sorts of things happening which were not properly understood. Wilson and Greenwood were increasing the speed of their runs in justifiably small steps. It was the bare beginning of the jet age.

My job seemed to develop chiefly into that of ‘Spokesman to the Press’, of whom we had a large number in residence at Herne Bay. They too must have been as irked as we were at the speed of progress. Every day we had dreadful briefing meetings at which I desperately tried to rake up something of interest that had happened the previous day. Day after day I had to tell them that there had been no flights and, if there had, I could only give them ‘egg-timer’ speeds. We gave them a demonstration of the timing equipment, we even tossed poor Uncle Evanson to them as a character to write up, and Geraldine’s disappearance got more coverage than many a film star. They wanted to talk to the two pilots – who refused point-blank to come and say anything. Nor would anyone from Glosters or the Ministry.

Not surprisingly, they got fed up with us and accused us of being unnecessarily secretive. We weren’t, there was nothing to tell. Finally they demanded to be allowed into Manston to see the aircraft and talk to the ground crews. When the Ministry refused that, things really reached an all-time low. Most of the reporters were pleasant types who recognised our difficulties and played along with us. There were, however, two who shall be nameless who became real anathema to Macgregor and me. They were for ever making sarcastic remarks about our inefficiency, our secretiveness and blimpish officiousness in holding back information which ‘the country has the right to know’.

When entry to Manston was refused, these two hit on the simple method of getting past the gate by hiring an aircraft and flying in. It worked a treat and they got right up to the door of the Gloster hangar when, unfortunately for them, it opened and MacGregor came out. The ‘Unheavenly Twins’ were terribly pleased with themselves, saying in effect, ‘Ha, that fooled you. We’re in!’ But Mac was a dour Scot who merely called up a sergeant and a couple of airmen and told them to hand ‘these two men’ in at the guard room to be charged with attempting to gain entry to ‘Secret Premises’. They were to be held until further notice. He then continued on his way out to Herne Bay and forgot to tell me.

The first I knew of it was after lunch when my boss rang up from London asking what the hell was going on. He had been phoned by the noble lord owning one of the papers, complaining furiously that one of his reporters had been put behind bars by ‘some fool airman’. It was all sorted out eventually and the two delinquents re-joined their mates out at Herne Bay. They were still breathing fire and slaughter against Mac and me, but we quietened them down by threatening to give their story as a scoop to the Daily Telegraph man or even Charles Gardner of the BBC who was also with us. He was still in uniform, a wing commander, and was a staunch ally.

A frustrating wait for allWith worsening weather and one or other of the aircraft always in trouble, it began to look as if the whole thing might have to be abandoned for the winter. Even the two pilots seemed to be getting a bit niggly with each other. Each was, naturally, all out to get the record for himself and so anxious were they not to have a march stolen on them that they produced a defensive pact together, that neither would have a go unless the other’s aircraft was serviceable too. It was to be both or neither. If one aircraft could not fly, the pilot of the other claimed that conditions were not quite suitable and one or two quite possible days were wasted in this way. On one occasion Nobby Clarke, who had been flying round the course until he was giddy, caused the two aces considerable embarrassment by flying the course at something well over 450mph and passing the press with both hands clasped above his head in a boxer’s victory handshake when conditions had been declared unsuitable for an attempt.

For some time Charles Gardner had been telling us all that an actual attempt, if and when it came, would happen at short notice, and he wanted to have a record prepared which he could broadcast immediately to the world, describing us all busy at our own jobs getting ready for it. Would we please rehearse something? It was a filthy wet morning, and we were all sitting dejectedly in the pub we had more or less taken over as our own, when he finally pinned us down and we put our minds to it. By throwing-out time we had the basis of what we thought was an entertaining script and we decided to assemble at eight that evening to record it. By that time, of course, everyone had thought up a few extra snippets which just had to be. Incorporated and Charles, who had set up his gear in a bedroom, kept dancing in and out telling us to get a move on.

Finally, around ten, we declared ourselves satisfied and trooped into the bedroom. After one or two false starts and essential pauses while one or other of the cast went out to get some more beer – or get rid of some - we got it all recorded and went off to bed with a feeling of work well done. Next morning, Charles came into the pub where we were all again assembled, and asked, ‘Anyone want to hear that record - before I smash it?’ We listened. It really didn’t sound very funny in the cold light of opening time and our diction was considerably below the acceptable BBC standards. No one said a word in protest when Charles took the disc and ceremoniously broke it across his knee. It really was HORRIBLE.

‘All Systems Go!’We never had a chance to make another because next day, suddenly it was ‘All Systems Go’, and the speed record was broken. As Charles Gardner had predicted, there was little warning. Nobby Clarke made his almost routine whizz round the course, testing the timing gear; we warned the press - who greeted us with sarcastic cheers-checked Uncle’s balloons, alerted the Air Sea Rescue boys and almost immediately, it seemed, the first

‘To the victor the spoils!’ Wilson and Greenwood shake hands for the benefit of the cameras. Via Martyn Chorlton

METEOR | 77

Meteor was upon us. In not much over five minutes he had finished, to be replaced almost immediately by the other. I cannot now remember the order they came in, but well remember the feeling of complete anti-climax as there was suddenly nothing more to do except wait for the timings.

Even the ‘egg-timer’ times seemed to take longer than usual that afternoon and, when they did come, they cast the Air Force contingent into the deepest gloom. I forget the figures but, roughly, they gave Greenwood at just over 600mph with Willy Wilson trailing about 10mph behind. The Gloster contingent were, it seemed to us, disgustingly cock-a-hoop and their directors immediately laid on an enormous celebration party in one of the smartest hotels. We were all invited but we had become more partisan than we had realised and we all felt very sorry for Willy. However, we promised to ‘look in’ and most of us did.

Charles Gardner had to be on hand elsewhere to get the official times as soon as he could for the late evening news and I joined him in the lounge of the hotel where he waited at the end of a telephone. There we sat for nearly two hours, drinking endless cups of coffee while we listened to the increasing noise of the Gloster festivities. Finally, sometime after ten, the call came through.

Charles pulled out a pen and started writing. He asked for a repeat, thanked them, put the phone down and turned to me to read out the final figures:- ‘Wilson 606. Greenwood 603.’ The Egg-Timer really had excelled itself this time: There was a long silence, terminated by the singing of ‘For He’s a Jolly Good Fellow’.

“Do we go in and tell them?” I asked. “Probably get lynched if we do. Think I’ll just get my story off and go to bed.”

So we both sneaked away. It seemed kindest; the morning would come quite soon enough. ✤

No, this isn’t some kind of RAF initiation ceremony, but it is a civilian Gloster engineer being manhandled into the intake of EE454’s Derwent engine, so as to carry out a close inspection of the turbine blades. Aeroplane

After service with the ETPS at Farnborough, as seen here on May 3, 1946, EE454 became instructional airframe No.6735M in December 1949.

78

From 1972, ‘The Vintage Pair’, comprising Meteor T Mk 7 WA669 and Vampire T Mk 11 XH304, had been entertaining crowds across the country whilst still serving as part of the examining wing of the CFS. Sadly, on May 25, 1986, during a synchronised � ying display, the two aircraft collided at the Mildenhall Air Fete. Sqn Ldr D Marchant and Sgt A Ball managed to eject to safety out of the Vampire while Flt Lt A J Potter and Cpl K Turner in the T Mk 7, without ejection seats, had no time to escape. Aeroplane

METEOR | 79

80

‘Meat-box’

Tony Haig-Thomas relates memories of fl ying the Meteor T Mk 7 and the APRF

Meteor T Mk 7 WL364 being put through its paces by a pilot of the CFS, stationed at Little Rissington. By the late 1950s, the type was proli� c throughout Britain which resulted in a large number being ‘exported’ to RAF units across the globe as ‘hacks’ for communication work and training. Via Martyn Chorlton

tales over the Middle East

METEOR | 81

The APRFThe Arabian Peninsular Reconnaissance Flight (APRF) had four pilots and four Meteor FR Mk 9s for low level fighter reconnaissance work with a two seat Meteor T Mk 7 for training, communications and instrument flying. The previous summer, on 63 Squadron, I had renewed my Vampire instrument rating on the Meteor as soon as I had checked out on the type. A Meteor rating was valid for any multi-engine aircraft but the Vampire only for single engine types so in Aden, although flying Venoms and Hunters operationally, I flew my annual instrument check in the Meteor which otherwise I could not have flown. I was a secret admirer of the four Fighter Recce pilots not because they were all hugely experienced, being second or third tourists, but because they had all flown Swifts in Germany, a type which had hooked itself into my psyche at Valley when, as I have recounted earlier, the F Mk 7 had lit its afterburner at low level over my head.

Shortly after I arrived the T Mk 7 was being flown to Mogadishu in East Africa by a Flt Lt Bradshaw. A flight this long was possible if flown high level with full mains, ventral and pylon tanks however when he arrived in the

general vicinity of Mogadishu he was desperately short of fuel and had suffered total electric failure above solid cloud. Unable to let down blind he jumped out and, descending by parachute, landed neatly on the beach whence he was rapidly rescued. A few hundred yards to his left and the sharks of the Indian Ocean would have had him while if a mile or so to the right he would have been big cat food; one had to admire the precision of his blind parachute descent through cloud. Clearly experience had paid dividends to allow him such an exact landing between these two perils.

A new Meteor was rapidly delivered from England, there being plenty of this obsolete type available and, not long after, one of the other APRF pilots, ‘Porky’ Munro, flew it down to Nairobi. Unfortunately he ran short of fuel before he got there and, to everyone’s amazement, he landed it wheels down in the African bush expecting to wipe off the undercarriage and slide to a halt in the remains. Instead he rolled to a halt in six-foot high elephant grass with the aircraft undamaged; presumably he was saved from becoming cat food by being able to hide in the Meteor at night when the purring noises

The author climbs aboard a Meteor T Mk 7 of the APRF at RAF Riyan near Mukalla 300 miles from Aden along the South Arabian Littoral. Via Author

WF897 of ITF Nicosia and WF853 of the Nicosia TTF cruise in company over Cyprus during the late 1950s. Aeroplane

82

grew too loud. Even more amazingly, after he was found, the elephant grass was cleared; a Beverley flew in with fuel in drums and the Meteor was then flown out, landing safely in Nairobi.

One day there were no Venoms to fly so I went next door to see if I could scrounge a Meteor, only to find a heated argument taking place between Tai Retief, the APRF Flight Commander, and Porky. In a nutshell, Tai said that you could not take a blurred photograph of a Land Rover using 1/2000th of a second shutter speed; Porky said you could. Two days later I saw a picture of a Land Rover that looked like a stretched version of a New York stretch Limo with the aperture and exposure time confirmed on the bottom of the photograph, I was amazed. ‘Porky’ said that he had been ten feet out and ten feet up at 400kts which must have been exciting for the occupants of the Land Rover if they had not seen him coming. ‘Porky’ became a good friend and I discovered that during his flying training he had bailed out after a mid-air collision with another student doing unauthorised formation aerobatics and, on another occasion, landed wheels up in a field after running out of fuel. Life in the RAF in the fifties was clearly more relaxed than later on as he got his wings on time with only a few extra orderly officers’ duties to compensate Her Majesty for the wrecked aircraft. ‘Porky’ or Tony as I am reminded by his wife that he is to be called nearly 50 years later, became CO of the Sultan of Muscat and Oman’s Air Force and then suffered a debilitating stroke soon after his retirement.

Manx Kelly was the third of the four pilots and he and I flew together a lot as a pair when the APRF joined up with 8 Squadron. Manx was a true eccentric, an exceptional handling pilot and brilliant artist. One day I was preparing for my instrument rating in the back seat with Manx in the

front as safety pilot; we were flying with one engine flamed out and me ‘under the hood’. Suddenly Manx said “I have it, I have just spotted Porky in an FR Mk 9 and he hasn’t seen us”. He pulled the Meteor vertically upwards, executed a perfectly flown stall turn, relit the starboard engine on the way down and turned in for a high quarter attack. As we closed to 400 yards he mimicked a machine gun with a ‘Tukka Tukka Tukka’ on the radio – nothing else was said but it provoked an instantaneous ‘break’ towards us followed by a memorable (when I was conscious) one on one dogfight. Manx announced that my instrument flying was fine so we went low flying instead. He was the founder in the mid-sixties of the Rothmans aerobatic team, and was tragically killed flying an experimental home built aeroplane in American when it developed ‘flutter’. It disintegrated, leaving Judy and four children without husband and father.

Bullets and big birds!One day we were briefed that some heavy machine guns had arrived at Al Qara and we were not to fly near the place. Unfortunately, Al Qara was a very picturesque town on top of a pinnacle of rock in the upper Yaffa district North East of Aden and Manx had just acquired a new Japanese cine camera. He thought Al Qara would make a nice shot for the film he was making of flying in Aden. He throttled back, dropped one third flap and flew slowly past the town cine camera in hand; his filming was rudely interrupted however and on landing it was found that he had thirty-eight bullet holes in his aircraft. The squadron engineering officer said that the aircraft was to be written off but the Group Captain overruled him as it was his favourite Meteor and, in spite of the 400 man hours required to repair it, repair it they must. Eventually, three

The whole of 208 Squadron over Ismailia, Egypt with their Meteor FR Mk 9s, which the unit operated from January 1951 to March 1958. Aeroplane

METEOR | 83

months later it, was done and Manx took off for an air test which, naturally, included a lot of low flying that is, until he collided with an Egyptian Vulture, which finally did for the aircraft what the thirty eight bullets had failed to do and the aircraft was scrapped.

This however was not the end of Manx’s excitements. At the beginning of 1961 Ken Hayr arrived on 8 Squadron and, there being no Hunters serviceable, Manx offered to show him around the area. Naturally the beauty of Al Qara was on the menu but, while they were flying over it, a distinct thud announced that they had been hit and, on landing back at Khormaksar, a bullet was found lodged in the parachute under Ken Hayr’s seat. The next day Manx promised Ken a less exciting sortie to the north east to show him the army camp at Ataq and the Wadi Sayeed to the south of it. Manx ordered the fuel tanks, including the pylon tanks under the wings, to be filled and they took off. They were nearing the end of the low level part of the exercise when Ken heard Manx exclaim “Oh my God”. The aircraft’s nose pitched up and both engines went to full power; on enquiring the nature of the problem Ken was told that they were down to a 40/40 fuel state (80 gallons) which was the normal landing fuel. At 30,000ft both engines flamed out and the aircraft entered a glide, with appropriate distress calls to base.Almost unbelievably they crossed the runway threshold from a straight in approach rolling to a halt half way down the asphalt. The usual array of ambulances, fire trucks, engineering officers and the curious surrounded the aeroplane, led by the Squadron SNCO in charge of the flight line. Manx, furious, climbed out – “I told you to fill the pylon tanks chief you bloody nearly killed us”. “I did so sir” and, patting the pylon tanks, “They are still full sir you must have forgotten to select them”. They were and he had! In the FR Mk 9 that the APRF normally flew, the pylon and ventral tanks fed automatically but in the T Mk 7 they had to be selected manually which Manx had forgotten to do and they had then ‘dead-sticked’ the jet with 200 gallons of unused fuel still on board. After these excitements Ken stuck to the Hunters. I had first met him on 66 Squadron at Acklington, and I met him again when he was a Flight Commander on 19 Squadron at Leconfield. Many years later, in 2001 in fact, after he had retired as Air Marshal Sir Kenneth but was still actively flying, I strapped him into a Vampire at the Biggin Hill Air Show and then watched him spin in ten minutes later when he encountered the tip vortices of a Sea Vixen. The aircraft rotated fast three times and then exploded, producing that, by now all too familiar great black mushroom cloud. With him when he died was another Vampire pilot, Jim Kerr, who I had just checked out in his own aircraft. A sad day.

The fourth pilot in the APRF was Fred Trowern or ‘Fat Fred’ as he was irreverently known. Fred was a father of five and never did anything wrong. Operationally he was exceptional and on one occasion in an area that had become politically very hot, he flew low level down a valley and noticed a rope in the mouth of a cave that had not been there two days earlier. As a true professional he did not go back for another look but briefed a pair of strike Hunters who each salvoed four rockets with HE into the cave mouth, killing a small group of baddies hiding out from the ground forces who were looking for them. Fred Trowern is still flying at Middle Wallop, teaching Army Air Corps pilots their basic fixed-wing flying before they graduated to helicopters and was one of the surprisingly few 8 Squadron pilots to survive to old age.

By the time I had left the Middle East I had flown a total of 113 Meteor sorties totalling just over 100 hours and never had a frightening moment or technical malfunction of any sort during that time. A wonderful aircraft. ✤

Tony flew 113 Meteor sorties, chalking up over 100hrs in a machine he described as ‘A wonderful aircraft’. Aeroplane

84

From Welland to TrentAlthough the Trent design is not new, in the sense that much water has, or rather many rivers have, in the past couple of years, passed under the bridge and Rolls-Royce are developing advanced new prop-jets, the Trent is still the only self-propelled Prop-jet engine actually fl ying in the world. So the thought occurred to me that a handling fl ight in the Trent-Meteor would be the best way to assess something of the more practical achievements in attaching an airscrew to a turbine and also to take the opportunity of outlining the engineering behind the Trent power plants.

The purpose here is to describe the engine handling characteristics of the Trent and reference is made to the Gloster airframe only where it relates specifi cally to the engine. There is no point in describing the airframe round the Trents, for two reasons. First, my former colleague, Sqn Ldr T S Wade, has already made a comprehensive report on the basic type and, secondly, EE227 is so old it is strictly a Meteor F Mk 1, formerly of 616 Squadron, with 80 hours of operational time and is certainly not a Meteor as we know it now. It was one of the fi rst to be fi tted with the larger diameter rear spar ‘banjos’ and for this reason it was selected for installation of Trent engines.

Thanks to facilities made available to me by Capt R T Shepherd, of Rolls-Royce Ltd, and the Ministry of Supply, my trip in this historic prototype now at Bitteswell, for the fi rst time, completes a series of articles on high performance aircraft representing three diff erent types of power plant, the pure jet Vampire, the prop-jet Trent Meteor, and the piston-engined Martin-Baker MB.5. These three aircraft are not exactly comparable, but an analysis of their diff erent characteristics will form the basis of a subject which we hope will be dealt with separately later on.

The Trent-Meteor was fi rst test fl own by Eric Greenwood on September 20, 1945, at Church Broughton and afterwards it was transferred to Bitteswell where it has

The World’s first ‘prop-jet’

Flying the Trent Meteor by R G Worcester The Aeroplane – March 26, 1948

remained, except for routine visits to Farnborough and Boscombe Down. During this time, the test programme was the responsibility of Rolls-Royce test pilot Wg Cdr A. McDowall who it may be remembered put up a magnifi cent display in the machine at the Derby Aero Show last year and with him is a very small maintenance team who look after the three Trent engines in existence, two of which are in the one and only Trent Meteor; one has been used for cannibalised spares. The astonishing thing about this aircraft has been the trouble free service it has given when it is remembered that the airframe, engines and Rotol’s airscrews were all in the experimental stage and when married together the individual components have completed over 200 hours of fl ying and probably at least another 100 hours of ground running.

Engineering BackgroundThe Trent Meteor weighs some 14,000lb gross and must be the heaviest Meteor in service. The extra weight is the result of fi tting the fi ve-bladed airscrews and the Trent engine naturally weighs rather more than the Derwent. The undercarriage also had to be lengthened to provide adequate ground clearance for the tips of the airscrew blades. With the present airscrews of 7ft 6ins diameter, the clearance with the undercarriage fully compressed is only some 11 inches and this, together with the fact that Rolls-Royce’s Experimental Flight Section at Hucknall is a grass airfi eld, is the reason why the Trent-Meteor has been in splendid isolation at Bitteswell.

The Rolls-Royce Trent is based on the Derwent 11 of 2,200lb ST, which has seven combustion chambers (instead of nine on the Derwent V) and has the necessary reduction gear on the front cover with the extension shaft leading through the mouth of the intake. There are a number of other minor changes on the Trent, such as the fi tting of series V fuel pumps.

In the airframe, the changes included an extension of

The sole Trent-powered Meteor, EE227, with its starboard engine feathered during an air-to-air shoot with renowned aviation photographer, Charles E. Brown. Charles E Brown via Martyn Chorlton

The World’s first ‘prop-jet’

METEOR | 85

6ins to the undercarriage which necessitated certain special changes to the wheel wells. The guns were removed and in their place ballast was located in the nose and, in addition, a little more was added to the ordinary ballast. Owing to the different thrust line and slipstream effect of the airscrews, the incidence of the tailplane had to be increased by one degree. Also, the fin area was increased by the addition of two small fixed fins on the tailplane. Cockpit controls of the Trent Meteor consist of two throttles, two airscrew levers with the ordinary high and low pressure fuel cocks and other conventional controls. The most interesting controls are those which relate to the engine airscrew interconnection system. There are two separate methods of operating the throttle and airscrew levers, either with a device known as the controller, or without it.

The throttle operates a resistance to pre-select a certain jet-pipe temperature through the controller. If the jet-pipe temperature rises above the predetermined amount, a signal is fed into the controller which relays to a fuel control which then shuts down the fuel supply slightly; if the temperature gets too low, the fuel supply is accordingly increased. Thus, under all normal conditions, the throttle pre-selects a jet-pipe temperature which is kept constant at all altitudes by the controller. Without the controller, the same effect can be achieved, but manual adjustment of the airscrew levers is required. If a certain jet-pipe temperature is required without the controller, it means that one must open the throttle and it may then be necessary to alter the rpm with the airscrew control. If the jet-pipe temperature gets

too high the pitch must be reduced slightly. The converse is also true: if the jet-pipe temperature gets too low, it is permissible to coarsen pitch manually.

This situation is somewhat analogous to that of the piston engine, a low jet-pipe temperature and high rpm is like having low boost and high rpm, and vice versa. Also similar to the piston engine, the most economical fuel consumption of some 40 gallons an hour for the Trent can be obtained by high boost and low revolutions, i.e., a jet-pipe temperature of about 600°C and the rpm ‘pulled back’ to about 10,000. Irrespective of whether the controller is used or not, the airscrew levers can be left, for all normal flight, in a central gate, but a certain manual adjustment of them may be required under special flight conditions. Without the controller, above about 20,000ft, the throttle must be closed to maintain jet-pipe limitations and the pitch will increase by reason of the inter-connected controls. So, to maintain the rpm required, it is necessary to manually inch the over-ride pitch control forward to give more revs. And one must move the pitch lever back into the coarse position when feathering. These characteristics, of course, apply to the Trent only in its present form and a separate pitch lever is not necessarily inevitable. A feathering button is provided, but when the throttle is closed and airscrew lever returned to its coarse pitch stop on the quadrant, the blades will feather and combustion will cease. To re-light in flight, the fuel cock should first be turned on, the airscrew control returned to the gate position used for normal flying, and the airscrew will unfeather. If it does not, pressing the unfeathering button for a few seconds will be sufficient. To ignite the

(above, left) Very rare photograph of Meteor F Mk 1 EE227 still sporting its original Rolls-Royce W.2B/Welland I engines. Note the top of the fin has been removed. Via Martyn Chorlton

(above) EE227 after being rolled out in its new Trent test bed guise with modified fin, additional finlets and extended undercarriage, to give sufficient ground clearance for the new engine’s propellers. The aircraft is pictured at Hucknall in September 1945. Via Martyn Chorlton

EE227 was first flown with Trent engines from Church Broughton by Eric Greenwood on September 20, 1945. Via Martyn Chorlton

fuel spray, the ignition button should be pressed and then the power will come on. Wg Cdr McDowall has tried re-lighting at sea level and all the way up to 30,000ft and has had no trouble. The engine, even at maximum altitude, has never failed to re-light, although re-lighting is somewhat hard on the flame tubes if they are exposed to -40°C and raised to 500°C a few moments later. However, the combustion chambers have given no trouble so far and, except for one or two replacements, the flame tubes are still the original set.

The Trent’s in flightWhen flying the Trent Meteor, I wanted to keep in mind the basic advantages of the prop-jet which, in a sentence, are: (i) greatly improved initial acceleration, reduced take-off run and better initial climb; (ii) considerably lower fuel consumption; and (iii) the welcome airscrew-disc drag at the final approach and landing. The Trent-Meteor unquestionably has these three qualities which make it an interesting and exhilarating machine to fly.

In the Trent Meteor cockpit I particularly liked the ASI, with big and small hands like a sensitive altimeter, and it was a novel experience to find oneself jogging along at, say, 283.5 mph. In addition to the ordinary instruments of

consists of putting the elevator and rudder trim neutral, flaps up or one-quarter down, airscrew levers in the central gate position, after which the ‘gallons gone’ indicator and the controller are turned on.

On opening the throttles fully, the initial acceleration is tremendous and far greater than pure jets; it is indeed comparable with piston engines in the largest sizes. At the first runway intersection at Bitteswell the speed was 130 mph IAS, the aircraft should be pulled off at about 150 mph IAS. The elevator control seems very heavy and a strong pull-force is needed to start the climb. I was told that the ballast in the nose was more than is strictly necessary and this no doubt contributed to a first impression of having to lift the aircraft off.

The climb is comfortable at a jet-pipe temperature of 500°C, giving some 230 mph IAS. In the air, the aileron control is pleasantly easy. Some pilots who have compared it with an ordinary Meteor say that fitting Trent engines has improved the rate of roll. The rudder is reasonably sensitive and the elevator, as already stated, is the hardest of the three.

Under asymmetric power there is a faint suggestion of crabbing, but the aircraft will fly with negligible opposite rudder and no off-setting rudder trim appears to be necessary. The engines can be suddenly closed to the

(above) The Trent Meteor was a delight to fly and its top speed of 440mph at 10,000ft easily put it on a par with its jet-powered cousins, without the alarming fuel consumption. Via Martyn Chorlton

(top) Another superb study of the Trent-powered Meteor during Charles E. Brown’s air to air photoshoot. Charles E Brown via Martyn Chorlton

86

the Meteor there are four ‘prototype-only’ oil-temperature recorders showing inlet and outlet readings for both engines. The Trents are fitted with the same starter motor as on the Derwent and, to reduce the load on the electric starters, the ground crew get the airscrews moving by hand. The electric motor then carries the turbine assembly up to some 1,500 rpm, the idling speed being 5,500 rpm. In the cockpit it is only temperature indicators that record accurately when the flame is properly lit.

As usual, there is no need to warm up or carry out a check test and after the starter trolley is disconnected, one can taxi out at once. When manoeuvring on the ground, the engines are responsive as piston engines and it is quite easy to steer along a winding taxi track by using the engines differentially. As the idling speed of the engines is rather high, a touch of the brakes is occasionally necessary. At the downwind end of the runway, the cockpit drill

idling position with no ill effects whatever as the blades at once coarsen pitch to reduce airscrew disc drag. When fully opened, the response is instantaneous and precisely like that of a piston engine; the acceleration from say, 150 mph to 250 mph, if the pilot is forced to ‘go round again,’ is most marked. The safety speed is 145 mph, and if an engine cuts on take-off it is necessary to close the throttle of the dead engine to reduce blade drag by getting into coarse pitch at once. In the air, the noise is not appreciably more than on some pure jet aircraft and is considerably less than a piston-engined aircraft of comparable performance. The actual performance of the Trent Meteor is not of great significance, since the object has been to develop the prop-jet engines. Nevertheless, the Trent-Meteor is as fast as the most highly developed piston-engined interceptor fighters, and on 800 bhp, plus 1,000lb. thrust from each engine, its maximum permitted speed of

470 mph TAS (400 mph IAS at 10,000ft), it is faster than the earlier Meteors with the original Derwent engines.

When coming in to land, the proper speed for undercarriage operation is 200 mph IAS, and flaps may be depressed at about 150 mph. The powered approach should be started at 150 mph IAS, a high figure which was necessary because of the increased gross weight. It can, however, be reduced gradually, crossing the boundary of the airfield at about 140 mph IAS. The flatten-out and touch-down can be made precisely and is simple and conventional. The aircraft lands naturally in a tail-down position with the nosewheel well off the ground, an attitude no doubt associated with the new thrust line of the power plants.

With the high initial speed, the braking effect of the airscrews is noticeable, but a touch of brake is necessary on the main runway at Bitteswell, which is due in part to the total idling thrust of about 400lb. The landing, however, presents no difficulties whatever.

To sum up, the Trent-Meteor is a real compromise between the pure jet and the piston-engined aircraft and points the way to the new types of engines being developed. The Trent has shown that a prop-jet can be as docile to handle as a piston engine and yet offers a greater performance, particularly with modern types of high-efficiency airscrews. No special technique was required to fly the Meteor with these engines and this, more than anything, is a testimony to the success of the development work which has been put into this aircraft.

Multiple usesThe development has not been easy and in their early form the Trents required much modification through trial and error with the different controls. But the result of the work is that an engine has been evolved which has all the advantages of the piston engine with many of the advantages of the pure-jet power unit. The Trent, as an engine, is not intended to have a future, but the controls system which has been perfected on the Trent Meteor will be of tremendous value in the future.

Characteristics of the prop-jet suggest many important uses to which it could be put. The Royal Navy need a power plant which will have a reasonable consumption at sea level necessary while, say, strike-fighters are looking for the ship in low visibility. They also want an aircraft with good acceleration and initial climb, and one which has the drag effects of the airscrew disc. Transport aircraft need the prop-jet when operating over short distances which make a climb to altitude uneconomical, and when they are flying from small airfields, a good take-off is essential. Many other branches of aviation will be interested but no doubt these two will be high on the priority list for re-equipment with prop-jets. ✤

EE227 taxying with a pair of 4ft 10½ in diameter propellers (the originals were 7ft 11in) which gave the Trent engines 1,400lb of thrust and 350 shaft horse power apiece. Via Martyn Chorlton

METEOR | 87

Andy Hay/www.flyingart.co.uk

88

Eric Greenwood nudges the Rolls-Royce RB.50 Trent turboprop-powered EE227 closer to the camera ship for the bene� t of aviation photographer Charles E. Brown. Charles E Brown via Martyn Chorlton

METEOR | 89

90

Saturday, February 24, 1951 On this day, the British Light Fleet Carrier HMS Warrior arrived off Iwakuni, Japan, with a deck cargo of 15 Meteor F.8s and two Meteor T.7s for 77 Squadron, Royal Australian Air Force (RAAF).

Although F-51D Mustangs (plus a few CA-18 Mustangs) had proved suitable workhorses for the Australian squadron during the first half-year of the undeclared Korean War, the advent of the MiG-15 over North Korea and Manchuria in November 1950 led to demands that 77 Squadron should re-equip with a modern jet fighter as a matter of urgency.Not only were UN piston-engine fighters and bombers now under threat, so too were first generation American jet fighters such as the USAF’s F-80C Shooting Stars and the F9F Panthers of the USN and USMC.

Enquiries were made in Britain and the United States for suitable, currently available, modern fighter aircraft. Lt Gen Sir Horace Robertson, Commander British Occupation Force, writing on discussions that he had held with Lt Gen George E. Stratemeyer, Commander of the Far East Air Force, reported that he had stated, “. . . you re-equip 77 Squadron with jet aircraft from British sources as early as you can do it. . .” Stratemeyer held out no hope on the possibility of rearming the squadron with second-generation American jets such as the new F-86 Sabre. He had added that it would be the first opportunity the British would have to test their aircraft in actual combat. The Americans hoped that this factor might induce the UK to speed up re-equipment of its forces in case the fighting should continue or escalate.

Australian High Commissioner in the United Kingdom,

A mix of the old and the new at Iwakuni, Japan, with RAAF F-51s and their replacements, Meteor F Mk 8s. Via Aeroplane

Meteors on the deck of HMS Warrior prior to being unloaded at Iwakuni, Japan. The Meteor T Mk 7 shown became A77-702 and is preserved at RAAF Museum Point Cook, Victoria. 77 Squadron RAAF

Offloading a Meteor onto a lighter.77 Squadron RAAF

Meteors combat ready77 Squadron, RAAF, the Korean War and the Gloster Meteor by Dennis Newton

Sir Eric Harrison, reported that three types could be acquired from British sources: the Venom; the P.1081 and the Meteor. For maintenance reasons he gave first priority to the Venom, second priority to the P.1081 and third priority to the Meteor T Mk 7 De Havilland could deliver 20 aircraft but only between January and June 1952, a twelve-month delay that was not acceptable. The P.1081, already disregarded, was destined never to enter production. Instead, it would be a stepping-stone on the trail of development towards the formidable Hunter - but all too late for Korea. The third possibility, the Meteor, won selection by default. Harrison was advised on November 21, 1950 that 36 Meteor F.8s could be supplied to the RAAF, with delivery of the first twelve within 3-4 months so that 77 Squadron could be equipped with ‘modern’ jet fighter aircraft early in the New Year.

Although the Meteor was the RAF’s front line fighter, it was, in fact, the least ‘modern’ of the three choices. The Meteor F.8 of 1950 was the latest single-seater fighter version of the line. And now the first batch of Meteors had reached the Korean War zone - but they were far from combat ready.

Work BeginsThere was much to be done. Iwakuni was a British Commonwealth Occupation Base under the control of 91 (Composite) Wing, RAAF.This Wing, commanded by Gp Cpt A. D. Charlton OBE, comprised 77 Fighter Squadron, 86 Transport Squadron and 391 Base Squadron. The Base Squadron was commanded by Wg Cdr K. S. Hennock DFC, while the Transport Squadron was in the charge of Sqn Ldr

METEOR | 91

Meteor F Mk 8 WA964 at Iwakuni covered with anti-corrosive inhibitor for the sea voyage. This aircraft became A77-17 and ended its days as a fire-fighting trainer at Laverton air base in the early 1960s. 77 Squadron RAAF

Sqn Ldr Richard Cresswell, CO of 77 Squadron RAAF. 77 Squadron RAAF

Gerber. Sqn Ldr Richard Cresswell commanded 77 Squadron.A detachment of Sunderlands from the RAF’s Flying Boat Wing at Singapore was also stationed there.

There were no harbour facilities at Iwakuni, so HMS Warrior was obliged to heave to about a mile from the jetty. Barges and lighters had been sent from Kure, a former Japanese naval port, for the job of transporting the aircraft ashore. The RAF aircraft handling party, commanded by Flt Lt Fleming, was fully conversant with aircraft lifting procedure. It had carried out the loading onto the ship at Renfrew, Scotland, about six weeks earlier.

Preparing these aircraft for their first flight proved to be very awkward and difficult. For protection from the sea salt they had been covered with black inhibitor but this had baked hard. The anti-corrosive treatment, applied so painstakingly to the surface of the fuselage by the 43 Group Unit in the icy conditions prevailing at Abbotsinch, Scotland, proved more than difficult to remove.

Meanwhile, the remaining twenty Meteor F.8s on order for 77 Squadron had been flown out to Singapore. They were picked up by aircraft carrier and arrived at Iwakuni around midday on Friday, March 23. Off-loading began at once but when darkness fell of the job had not been completed. All, the aircraft were ashore by midday on Saturday.

Initial Pilot TrainingThe purpose of the two Meteor T Mk 7s was for training, to help 77 Squadron pilots with their transition from single-engined propeller-driven aircraft to twin jet fighters. Few had flown jets previously. Prior to the arrival of the Meteors, three Australians had been selected for a jet fighter conversion course with the USAF at Itazuke in Japan flying the F-80C Shooting Star.

The Australians returned to 77 Squadron towards the end of February after notching up ten F-80 missions each.

Four experienced RAF pilots arrived with the Meteors. In charge was a New Zealander, Flt Lt Max Scannell from 12 Group Headquarters, Horsham St. Faith. The other pilots were Flt Lt ‘Joe’ Blyth and Sgt Reg Lamb from 203 APS, Driffield and also Flt Lt Frank Easley from 63

Squadron, Waterbeach.The individual aerobatic flying by Max Scannell and the formation flying by the others was something that was talked about for a long time.

The first Australian pilot checked out was Dick Cresswell and he was soon followed by Flt Lt Compton who was also an Engineering Officer on the base. This proved particularly beneficial because, as the aircraft were prepared for flying, he was able to make the necessary test flights.

Influenced by his experiences with the Americans who had stressed that for jet operations over Korea the ability to operate in all weather was a prerequisite, Cresswell emphasised practice in instrument flying and ground control techniques. Concurrent with lectures, flying continued with more instrument flight training on Mustangs and Wirraways. After a few weeks of lectures and instrument flying, the Australians had at least two flights in a Meteor T Mk 7 with one of the RAF instructors before proceeding to fly solo in a Meteor F Mk 8 Flt Lt Vic Cannon made the first conversion flight on April 17.

A decision had been made for 77 Squadron to continue operational flying in Korea with Mustangs until the end of April. Keen for some operational experience themselves, the RAF pilots volunteered for posting to Pusan on Mustangs prior to the squadron being withdrawn for conversion. Joe Blyth actually flew more than 100 operational flying hours in April and the squadron accumulated an enviable total of 1,700 operational hours for that month.

When Dick Cresswell announced the details of his unit’s planned move back to Japan, there were mixed feelings tinged with sincere regret. The Australians had been integrated with the USAF’s 35th FBG (Fighter Bomber Group) for six months and many strong individual

friendships with Americans had grown during that time. They had met the foe together during the early grim days at Pohang, gone together north to Yonpo to face the bitterly cold winter fighting and then moved back together to Pusan in the hasty retreat that followed China’s entry into the war. Many life-long bonds had been forged between the men, regardless of the country of origin.

By May 8, except for a small rear party, the whole of 77 Squadron was back in Japan at Iwakuni. After two days free from duty, training began, first on Mustangs and then on the new Meteors.

Mounting ProblemsAfter graduating to the Meteor F Mk 8, the next stage of training for the pilots involved was becoming fully familiar with the aircraft and gaining proficiency in its handling. A flying training programme based on the RAF Fighter Command Annual Training Syllabus was put into effect. Because 77 Squadron’s previous role had been tactical support, emphasis during the training period was placed on high altitude flying, air-to-air attacks using the Gyro gunsight, tactical formation flying, fighter-verses-fighter tactics, approach aids under instrument conditions and high altitude navigation. The majority of the pilots had had little or no practice in high altitude flying so, after their initial conversion, all flying, with the exception of armament training, was carried out at 30,000ft or above. A few pilots had never used the Gyro gunsight before and, with the exception of those who had recently joined the Squadron, all were out of practice. Exercises using the gunsight were carried out at altitude, the initial practices being started at 25,000ft and the height was increased as the pilots gained in confidence and grew in efficiency.

Some problems were beginning to manifest themselves. Many of the Rolls Royce Derwent engines were surging at height. It was found that engine RPM had to be reduced by so much that the pilots were not able to maintain formation at altitude, let alone practice for fighting.

The lack of navigational aids in Japan and Korea necessitated a very high standard of pilot navigation and called for accurate flight planning. This was aggravated by the extremely high winds encountered at heights above

10,000ft. Over Japan and Korea during the winter months, an almost permanent jet stream covered the operational area with wind speeds reaching 100-200kts. Before any operational flight, accurate pre-flight planning had to be carried out. Perhaps most important of all, the minimum amount of fuel needed to return to base and carry out a VHF/DF let down had to be determined and included in the pilot’s briefing. The possibility of fitting the American radio Compass ARN-6 to the Meteor was being discussed. This would help substantially with navigation and give an accurate homing course, thus relieving the pressure on the pilot and undoubtedly reducing the traffic on the emergency radio channel.

A square peg for a round hole? – Incompatibility Several factors had the potential to limit the operational use of the Meteor in Korea. This was particularly true with regard to supplies. In most situations, American equipment could not be used. American rockets, wireless

(top, centre) Meteor A77-373 (formerly WA936) on a test flight over Iwakuni. The Meteors were randomly renumbered as a security measure, not in sequence. Note it is not equipped with an ARN-6 radio compass. This aircraft was lost on a rocket strike in May, 1952. RAAF Museum via Bob Wills

Meteor F Mk 8s of 77 Squadron RAAF being prepared for a ground attack operation. 77 Squadron RAAF

In a symbolic changeover from prop to jet aircraft, 77 Squadron’s last Mustang taxis past a line-up of Meteors. AWM

Never allocated to an RAF unit, ex-WA964 was transferred to the RAAF on February 19, 1951 and re-serialled as A77-17. Andy Hay/www.flyingart.co.uk

92

crystals and oxygen equipment were not compatible. Although the USN and USMC were using 20mm ammunition, if this had to be acquired, the shells would need to be re-belted because the American links did not fit the British gun.

Fuel was another possible problem. The USAF was using JP1 aviation fuel but it was expected to begin using JP3 aviation fuel in the near future. If, in the course of time, it switched exclusively to JP3 fuel, which appeared to be the intention, JP1 fuel would need to be specially brought in for the Meteors.

There was an urgent need for a refrigeration device to ensure that the cockpit temperature was cool enough for a pilot to wear sufficient clothing to guard against frostbite if forced to bail out at height. For evasion and escape and high altitude bailouts, it was necessary to wear warm clothing. The most comfortable gear for flying in the Meteor at this time was a summer weight flying suit and underpants but even this was too much when flying below 10,000ft, besides being totally useless as escape apparel. If forced down during a mission, such scant clothing would do little to enable a pilot to evade capture through some 200 miles of enemy held territory.

On the positive side, the idea of flying a twin-engined jet fighter had some appeal. One of the main worries of pilots conducting operations over North Korea was the fear of an engine cutting out, particularly if operating from Japan across 200 miles of sea. Two engines gave a better chance of survival. Few of the Australian pilots had flown a twin-engined aircraft before, let alone a twin with one engine disabled. Asymmetric flying training was therefore most important.

Combat tactics - Meteor vs SabreFlt Lt S.W. Daniel RAF, who was on exchange duty with the USAF’s 334th Squadron at Johnson Field, brought an

F-86A Sabre down to Iwakuni to carry out comparative trials against a Meteor F Mk 8 flown by Max Scannell. These began on the afternoon of May 18. Two days of high speed flying and aerobatics followed, witnessed by those on the ground as both of these very competent pilots carried out the tests within sight of the airfield. It was soon apparent that, above 25,000ft, the Sabre was superior and in a long, straight and level run, the Sabre left the Meteor behind because of its superior Mach number. However, in turning, zooming and in a sustained climb below 25,000ft, the Meteor had a clear advantage.

A serious disadvantage that the British machine did have was the obtrusive blind spot to the rear caused by the end metal of the cockpit canopy.

The Meteor pilots practised basic formations at all altitudes and it was decided to adopt the open battle formation with pairs flying in line abreast for air operations. The best distance between pairs was worked out to be about 500yds at 20,000ft and this was to be increased as height increased, so that at 40,000ft sections would fly at 1,000 to 1,500yds distance. American aircraft on fighter sweeps were currently adopting the fluid six formation, an arrangement that increased visual cover but was lacking in manoeuvrability. The Australians decided that this would be too cumbersome for Meteor operations.

Korea delayedOn June 2, 77 Squadron was ordered back to Korea but, before the move was put into effect, Lt Gen Sir Horace Robertson intervened. He announced that the squadron’s Meteors would not be allowed to operate in Korea without each aircraft being fitted with an ARN-6 radio compass. Robertson’s action was in response to USAF advice. The decision prompted a high priority search for an ARN-6 radio compass to install in a Meteor for proper testing.

Some components of an ARN-6 were made available from ‘an American source’, apparently due to some behind the scenes staff work by General Robertson. This made it possible to start work on a retrospective installation. The first problem was in finding a suitable position for the sense loop. It was essential that it should not be surrounded by a mass of metal. In American installations, it was fitted underneath the rear Perspex of the pilot’s cockpit canopy. In the Meteor, this was not possible, owing to the dural blind spot structure at the rear of the hood. Finally, it was decided to modify the mounting structure for the mast type aerial which had been removed earlier from the top surface of the mid-fuselage. The complete mounting was removed and at Iwakuni’s workshops it was cut away and strengthened, to take the base of the loop. A large dural plate had to be cast and machined to counteract the difference between the contour of the rear fuselage skin and the loop attachment plate.

Placement of the tuning control proved difficult. This knob had to be readily accessible and it was also necessary to avoid excessive kinking of the 20ft flexible drive. A compromise was reached by positioning it under the starboard longeron. It was necessary to reposition the

F-86A Sabre and Meteor F Mk 8 being prepared for the flight comparison trials. Keith Meggs

METEOR | 93

starboard and front windscreen demister switch. A locally manufactured seal was used to provide an effective air seal at the point where the flexible drive passed through the cockpit’s rear bulkhead.

The port anti‑glare panel was cut away to form a mounting for the indicator. This was positioned in such a way that the vision through the port windscreen was not affected.

In positioning the transmitter on the radio tray mounting, it was necessary to move the IFF set about 2 inches nearer to the two 1936 radio installations. It was not possible to obtain a pressure type breeze plug for the leads from the cabin, but in the ensuing pressure cabin tests the ordinary breeze type plug proved to be satisfactory. When the installation was completed, a test to see how it functioned was carried out on the ground and only a very fine adjustment proved to be necessary.

As no plastic cover was available for the loop, Max Scannell carried out a series of flight tests with the loop open to the atmosphere. The sense aerial was attached temporarily by clear adhesive tape to the inside of the cockpit hood. Scannell found the flying characteristics of the aircraft were quite unchanged. A Perspex blister for the loop was manufactured in Australia and soon became available in quantity.

The problem of attaching the sense aerial to the hood resulted in much experimenting with a low voltage soldering iron and Perspex cements. Finally, a very good aerial was made by attaching about 14ft of fine wire in a clear plastic tube to the inside of the hood. The plastic tube was of such a small diameter that external vision was hardly affected.

More problems and crashesThere were still other teething problems that persisted and had to be overcome. Early in June considerable trouble was experienced with faulty readings on jet pipe temperature gauges. Most of this trouble was traced to the cold junction compensator. When a report of this was forwarded to the manufacturer of this component, it was admitted that the fault existed due to the method of manufacture. All of the unserviceable cold junction compensators were exchanged for a modified type that proved satisfactory.

In some aircraft, the 20 mm Hispano cannons were trouble free but in others a stoppage would occur after only a few rounds had been fired. This situation was improved to some extent by fitting a 14‑gauge sheet metal plate at the neck of the ammunition link chute on the inboard and outboard faces which prevented links from twisting and jamming in the neck of the chute. Both starboard guns gave more trouble than the port guns. The guns were made to fire by adjusting the tension on the belt feed mechanism spring and it was noticed that, when the guns had shot off about 200 rounds, it was then possible to fully tension these springs properly. When reporting on these problems, it was suggested that, if a firing butt had been available, the trouble would not have occurred. The efficiency of the guns gradually improved, finally reaching such a pitch that there was only about one stoppage in 1,000 rounds fired. Broken cannon sear lugs and faulty ammunition accounted for 60% of these stoppages.

On the 14th, 77 Squadron suffered two more incidents during its Meteor work‑up programme ‑ one

Meteor T Mk 7 and Meteor F Mk 8 in formation over Iwakuni, Japan. Bill Simmonds

Refuelling a Meteor. The ARN-6 radio compass with plastic blister cover is clearly shown in situ on the top of the fuselage. Fuel was another potential compatibility problem. The USAF was expected to begin using JP3 aviation fuel in the near future. If it switched exclusively to JP3 fuel, which appeared to be the intention, JP1 fuel would need to be specially brought in for the Meteors. AWM

METEOR | 95

was minor and the other an enigma. Sgts Keith Meggs and Dick Wittman had been up to 40,000ft just before dawn and were landing in pairs using landing lights. At the end of the landing run the two aircraft collided. Keith Meggs, leading in Meteor A77-587, landed but just before coming to a stop, his radio and landing lights cut out. The following machine, Dick Wittman’s A77-373, with its windscreen and side panels misted up obscuring the pilot’s vision, slowly taxied into it. Fortunately, nobody was hurt.

The second incident occurred when Sgt Tom Stoney, a veteran of over 100 missions in Korea, took off in the afternoon to perform an acceptance check on Meteor WA944. If accepted, it would take up its allocated RAAF serial A77-231. Within a few minutes of leaving the ground, he was seen to be dropping by parachute with his aircraft making right hand turns around him. It flew around him five times and at one period it was only 20ft away before it crashed into a hillside four miles west of Iwakuni. Stoney was able to gather his parachute and walk down to a jeep that took him to hospital. There it was discovered that he had sustained a slight injury to his spine and suffered abrasions to his wrist, thigh and tongue. In the subsequent interview, Stoney remarked that at the time of the ejection he was leaning slightly forward in the cockpit with his left hand on the throttle and his right hand on the control column. The ejection had been entirely automatic and he had been catapulted up by the ejection seat clear through the canopy, which had not been jettisoned.

June lived up to its reputation of being the wettest month of the year but the real problem facing the ground crews servicing 77 Squadron’s new Meteors was the manner in which the sun would shine immediately after a very heavy shower of rain. This caused heavy condensation in the rear fuselage. After a weekend of particularly heavy rain, the radio mechanics found that nearly 60% of the aircraft radio receivers were unserviceable. In most instances the trouble was in the device’s mictel relay situated in the rear fuselage. In some cases there was moisture in the transmitter, but practically all of the trouble was caused by condensation resulting in the shorting of circuits. As a consequence of this, it became standard practice in wet weather for mechanics to remove the radio sets or not to operate them until the rear fuselage had been properly ventilated by the removal of the radio access panel.

Towards the end of the month, despite only a proportion of the Meteors being fitted with their ARN-6 radio compasses, it became apparent that the Squadron would soon be moving from Iwakuni back to Korea. The Meteors T Mk 7 carrying radio officers as passengers were making numerous trips to Kimpo airfield, near Seoul. The reason for this was to establish a pattern for GCA.

On the 20th, 77 Squadron commenced its move back

to Korea. Its ground equipment was airlifted to Kimpo by the USAF in seventeen C-119s and seven C-54s. Dakotas of 86 Squadron transferred its forward ground personnel.

KimpoBy July 25, 1951, 77 Squadron was fully established back in Korea with its new Gloster Meteors. It was ready to operate from Kimpo airfield near Seoul, home of the USAF’s F-86A Sabre-equipped 4th FIW (Fighter Interceptor Wing). The transfer from Japan to Kimpo had taken most of the month.

Five American C-54 transports flew the next elements of the squadron in on July 20. The newly arrived ground crews were greeted by driving rain and mud that hampered unloading operations and the establishment of the unit’s maintenance facilities. Training was commenced co-ordinating with the GCI station sited near the airstrip, known under the call sign of “Dentist”. Although the lack of refuelling tankers - there were only two available at the time - restricted initial training somewhat, practice interceptions did begin under Dentist control for flights of four aircraft. Despite the limitations, 20 training sorties were flown on the 27th, the day that Lt General Robertson at last sanctioned the squadron’s return to operational flying.

EpilogueBetween August-December 1951, fighter operations regrettably showed that Meteor F Mk 8s did not have the performance to match the MiG-15s in air-to-air combat, especially at higher altitudes. A gruelling encounter on December 1 in which three Meteors were lost and one severely damaged for two MiGs confirmed destroyed credited to the squadron provided the final straw. At the beginning of 1952, their role was changed to that of ground attack. While performing this duty, 77 Squadron achieved an outstanding record. The Meteors also gave a good account of themselves on the few occasions that they did clash with MiGs at lower altitudes.

Keeping the British jets ready for combat continued to create problems right up to the end of hostilities in July 1953. The other non-American squadron operating in Korea, 2 Squadron, South African Air Force, swapped its F-51D Mustangs for F-86F Sabres early in 1953. Its changeover and ability to function was technically much less difficult because it was using American equipment in an American combat zone – it was compatible. The Australian squadron did not have that same luxury of direct access to an abundance of US ordnance and spares.

At times, keeping the flow of necessary British equipment coming in proved difficult, particularly because of the Commonwealth’s commitments elsewhere, such as in Malaya and Europe. Nevertheless, despite the problems caused by incompatibility that cropped up along the way, the Meteors were kept combat ready. ✤

(top, right) At Kimpo, South Korea, at last, four Meteors wait for a Sabre of the 4th FIW to land before they take off on a mission. Ted Leach

(top, centre) Meteor F Mk 8s of 77 Squadron RAAF and F-86F Sabres of 2 Squadron SAAF in formation over Korea. The South African squadron was the other non-American squadron operating in Korea. It swapped its F-51D Mustangs for Sabres early in 1953 and its changeover was technically much less difficult because of compatibility. The Australian squadron did not have the same luxury of access to an abundance of US ordnance and spares. Dirk Stoffberg

96

WK938 was the last of 470 built by Armstrong Whitworth and was destined never to enter operational service. It was, instead, uniquely converted with an extended nose containing a second cockpit for prone pilot trials. The experiment did prove that ‘G’ forces can be withstood better when lying in the prone position. However, it did not lend itself to being able to see to the rear and the controls proved to be quite tiring to operate. Aeroplane

METEOR | 97

98

The longest Meteor ever madeThe good old Meteor brought generations of English pilots into the jet age like an aluminium midwife. It made some great pilots: it killed far too many others. We all respected its aerodynamic vice-lessness, but came to despise its ugliness, hated its crude discomforts and worked to survive the barely adequate environment in which we flew it. Sabre pilots smiled down on us.

Meteors were used for every kind of experiment and one of the oddest was the prone-pilot Meteor converted from an F Mk 8 by Armstrong Whitworth in 1955. It was the longest Meteor ever made and it showed that you can’t fly fighters effectively lying on your tummy. That’s progress.

The serious trials were over in March 1956 when I, with about 380 hours of Meteor F Mk 8 time, was invited to fly prone. The beast belonged to the Institute of Aviation Medicine at Farnborough and I was to fly with what was even then a dwindling breed, a RAF flying doctor.

I knew nothing of the military requirements behind the prone Meteor but the reasoning seemed to be “If the ride is going to be rough, take it lying down. If you’ve got to control it, lie on your tummy like the Wright brothers or Northrop.” If not, I mused, “lie on your back and think of England?”

Piloting in gliders and spacecraft has since changed all that but the designers in the early 1950s were probably considering another significant point. The prone posture looks right for a pilot in an air-breathing fighter taking off vertically from a ramp but not for landing normally on a runway. Those were the days when the Russian threat was hanging from fleets of Tu-4s, to small numbers of jet bombers bringing nuclear bombs in at 35,000ft or higher. Just three of the big ones could wipe out England, and the defending fighters had to scramble in seconds and climb like bullets in order to hack the bomber down in the few minutes between first radar identification and the bomb-release point. To squadron Meteor pilots struggling around at 35,000ft or more, it seemed much more likely that an attacker trying to plant a single bomb on London would come in at nought feet, alone, under the radar and in poor weather.

We saw the USAF doing something like it during air defence exercises. Thirty or more F-84 ‘attackers’ would run up to the coast at 30,000ft and, as soon as they were bounced and a dog-fight started, a ‘loner’ would plummet down out of the formation, head for the deck and start his run-in for a LABs toss-bombing delivery. But I digress.

Trussed up like a chicken!Prone piloting was not, incidentally, the only way to deal with vertical fuselage attitudes. SNECMA in France, working on the tail-sitting Coléoptère, probably had a better solution in simply rotating the pilot forward in his seat while the tail-sitting was going on and giving him a second windscreen in the floor. Once in horizontal flight, he tilted back into a normal position under the bubble canopy. The problem was that the transition from horizontal flight to tail-sitting landing called for the pilot to swoop up into a vertical climb, stop in mid-air and then let down tail first for up to 1,000ft on to the landing pad, descending slowly enough not to re-ingest exhaust into the intake and stop

Flying the prone ‘Meat-box’Mark Lambert recalls the occasion when he prostrated

himself to fly the strangely-modified prone-pilot Meteor

The neatly modified Armstrong-Whitworth nose and extra cockpit of the prone-pilot Meteor WK935 is shown to good effect in this image with the pilot straining his neck to look up at the camera. Via Martyn Chorlton

METEOR | 99

the engine. Judgement of rate of descent was critical and failed on the very first attempt, leading to a timely ejection by the pilot and an equally timely cancellation of the whole project by the government.

My prone pilot Meteor flight was far less adventurous, though it was a great enough experience to be admitted to RAE Farnborough, which was then one of the world’s inner sancta of experimental flying. RAF flying doctor John Wambeek, then and since famous in the aviation medical world, was to sit in the normal upright ejection seat of the Meteor and he presided over my installation.

I put on a normal seat-type parachute, climbed up a step-ladder and flopped onto the padded couch directly under the sideways-opening canopy. My feet dangled into the cavern above the nose-wheel and a ground-crewman placed them on organ-type rudder pedals out of sight astern. My forearms were threaded through the gap, on either side of the couch and, rested my elbows on padded side-rests. With four switches beneath my chin I ran electric motors to adjust the angle of thighs relative to body, thigh length, knee-to-ankle length and chest height. After some experimenting, I achieved the objective of distributing my weight evenly over the padding, not too much weight on the knees or elbows and the chin supported at a good height to see the instruments and look forward through the windscreen.

The parachute now rested on a prop projecting rearwards between my thighs and a harness holding it to the rear of the bench also held me firmly in place. Other harness straps passed over my shoulders and waist to stop

me moving forwards or upwards. I could now neither extract my arms from the side channels nor raise my head significantly off the chin rest. Nor could I turn my head sideways. No good developing a runny nose! The parachute junction box lay in a groove in the couch but the harness junction box inevitably lay totally out of reach in the middle of my back. I could release it by pulling a lanyard.

You can’t eject in any direction lying down. The only way out of the prone Meteor was to slip feet-first off the rear end of the couch and through the floor. One trusted that ‘G’ would be acting normally at the crucial moment. To depart in a hurry, the pilot first pulled a lever to jettison the ventral fuel tank and to retract the nosewheel, if it was extended. Both would be bad news to a passing body. He was then to pull a plunger to make a hydraulic jack force the leg portion of the couch down into the airstream so that he was hanging over the abyss, so to speak. A final lever under the couch was to release the body to fall out of the aircraft and a long static line would open the parachute or trigger the barometric parachute-opening device.

The Meteor’s brakes were strictly 1940s vintage and, should they show signs of failing, the prone pilot would be uncomfortably close to the ensuing accident. Ditto if the nosewheel failed to extend. In either case, the prone pilot was to manipulate the next-of-kin levers and earn his caterpillar. No-one ever had to try it, but it was a reasonable compromise system under all the circumstances.

A few seconds in the trussed chicken state of the prone position was enough to show up essential problems. Able to move only my forearms, I could not reach anything distant and had very little muscle power available. The stiff old Meteor trim, flap and undercarriage controls were distributed round the left side of the flat shelf under the chin rest, some of them permanently out of sight, and were even harder to work than usual. The instrument panel was inevitably much closer to the eyes than normal, but even so, the heading-select and synchronising knobs of the G.4F gyro-magnetic compass carried six-inch long stalks to bring them within reach. The pressure instruments were tilted forward on a separate panel to reduce parallax, but the gyro horizon and compass had to remain vertical in those days and were therefore recessed forwards, so that the horizon was partly obscured by the ‘G’-meter. Good old ergonomics!

To make discomfort absolutely certain, the prone Meteor was not pressurised and the draughty nosewheel bay formed part of the front cockpit, which made it unbelievably cold in hard weather. Those familiar with the disgracefully crude Meteor T Mk 7 will vividly remember flying at 40,000ft in winter with cockpit temperatures around -30C° and a pathetic heater. “Things become

WK935’s extra cockpit, giving a good view of the prone-pilot position and,

note the transparent vertical panel.

Via Martyn Chorlton

Prone-pilot diagram displaying the four electric screw-jacks which controlled the pilot’s eye-level, angle of thigh to body, thigh length and rudder pedal reach. Via Aeroplane

100

pretty chilly in consequence,” I wrote sedately at the time. The Meteor windscreen used to mist over completely during a normal descent from altitude and lots of hot air was needed to clear it. The prone Meteor had such a supply but I note from my report that “at full throttle this produced a certain amount of acrid smoke and jets of dusty air converged on my eyes and forced me to close them . . .” Good old British design.

Poor ergonomicsOnce fastened so strangely into an aircraft I otherwise knew extremely well, I felt as if I were trying to drive a familiar car from the back seat. Curiously, the rudder responded quite normally. I had expected to feel inside-out, but left foot for left turn works whichever way up you are. My head was perhaps 10ft further forward than usual and I was way ahead of the nosewheel but there were no problems taxiing, using brakes and rudder together to steer.

As usual in the Meteor, we did not pause to warm-up. The moment the engines were running we moved off to save fuel and did the take-off checks on the run. By the time we reached the runway threshold, we were impatient as always to blast off. A ‘go’ from the holy minaret of Farnborough control and away we went, accelerating uphill towards the black sheds. At the regulation 70kt, I hoisted my end of the aeroplane off the ground to spare the nosewheel, groping for the now unfamiliar attitude. At 120kt, I lifted the main-wheels off the runway, squeezed the brakes and selected gear up. To compensate for the extended nose, a Mk 12 fin with limited rudder travel was fitted to maintain stability ailerons because of the unexpected lightness of the powered controls.

A change of frequency to approach and roll into the standard 45° bank for a rate one turn on to the climb heading. Accelerate to 300kt and pull up into the fresh, free sky, no airliners above 11,000ft then! At around 20,000ft I started to feel the aircraft out, turning more and more tightly, extending and retracting airbrake, flying on instruments, testing the sensation of steep descents. It all seemed surprisingly normal,

even the headfirst plunge of a steep dive.Above 20,000ft, we usually left the throttle wide open

and kept our position in the battle formation by playing the cross-over turns and using height. We could not turn very tightly at high altitude and spent most of the time either rumbling and nodding on the edge of the stall or trying to hold off compressibility. At Mach 0.76, the nose would try to rise and by the time we had two hands on the stick to hold it down, ‘the Mach’ proper would grab hold at around 0.79. The ailerons would twitch violently and the Meteor would rock uncontrollably from side to side and buck hard until we managed to slow down again. Airbrakes and ‘G’ made it worse. We could improve the turning performance by popping 10° of flap if we could get to the lever at full arm’s stretch while pulling several ‘G’ and move it exactly at the right amount. Ergonomics again.

None of this changed significantly in the prone position, except that it was impossible to look sideways, let alone rearwards and that would be fatal for a fighter pilot. I was more relaxed than usual, not having to tense leg and stomach muscles hard whenever the grey-out threatened.

I tried some aerobatics. Up into the loop at 340kt, slow over the top, 5,000ft above, down into the long dive with airbrakes out and pulling about 4g. Rolls and hesitation rolls, it was all totally familiar. Wambeek was making occasional comments but taking little part in the proceedings. Afterwards, I discovered why. I was not feeling the effects of ‘G’ at all; he was!

Finally, I spied a lone Meteor F Mk 8 evidently returning to Odiham, where several squadrons were then based. ‘Here we go’ I thought, ‘Never miss a chance to bounce someone.’ To keep the authorities calm, I wrote afterwards that this was a prearranged meeting, but I don’t suppose those of them who read the story believed that either. The Odiham chap must have been fast asleep, or busy preparing for the QGH controlled descent. He didn’t even twitch as I curved in on him in a standard high quarter attack, sashayed through his slipstream with full aileron and curved away below and beyond him, losing him instantly and dangerously from view.

I spent the last few minutes at around 1,000ft looking

WK935 was originally built at Moreton Valance as an F Mk 8 to contract 6/Acft/6066 in late 1951. The aircraft never entered squadron service and, after conversion by Armstrong Whitworth at Baginton, the aircraft only served with the Institute of Aviation Medicine at Farnborough before being withdrawn from service after a short flying career. Via Martyn Chorlton

METEOR | 101

at prone low-level navigation which we, in our F Mk 8s, normally did much nearer 50ft in the permitted low-flying area. The main problem, which I was the last to discover, was that you couldn’t see where you were going in a steep turn and all Meteor turns were two-handed steepies at those heights. My neck was strained to see forwards, let alone towards the inside of the turn. That’s fatal.

Even more, you must see back over your shoulder and that was totally impossible. Fighter pilots then and now must be able to spend time looking back to guard their tails. No way while prone.

I flew back to Farnborough, made the run-in along the runway heading and rolled into the starboard, continuously turning circuit. It was hard to keep the runway threshold in sight during the final curved

approach, flown at 40° bank while bleeding the speed off from the 175kt gear-down speed to 120kt on finals and 105kt at touchdown. The nose, and my head with it, seemed a long way above the runway as the main wheels touched and then we dropped like the jib of a crane as I lowered the nose at the regulation 70kt. The nosewheel threatened to burst if lowered at much more than 70kt and you couldn’t hit the brakes until then. If you then used them too hard, they would fade completely before stopping the aircraft.

Relief from ‘G’I cannot report that the prone position was comfortable. Try lying on a table with your toes resting on a chair and looking out of the window. But one part of the scheme worked extremely well. When I clambered out, Wambeek was red-faced and sweating in his upright seat. The ‘G’ I had pulled, normal for the rather rough, tough flying of the fighter world, had given him a beating, whereas I was quite

fresh and cool. The ‘G’ suit was introduced as much to reduce the fatigue of being pummelled by gas to push the black-out threshold back an extra ‘G’ or two. The RAF did not adopt the ‘G’-suit until the Hunter and Swift arrived.

There is nothing so extraordinary about flying on your tummy. The Wright brothers started that way. The Germans, Northrop, Reid and Sigrist all tried it. But in the end the glider pilots have found the answer - lie on your back. The F-16 pilot takes nine ‘G’ sustained in his 30° inclined seat. The glider pilot lies down to reduce frontal area. In military aircraft, ‘G’ is the main stimulus because engine and radar may well dictate fuselage cross-section more than the height of the sitting pilot.

So the prone-pilot Meteor passed into the underworld of 12 MU before it was finally grounded. Maybe its most significant feature was, after all, its record-breaking ( for a Meteor) 51ft 5in length. ✤

(top) Official photograph dated February 10, 1954 claiming to be the first image of the ‘prone pilot Meteor’ with Armstrong Whitworth Chief Test Pilot, Eric George Franklin DFC, AFC at the controls. Via Martyn Chorlton

(above) WK935 only flew for a total of 55 hours over 99 test flights before being retired and today is on display at the RAF Museum at Cosford. Via Martyn Chorlton

Andy Hay/www.flyingart.co.uk

102

Droning over the Fens

A pleasing shot taken from Marshall’s Citation on March 11, 1987. The repositioning of the lamp under the nose to make room for the experimental camera is apparent. The pilot’s silly grin is, however, invisible. Keith Ingles/Marshall Aerospace

WK800 at Farnborough in early 1987 having its Radar Vector Miss

Distance Indicator (RVDMI) system calibrated by means of the missile seen passing along

wires overhead. The upper radomes are clearly visible as is the right upper airbrake which is

partially extended. DRA Farnborough

Over 40 years after the type’s fi rst fl ight, a Meteor, WK800, was modifi ed by Marshall of Cambridge (now Marshall Aerospace) for trials of new target drone equipment.

Extensive alterations and fl ight trials extended over fi ve years. Here, Tim Mason, the pilot involved relates the story.

METEOR | 103

Developing the droneA photograph of Meteor WK800 for sale at Boscombe Down reminded me of an episode some 20 years ago.It was one of those rare occasions of being in the right place at the right time. I was the sole pilot authorised to fl y it, which I did for about 45 hours between 1986 and 1988. I was a pilot at Marshall of Cambridge and the Meteor provided an interesting addition to the Tristar, Hercules, Citation, Aztec and Cessna 152 fl ying of the normal daily grind (‘grind’ is misleading ‘fun’ would be more appropriate).

The company had a contract to fi t and test some new kit under development for future target/drone aircraft and

WK800 had arrived at Cambridge in 1983 after a chequered career, including time in Australia. By 1986, I remained the only pilot with relevant experience by which time the aircraft was ready to fl y after lengthy tests in the hangar. So it was off to Llanbedr where Len Morgan gave me a good work out in their T Mk 7, but was it REALLY necessary to fl y around so much on one engine? Overshooting (or missed approach as my civil fl ying was teaching me) using the port engine only (i.e. simulating the failure of the starboard engine with the sole hydraulic pump) caused knee trembling of monumental proportions since the undercarriage had to stay down at low speed and high power. 30 years previously at Worksop similar activity had not caused such pain and my young body had coped for the eternity of pushing like hell on the left rudder bar. Anyway, three cups of coff ee later and the Masonic corpus reverted to normal static sloth.

Flight testing and modsCome the big day, they towed WK800 ‘down the fi eld’ as we used to say, ready for the lucky boy to air test before installation of new kit. First step, strap into the Mk 1

ejection seat (separate seat and parachute harness) after a careful external walk round ensuring that the ignition switches in the wheel wells were up and on (as per NATO standard). Then strap on the test pilot’s knee pad (I never did discover what would happen if I had a knee-trembler with it on), careful checks from my list, thumbs up (would aviation have progressed so far without thumbs?), press the starter buttons………. A whirring sound from the left engine but no sign of light up. Same with the right, must be a gremlin. Try with a new trolley acc (battery)….still no joy. Smell of fuel, quick discussion with hastily summoned hangar supervisor, pin (one only) back in ejection seat and Mason debarks. The reason, my digit was well in – the ignition switches in the wheel well were DOWN for on

Meteor U Mk 16 WK800 ready at Cambridge with pilot aboard for its � rst   ight for over three years on April 28, 1986. No trials modi� cations had been made. Marshall Aerospace

104

(NATO hadn’t been invented when the ‘Meatbox’ was designed). Two sorties sufficed to prove all was well, including relight of the engines and a bit of asymmetric flying at low speed/high power; the later single seat Meteors had a redesigned rudder with efficient tabs and end plates making rudder forces more manageable, but still heavy. Then another year back in the shed for installations including the ten radomes (two transmitters top and bottom of the centre fuselage and eight at the extremities) for the Radar Vector Miss Distance Indicator (RVMDI), a TV camera in the nose, a data link and later a TV miss distance indicator.

Flying restarted in January 1987 with threshold speeds raised just in case the 5% of wing area lost to the wing tip radomes reduced lift. First flights revealed no significant change to stalling speeds and the only noticeable effect was the severe turbulence and noise generated by the top nose radome. We decided to restrict flying to a maximum of 400kts as a result. Otherwise, all the good test-piloty stuff like rates of roll, stick force per g and critical speeds proved satisfactory. In another manifestation of the age of the aircraft, with no mandatory height encoding altimeter (Mode C), special clearance had to be obtained from air traffic control to fly once above 10,000ft. Also, crystals for the wireless set (careful choice of nomenclature!) had to be specially grown for local UHF frequencies. There was a minimum order for new crystals and I now have 15 in my garage – does anyone want them – they’ve stopped growing? All the kit worked as advertised, and the trials team in their caravan received good close up TV pictures of themselves from unnecessary but enjoyable low passes over the top.

FarnboroughAnd so to Farnborough for tests using a dummy rapier in a hangar, then back to Cambridge; we took some happy snaps from the accompanying Citation. Next was a detachment to Llanbedr, home of the drones and ‘my’ Meteor, and 16 enjoyable but unremarkable flights. I perfected the trick of half opening the fuel cocks when the undercarriage green lights dimmed on start up without threatening to burn out the turbines. Back in the flat Fens, accuracy checks of the kit required flying at 55ft along the two mile length of Bedford’s runway, passing only inches, it seemed, from a dummy missile mounted on a 55ft pole while kinetheodolites measured precise separation; on board recorders also marked each metal drain cover as we passed over it. Further accurate flying and navigation were needed on a track between Waterbeach and Ridgewell (both old RAF airfields near Cambridge) to assess recording instruments in the ground caravan. After landing I was told that I had crossed track many times but remained within 200 yards of it! Close enough for government work, I thought.

After a hiatus to fit wing tip TV cameras, the remaining flying was based at Llanbedr again using the nearby range at Aberporth. One incident could have spoilt the whole trial. I decided to complete some optional test points at the end of the sortie as the range controller reported no change in the favourable weather at Llanbedr where I planned a smart visual landing. On calling the airfield, I was horrified to learn that the cloud base was 200 to 300ft and reducing! I watched the fuel gauges move towards empty as I debated the advisability of closing down one engine to save fuel – but the short distance made this a marginal benefit in spite of the lengthy radar circuit. The controller gave me an immaculate GCA (precision radar) talk down and I

WK800 on June 15, 1988 departing Cambridge with Phase II modification. Cameras above and below each in evidence. Marshall Aerospace

The pilot and author, Tim Mason, prepares for another sortie from Cambridge in WK800 in the spring of 1988. Marshall Aerospace

METEOR | 105

picked up the runway lights at half-a mile. After a few more mundane trips, the trial fi nished and I reluctantly handed the aircraft back to its rightful owners in July 1988. WK800 fl ew with them in both piloted and pilotless confi gurations before delivery to Boscombe Down.

Representing WK800This was not the end of the RVMDI trial, as

Llanbedr’s Meteor T Mk 7 WA662 was sent in bits to Cambridge to be part modifi ed to

represent WK800. The upper aerials were fi tted, the RVMDI installed and

the nose extended. The aircraft was sent to Farnborough, where it received close encounters of the missile kind; it was later taken to Shoeburyness for further tests in an undignifi ed attitude. ✤

(insert) Meteor Trials ‘zap’ as designed by Ron Goodger on a rainy day at Llanbedr in 1987.

Meteor T Mk 7 WA662 undergoing further calibration at Farnborough having been modi� ed on the underside to replicate the U Mk 16. Radomes have not been � tted but the aerials are visible. DRA Farnborough

The last Meteor four-ship? Sqn Ldr Mick Doherty pushing along in the T Mk 7 with three drones in vic on January 29, 1978. Cardigan Bay is in the background. Via Author

Representing WK800This was not the end of the RVMDI trial, as

Llanbedr’s Meteor T Mk 7 WA662 was sent in bits to Cambridge to be part modifi ed to

represent WK800. The upper aerials were fi tted, the RVMDI installed and

the nose extended. The aircraft was sent to Farnborough, where it received close encounters of the missile kind; it was later taken to Shoeburyness for further tests in an undignifi ed attitude.

106

METEOR | 107

Cutaway with key. Aeroplane

The World Air Speed Record BreakerThe Gloster Meteor IV

(Two Rolls-Royce Derwent V Turbo-Jet Units)

A total of 3,881 Meteors were built by the Gloster Aircraft Company, Armstrong Whitworth, Fokker and Avions Fairey from 1943 to 1954. Aeroplane

110

Massed ‘meat-box’ productionGloster E.28/39 to the Meteor NF Mk 14 production from 1943 to 1954. Compiled by Owen Cooper

Building the ‘meat-box’The Meteor was a huge success, not only for the Glosters and Armstrong Whitworth, but also the British economy for over ten years non-stop. It ensured that thousands of people had a job to go to during the bleak post-war years and helped to establish the British aircraft industry as whole, which, unknowingly, was enjoying its heyday.

The Meteor was a conventional design, created in an era dominated by piston engined types, making the transition for those engineers experienced from that period much easier.

(top) Original photo caption: ‘Meteors in the Making – Jets for Western Union Defence Gloucester’ Jet aircraft which form the spearhead of Western Union Defence, being assembled at the Gloster Aircraft Company’s Works at Hucclecote here.The planes are Meteor T Mk 7, F Mk 8, FR Mk 9 and PR Mk 10 versions of the twin-jet plane now in service with many air forces. The latest version of the Meteor has increased range and many new features. It can climb at the rate of 30,000ft in 6½ minutes and, in addition to the normal armament of four 20mm cannons, can carry sixteen rocket projectiles or two 1,000 pound bombs. Mr G. R. Struass, Minster of Supply, today visited the factory and saw the Meteors under construction. Dated March 28, 1951. Aeroplane

Original photo caption: Meteor jet fighters on the production line in the main assembly shop of the Gloster Aircraft Company’s plant at Hucclecote, Gloucestershire, visited by the Minister of Supply today (Wednesday). Mr George Strauss, the Minister, saw rows of newly completed fighters for Denmark, watched production of the jet planes and went for a flight in one from Morton Valence airfield. Dated March 28, 1951. Aeroplane

METEOR | 111

British production of the Meteor was confined to three major sites, namely Gloster’s own factory at Hucclecote, east of Gloucester and Armstrong Whitworth’s plants at Baginton, near Coventry and Bitteswell, west of Lutterworth. Between the two companies, 3,514 Meteors were built (2,404 by Gloster and 1,110 by Armstrong Whitworth), Gloster producing all marks up to F Mk 3, then the F Mk 4, T Mk 7, F Mk 8, FR Mk 9 and PR Mk 10. Armstrong Whitworth was initially sub-contracted to produce the F Mk 4 and F Mk 8 and then became the sole producer of all four night-fighter variants, the NF Mk 11, 12, 13 and 14 these were general being referred to as Armstrong Whitworth Meteors.

Overseas, N.V. Koninklijke Nedelandse Vliegtuigenfab-riek Fokker, Schiphol in the Netherlands built 330 Meteor F Mk 8s between 1951 and 1954, 155 went to the Royal Netherlands Air Force and 145 to the Royal Belgian Air Force. Both countries were already operating the F Mk 4.

Gloster continued to ride on the back of the Meteors success with the Javelin which first flew in 1951. However, the overseas orders never came and only 436 were built, all supplied to the only customer, the RAF. By the 1960s, the industry had suddenly become very bleak and, in 1961, Gloster merged with Armstrong Whitworth to form Whitworth Gloster Aircraft Ltd. This was to be short lived and in 1963 the company was incorporated into the Avro Whitworth Division of Hawker Siddeley Aviation. From this point onwards, Gloster ceased to exist and, by 1964, the site at Hucclecote was closed and sold off.

PROducTiOnE.28/39Two prototypes, W4041 and W4046, ordered

under Contract SB.3229.

F.9/40 Prototypes Twelve prototypes ordered under Contract SB.21179/C.23(b) on February 6, 1941 in the serial range DG202 to DG213. Only DG202 to DG209 (8) were built because of engine development delays.

F Mk 1 20 aircraft ordered under Contract Acft/1490/CB.7(b) in August 1941 and delivered between February and September 1944 by Glosters, Hucclecote. Serial range EE210 to EE229.

F Mk 2 Only one F Mk 2 was produced by converting F Mk I DG207.

F Mk 3 210 aircraft ordered under Contract Acft/1490/CB.7(b) in the serial range EE230 to EE493 and delivered between November 1944 and December 1946 by Glosters, Hucclecote. One aircraft went to RAAF for evaluation; one aircraft to RNZAF for evaluation; one aircraft to SAAF for evaluation.

F Mk 4 70 aircraft ordered under Contract Acft/1490/CB.7(b) in the serial range EE517 to EE599 and delivered between March and December 1946 by Glosters, Hucclecote. 100 aircraft ordered under Contract Acft/1490/CB.7(b) on August 14, 1943 in the serial range RA365 to RA493 and

A pre-production cutaway diagram of the Gloster F.9/40, dated August 26, 1942 by Frank Whittle’s Power Jets Ltd at Lutterworth. This drawing pre-dates the first flight of F.9/40 dG206/G at cranwell on March 5, 1943, so perhaps explains why there are some detail differences here compared to the actual early Meteors. The initials ‘FW’ are visible on the original which could indicate that this copy was for Frank Whittle, but the letters are not in his handwriting. Aeroplane

112

delivered between December 1946 and January 1947 by Glosters, Hucclecote.

200 aircraft ordered under Contract 6/ACFT/658 in the serial range VT102 to VT347 and delivered between January 1948 and March 1949 by Glosters, Hucclecote.

58 aircraft ordered under Contract 6/ACFT/1389 in the serial range VW255 to VW315 and delivered between December 1948 and March 1949.

12 aircraft ordered under Contract 6/ACFT/1389 in the serial range VW780 to VW791 and delivered between January 1948.

46 aircraft ordered under Contract 6/ACFT/2430 in the serial range VZ386 to VZ437 and delivered between August 1949 and April 1950 by Armstrong Whitworth, Baginton.

Serial prefix range: EE (75), RA (100), VT (200) & VW (73) and VZ (1). 50 diverted from RAF contracts and 50 new-build to Argentina; 48 to Belgium; 34 to the Netherlands; 20 to Denmark; twelve to Egypt and G-AIDC (private-venture T Mk 7); five aircraft loaned to RCAF and one to France.

Total Production:- 604 (558 built by Gloster, 46 by Armstrong Whitworth)

PR Mk 5 One aircraft, VT347, transferred to Contract 6/ACFT/1418/CB.7(b).

T Mk 7 70 aircraft ordered under Contract 6/ACFT/1389 in the serial range VW410 to VW489, delivered between October 1948 and July 1949. (VW430 converted to prototype NF Mk 11).

21 aircraft ordered under Contract 6/ACFT/2430 in the serial range VZ629 to VZ649, delivered between July and September 1949 by Glosters, Hucclecote.

137 aircraft ordered under Contract 6/ACFT/2982 in the serial range WA590 to WA743, delivered between August 1949 and February 1951 by Glosters, Hucclecote.

89 aircraft ordered under Contract 6/ACFT/5044 in the serial range WF766 to WF883, delivered between January and August 1951 by Glosters, Hucclecote.

160 aircraft ordered under Contract 6/ACFT/5621 in the serial range WG935 to WG999 and WH112 to WH248, delivered between August 1951 and March 1952 by Glosters, Hucclecote.

126 aircraft ordered under Contract 6/ACFT/6066 in the serial range WL332 to WL488, delivered between March and November 1952 by Glosters, Hucclecote.

13 aircraft ordered under Contract 6/ACFT/6066 in the serial range WN309 to WN321, delivered between

A somewhat chaotic scene at Hucclecote, where a host of components in the foreground steadily travel towards to the hangar exit in the distance and turn into a Meteor! Aeroplane

METEOR | 113

November 1952 and July 1953 by Glosters, Hucclecote.25 aircraft ordered under Contract 6/ACFT/6410 in the

serial range WS103 to WS127 for the Royal Navy. Only WS103 to WS117 delivered between May and July 1952; remainder cancelled.

60 aircraft ordered under Contract 6/ACFT/6411 in the serial range WS103 to WS211. All except WS140 and WS141 delivered in November 1953 were cancelled.

Seven aircraft ordered under Contract 6/ACFT/6411 in the serial range XF273 to XF279, delivered between November 1953 and July 1954.

Serial prefix range: VW (70), VZ (21), WA (137), WF (89), WG/WH (160), WL (126), 13 (WN), WS (27) and XF (7). Nine T Mk 7s to Australia; three new-build and nine diverted

from RAF contract to Belgium; nine to Denmark; approx. 45 to the Netherlands; three to Egypt; four to Israel; three to Sweden and thirteen to the France. G-AKPK was F Mk 4 G-AIDC converted and G-ANSO was F Mk 8 G-AMCJ converted.Total production:- 677

F Mk 8 73 aircraft ordered under Contract 6/ACFT/2430 in the serial range VZ438 to VZ517, delivered between February and June 1950 by Glosters, Hucclecote.

45 aircraft ordered under Contract 6/ACFT/2430 in the serial range VZ518 to VZ569, delivered between June and October 1950 by Armstrong Whitworth, Baginton.

35 aircraft ordered under Contract 6/ACFT/2430 in the

serial range VZ577 to VZ611, delivered between November 1950 and April 1951 by Glosters, Hucclecote.

210 aircraft ordered under Contract 6/ACFT/2983 in the serial range WA755 to WB112, delivered between October 1950 and April 1951 by Armstrong Whitworth, Baginton and (WA813 to WA857, WA867 to WA909 and WA920 to WA964) by Glosters, Hucclecote.

120 aircraft ordered under Contract 6/ACFT/4040 in the serial range WE852 to WE976, delivered between April and May 1951 by Armstrong Whitworth, Baginton (to WE902) and by Glosters, Hucclecote (the remainder).

89 aircraft ordered under Contract 6/ACFT/5043 in the serial range WF639 to WF760, delivered between June and September 1951 by Armstrong Whitworth, Baginton (WF639 to WF688) and by Glosters, Hucclecote (the remainder).

200 aircraft ordered under Contract 6/ACFT/5621 in the serial range WH249 to WH513, delivered between September 1951 and February 1952 by Glosters, Hucclecote.

373 aircraft ordered under Contract 6/ACFT/6066 in

the serial range WK647 to WL234, delivered between March 1952 and June 1955 by Glosters, Moreton Valence and WK707 to W756 and WK906 to WK935 built by Armstrong Whitworth, Baginton. WL192 to WL207 and WL221 to WL234 all cancelled.

Overseas production330 Meteors produced by N.V. Koninklijke Nedelandse Vliegtuigenfabriek Fokker, Schiphol, Netherlands from 1951 to 1954 as follows: 300 F Mk 8 and 30 sets of components supplied to Avions Fairey, Belgium for assembly (Gloster also supplied a further 37 aircraft in component form). Of the original 300 F Mk 8s, 155 wen to the Royal Netherlands Air France and 145 to the Royal Belgian Air Force

All 208 Meteor F Mk 3s (EE230 to EE493) produced were built at Glosters, Hucclecote factory. The Meteor’s brute strength was helped by the centre wing section and engine mountings all being built as one section. Aeroplane

All 677 Meteor T Mk 7s were Gloster-built at Hucclecote. This view of the factory floor represents at least 30 examples. Aeroplane

114

Serial prefix range: VZ (73), WA (133), WE (72), WF (53) and WK/WL (263). 94 to Australia; 60 to Brazil; 20 to Denmark; eleven to Israel; twelve to Syria and four to Egypt. G-AMCJ/G-7-1.Total production:- 1502 (702 built by Gloster, 470 by Armstrong Whitworth and 330 by Fokker).

FR Mk 9 13 aircraft ordered under Contract 6/ACFT/1389 in serial range VW360 to VW371, delivered between July 1950 and February 1951.

35 aircraft ordered under Contract 6/ACFT/2430 in serial range VZ577 to VZ611, delivered between November 1950 and April 1951.

24 aircraft ordered under Contract 6/ACFT/2983 in

serial range WB113 to WB143, delivered between April 1951 and January 1952 by Glosters, Hucclecote. 25 aircraft ordered under Contract 6/ACFT/5621 in serial range WH533 to WH557, delivered between January and March 1952.

11 aircraft ordered under Contract 6/ACFT/6066 in serial range WL255 to WL265, delivered between March and May 1952 by Glosters, Moreton Valance.

20 aircraft ordered under Contract 6/ACFT/7252 in serial range WX962 to WZ151, delivered between May and August 1952. WX982 to WX994 and WZ105 to WZ151 all cancelled.

Serial prefix range: VW (12), VZ (35), WB (23), WH (25), WL (11) and WX (20). Twelve ex-RAF to Ecuador; seven ex-RAF to Israel; two to Syria. Total production:- 126

PR Mk 10 Four aircraft ordered under Contract 6/ACFT/1389 in serial range VW376 to VW379 and delivered between January and April 1951.

One aircraft, VZ620 ordered under Contract 6/ACFT/2430 and delivered in May 1951 by

Glosters, Hucclecote.29 aircraft ordered under Contract 6/ACFT/2983 in the

serial range WB153 to WB181 and delivered between March and August 1951 by Glosters, Hucclecote.

Five aircraft ordered under Contract 6/ACFT/5621 in the serial range WH569 to WH573 and delivered between February and March 1952.

Serial prefix range: VS (20), VW (4), VZ (1), WB (29) and WH (5). Total production:- 59

NF Mk 11 Two prototypes, WA546 and WA547 ordered under Contract 6/ACFT/13090 for the Ministry of Supply and built by Armstrong Whitworth, Bitteswell.

One aircraft, WB543 ordered as production prototype, for the Ministry of Supply in June 1952.

200 aircraft, ordered under contract No.6/Acft/3437/CB.5(b) May 31, 1949, in the serial range WD585 to WD800 and delivered between November 18, 1950 to July 14, 1952 by Armstrong Whitworth, Bitteswell.

116 aircraft, ordered under contract No.6/Acft/6141/CB.7(b) December 22, 1950, in the serial range WM143 to

The first of many Meteors received by the Royal Netherlands Air Force was a batch of 34 F Mk 4s registered as I-21 to I-54. I-21, pictured being completed at Hucclecote, was one of the new-build Meteors. It was followed by a second batch of 30 ex-RAF F Mk 4s. Aeroplane

Meteor F Mk 8s being licence-built in Belgium by Avions Fairey. EG-226 is in the foreground. It was taken on charge by the BAF in 1952 and served with 349 Squadron at Beauvechain until it was SOC in 1963. To the right and behind is EG-225, which also served with 349 Squadron and was also SOC in 1963, by which time, it had accumulated a respectable (for a Meteor), 952hrs and 40 minutes of flying time. Aeroplane

METEOR | 115

WM307 and delivered between July 11, 1952 and March 1953 by Armstrong Whitworth, Bitteswell, (except WM261 completed as NF Mk 14 prototype).

36 aircraft ordered for export and Ministry of Supply in the serial range, WM368 to WM403. (WM375 to WM383 to France direct and WM384 to WM403 to Denmark direct as No.501 to 520).

Serial prefix range: WA (2), WB (1), WD (200) and WM (152). 41 aircraft to France; One to Australia; 24 ex-RAF aircraft to Belgium; 20 to Denmark.Total production:- 355

NF Mk 12 100 aircraft ordered under contract No.6/

Acft/6412/CB.7(b) February 28, 1951, in the serial ranges WS590 to WS639, WS658 to WS700 and WS715 to WS721, delivered between May 6 and October 14, 1953 by Armstrong Whitworth, Bitteswell.

Serial prefix range: WS (100). Total production:- 100

NF Mk 13 40 aircraft ordered under contract No.6/Acft/6141/CB.7(b) December 22, 1950, in the serial ranges WM308 to WM341 and WM362 to WM367, delivered between January 30 and March 20, 1953 by Armstrong Whitworth, Bitteswell.

Serial prefix range: WM (40). Six ex-RAF to Egypt; six to the Israeli Defence Force; six to Syria; two ex-RAF to France Total production:- 40

NF Mk 14 100 aircraft ordered under contract No.6/Acft/6412/CB.7(b) February 28, 1951, in the serial ranges WS722 to WS760, WS774 to WS812 and WS827 to WS848, delivered between November 6, 1953 and September 4, 1954 by Armstrong Whitworth, Bitteswell.

Serial prefix range: WS (100). Two ex-RAF to France. Total production:- 100

TT Mk 20 50 conversions were carried out by Armstrong Whitworth or the Royal Navy Air Yard ay Sydenham, Belfast.

Serial prefix range: WD (26), WM (19) and RDAF 504, 508, 512, 517, 518 and 519. Six to France; four ex-RDAF to Svensk Flygtänst, Sweden.

Total Meteor Production from 1943 to 1954 by all manufactures:- 3881 ✤

Produced virtually from the same jig, the forward fuselages of all marks of Meteor a hardly differed, and the T Mk 7 forward fuselage pictured here, still retained the apertures for the 20mm cannon, which was never carried on the trainer, but were merely panelled over instead. This view also shows the way the sturdy nose wheel undercarriage is mounted to the armoured forward bulkhead. Aeroplane

Belgium ordered 48 new-build F Mk 4s from the Gloster Aircraft Co. in 1947 in the

serial range EF-1 to EF-48. This photo, taken in April 1949, shows the first aircraft

being prepared for delivery to Belgium. Aeroplane

116

Pushed and pulled in all directions, the original F.9/40 only held a passing resemblance to the later NF Mk 14. This evolutionary period covered a decade and by the time the final drone variants had been completed in the early 1970s, the Meteor could boast 26 different versions.

Mark by mark

Gloster F.9/40 ‘Meteor’PowerPlant: (DG202/G) 2 x Rover W.2B; (DG203/G) 2 x Power Jets W2/500; (DG204/G) 2 x Metrovik F.2; (DG205/G & DG208/G) 2 x Rover W.2B/23; (DG206/G & DG207/G) 2 x Halford H.1; (DG209/G) 2 x Rover W.2B/27. Fuel/oil: Fuel, 300 gal in all F.9/40s except DG204/G which carried 330 gal; Oil, 3 gal.Dimensions: Span, 43ft, (DG206/G & DG207/G) 44ft 3in; Length, 41ft 3in, (DG206/G & DG207/G) 41ft 5in; Height 13ft 0in, (DG204/G) 13ft 8in; Wing Area, 374 sq ft; Track 10ft 5in.weights: Empty, 9,654lb (DG202/G, DG203/G, DG205/G,

Meteor F Mk 1PowerPlant: 2 x 1,600lb Rolls-Royce W.2B/23C Welland I turbojets.Fuel: 300 galDimensions: Span, 43ft 0in; Length, 41ft 5in; Height 13ft 0in; Wing Area, 374 sq ft.weights: Empty, 8,140lb; Loaded (clean), 13,795lb.Performance: Max speed (clean), 415 mph at 10,000ft; Climb rate to 30,000ft, 15 min; Service ceiling, 40,000ft.Armament: Four 20mm Hispano cannon mounted in the front fuselage sides with 780 rounds of ammunition.

Meteor F Mk 1, trent turboprop

PowerPlant: 2 x Rolls-Royce RB.50 Trent

propeller-driven turbines fitted with 7ft 11in diameter

Rotol five-blade propellers.ProDuction:

Single aircraft, EE227, the 18th production Meteor F Mk 1.

DG208/G & DG209/G); 9,996lb (DG204/G); 9,885lb (DG206/G & DG207/G); Loaded, 11,775lb (DG202/G, DG203/G, DG205/G, DG208/G & DG209/G); 13,081lb (DG204/G); 13,300lb (DG206/G & DG207/G).PerFormance: (DG202/G, DG203/G, DG205/G, DG208/G & DG209/G) Max speed at 30,000ft, 420 mph; Max speed at sea level, 385 mph; Climb rate to 30,000ft, 17min; Service ceiling, 37,000ft; Absolute ceiling, 42,000ft.armament: Four 20mm Hispano cannon in the front fuselage with 600 rounds of ammunition.

rover W.2b-powered F.9/40 Meteor DG205/G which was first flown from barford st John by Michael Daunt on June 12, 1943. Daunt described the aircraft’s performance as ‘unimpressive’. Andy Hay/www.flyingart.co.uk

ee212/G, the third production Meteor F Mk 1, which took part in extensive flight trials with the A&Aee at boscombe Down from september to December 1944. Via Martyn Chorlton

trent turboprop Meteor F Mk I ee227, the world’s first propeller-turbine aircraft. Via Martyn Chorlton

METEOR | 117

METEOR F MK 2 POWERPLANT: 2 x 2,000lb de Havilland H.1DIMENSIONS: Span, 44ft 3in; Length, 41ft 5in; Height 13ft; Wing Area, 374 sq ft.WEIGHTS: Gross, 13,750lb.PERFORMANCE: Max speed, 505 mph at 30,000ft; Ceiling, 49,000ft.

METEOR F MK 3 & PR MK 3POWERPLANT: 2 x 2,000lb Rolls-Royce W.2B/23C Welland or 2,400lb Derwent.

FUEL: 325 gal.DIMENSIONS:

Span, 43ft; Length, 41ft 3in; Height 13ft; Wing Area, 374 sq ft.

WEIGHTS: Empty 10,519lb; Loaded (clean), 13,920lb.

PERFORMANCE: Max speed (clean) at 10,000ft, 415 mph; Climb rate to

30,000ft (clean), 15min; Service ceiling, 40,000ft.

ARMAMENT: Four 20mm Hispano cannon mounted in the front fuselage sides with 780 rounds of ammunition.

METEOR F MK 4 (INCLUDING SHORT SPAN)POWERPLANT: 2 x 3,500lb Rolls-Royce Derwent V.FUEL: 325 gal.DIMENSIONS: Span, 43ft, (Short Span) 37ft 2½in; Length, 41ft; Height 13ft; Wing Area, 374 sq ft, (Short Span) 350 sq ft.WEIGHTS: Empty 10,529lb, (Short span) 15,175lb; Loaded (clean) 14,460lb, (Short span) 14,545lb.PERFORMANCE: Max speed (clean), 575 mph at 10,000ft, (Short Span) 580 mph at 10,000ft; Climb rate to 30,000ft (clean), 6 min; Service ceiling, 52,000ft, (Short Span) 44,500ft.ARMAMENT: Four 20mm Hispano cannon mounted in the front fuselage sides with 780 rounds of ammunition.

The one and only Meteor F Mk 2 was DG207/G, � tted with the H.1 engines and a

modi� ed windscreen and canopy which would be introduced with the F Mk 3.

Via Martyn Chorlton

‘Navalised’ Meteor F Mk 3 EE337 during deck landing trials onboard HMS Implacable. Via Martyn Chorlton

Meteor F Mk 4s of 600 (City of London) Squadron operating out of Biggin Hill in 1952. Aeroplane

118

Meteor t Mk 7 (IncludIng t Mk 7/F Mk 8 hybrIds)PowerPlant: 2 x 3,500lb Rolls-Royce Derwent 8. (To check xxxx xx )Fuel: 325 gal.Dimensions: Span, 37ft 2in; Length, 43ft 6in; Height 13ft; Wing Area, 350 sq ft.weights: Empty 10,645lb; Loaded (clean) 14,230lb.PerFormance: Max Speed (clean), 590 mph at 10,000ft; Climb rate to 30,000ft (clean), 5.6 min; Service ceiling, 45,000ft.

Meteor F Mk 8 Prone PIlotTechnical information as per standard F Mk 8 except aircraft length, which was 51ft 5in. One aircraft, WK935 converted.

Meteor F Mk 8PowerPlant: 2 x 3,500lb Rolls-Royce Derwent 8.

Fuel: 420 galDimensions: Span, 37ft 2in; Length, 44ft 7in; Height

13ft 0in; Wing Area, 350ft2weights: Empty, 10,684lb; Loaded (clean), 15,700lb.

PerFormance: Max speed, 598 mph at 10,000ft; Climb rate to 30,000 ft (clean), 6.5 min;

Service ceiling, 43,000ft.armament: Four 20mm Hispano cannon mounted in

the front fuselage sides with 780 rounds of ammunition. Provision for single or double tier

underwing RP racks.

built from a batch of 70 t Mk 7s under contract 6/AcFt/1389, VW411 only served with the rAe, the A&Aee and bleu at Martlesham heath. It was during the trials with the latter unit that the nose was modified to carry a forward facing camera. VW411 was also one of several t Mk 7s to be fitted with a F Mk 8 tail unit, which marginally improved performance. Andy Hay/www.flyingart.co.uk

Meteor F Mk 8, Wl181, Wl190 and Wh301 of the rAFFc operating out of cranwell. Wh301 is the

only one of the three that still exists. the Meteor was donated to the rAF Museum in February

1967 and remains there to this day. Aeroplane

Another survivor is the Prone Pilot converted Meteor F Mk 8 Wk935 which was allocated for preservation in early

1965 and resides today at the rAF Museum, cosford. Via Martin Chorlton

Meteor Fr Mk 5 (Vt347)Technical information as per F Mk 4; one aircraft only.

Meteor F Mk 6Proposed swept-wing variant of the F Mk 4; not built.

METEOR | 119

METEOR FR MK 9POWERPLANT: 2 x 3,500lb

Rolls-Royce Derwent 8.FUEL: Internal 420 gal; Ventral,

1 75 gal; Wing tanks, 100 gal each.

DIMENSIONS: Span, 37ft 2in; Length, 44ft 7in;

Height 13ft; Wing Area, 350 sq ft.WEIGHTS: Empty, 10,790lb; Loaded

(clean), 15,770lb; Loaded (ventral and wing tanks), 19,135lb.

PERFORMANCE: Max speed (ventral and wing tanks) at 10,000ft,

396 mph; Climb rate to 30,000ft (clean), 6.5 min; Service ceiling

(clean), 44,000ft; Service ceiling (ventral and wing tanks), 41,000ft.

ARMAMENT: Four 20mm Hispano cannon mounted in the front fuselage sides with 780 rounds of ammunition.

Provision for single or double tier underwing RP racks.

METEOR PR MK 10POWERPLANT: 2 x 3,500lb Rolls-Royce Derwent 8.FUEL: Internal 420 gal; Ventral, 175 gal; Wing tanks, 100 gal each.DIMENSIONS: Span, 43ft 0in; Length, 44ft 3in; Height 13ft; Wing Area, 374 sq ft.WEIGHTS: Empty, 10,993lb; Loaded (clean), 15,400lb; Loaded (ventral and wing tanks), 18,765lb.PERFORMANCE: Max speed (ventral and wing tanks) at 10,000ft, 576 mph; Climb rate to 30,000ft (clean), 6.2 min; Service ceiling (clean), 47,000ft; Service ceiling (ventral and wing tanks), 44,000ft.

METEOR NF MK 11POWERPLANT: 2 x 3,700lb

Rolls-Royce Derwent 8.FUEL: Internal, 325 gal; Ventral, 175

gal; Wing tanks, 100 gal each. DIMENSIONS: Span, 43ft; Length,

48ft 6in; Height 13ft 11in; Wing Area, 374 sq ft.

WEIGHTS: Empty, 12,019lb; Loaded (clean), 16,542lb; Loaded

(ventral and wing tanks), 20,035lb.PERFORMANCE: Max speed

(ventral and wing tanks) at 10,000ft, 554 mph; Climb rate to 30,000ft

(ventral and wing tanks), 11.2 min; Service ceiling (ventral and

wing tanks), 40,000ft.ARMAMENT: Four 20mm Hispano

Mk V cannon mounted in the outer mainplanes with 640 rounds

of ammunition.

FR Mk 9 VZ605 pictured at Moreton Valance prior to delivery to 2 Squadron at Bückenburg. The unit operated the FR Mk 9 from December 1950 to June 1956. VZ605 spent its entire, faultless

� ying career with the West Germany-based squadron. Aeroplane

PR Mk 10 VW376 pictured following its delivery to 541 Squadron at Benson. The aircraft only served with 541 Squadron, which moved to West Germany in June 1951 and remained there until it was disbanded in September 7, 1957. VW376 was SOC three days later. Via Martyn Chorlton

Originally built as the fourth production T Mk 7, VW413 was converted by Armstrong Whitworth at Bitteswell to become the prototype NF Mk 11. Via Martyn Chorlton

120

METEOR NF MK 12POWERPLANT: 2 x 3,800lb Rolls-Royce Derwent 9.FUEL: Internal, 325 gal; Ventral, 175 gal; Wing tanks, 100 gal each. DIMENSIONS: Span, 43ft; Length, 49ft 11in; Height 13ft 11in; Wing Area, 374 sq ft.WEIGHTS: Empty, 12,292lb; Loaded (clean), 17,223lb; Loaded (ventral and wing tanks), 20,380lb.PERFORMANCE: Max speed (ventral and wing tanks) at 10,000ft, 554 mph; Climb rate to 30,000ft (ventral and wing tanks), 12 min; Service ceiling (ventral and wing tanks), 40,000ft.ARMAMENT: Four 20mm Hispano Mk V cannon mounted in the outer mainplanes with 640 rounds of ammunition.

METEOR NF MK 13POWERPLANT: 2 x 3,800lb

Rolls-Royce Derwent 9. (check engines)

FUEL: Internal, 325 gal; Ventral, 175 gal; Wing tanks, 100 gal each.

DIMENSIONS: Span, 43ft; Length, 48ft 6in; Height 13ft 11in;

Wing Area, 374 sq ft.WEIGHTS: Empty, 12,347lb; Loaded

(clean), 17,333lb; Loaded (ventral and wing tanks), 20,485lb.

PERFORMANCE: Max speed (ventral and wing tanks) at 10,000ft, 576

mph; Climb rate to 30,000ft (ventral and wing tanks), 14 min; Service ceiling (ventral and wing tanks),

36,000ft.ARMAMENT: Four 20mm Hispano

Mk V cannon mounted in the outer mainplanes with 640 rounds

of ammunition.

METEOR NF MK 14 & NF (TT) MK 14POWERPLANT: 2 x 3,800lb Rolls-Royce Derwent 9FUEL: Internal, 325 gal; Ventral, 175 gal; Wing tanks, 100 gal each. DIMENSIONS: Span, 43ft; Length, 51ft 4in; Height 13ft 11in; Wing Area, 374 sq ft.WEIGHTS: Empty, 12,620lb; Loaded (clean), 17,287lb; Loaded (ventral and wing tanks), 21,200lb.PERFORMANCE: Max speed (ventral and wing tanks) at 10,000ft, 578 mph; Climb rate to 30,000ft (ventral and wing tanks), 13.2 min; Service ceiling (ventral and wing tanks), 40,000ft.ARMAMENT: Four 20mm Hispano Mk V cannon mounted in the outer mainplanes with 640 rounds of ammunition.PRODUCTION: 100 aircraft built between 1954 and 1955 by Armstrong Whitworth at Bitteswell.

25 Squadron NF Mk 12 three-ship, made up of WS622, WS697 and WS694 pictured on May 26, 1954. Only WS694 was lost in service when, on April 16, 1956, an engine failed after take-off and the jet crashed near to West Malling. Pilot, Fg Off J C Langham and navigator, Fg Off R A Hollingsworth were both killed. Via author

Yet another busy Meteor was NF Mk 14 WS838 which served with AWOCU, 64 Squadron, RRE,

A&AEE and the RAE (in the yellow scheme shown) before being retired to Colerne for

preservation on February 9, 1972. Andy Hay/www.fl yingart.co.uk

No.1428 was one of six Meteor NF Mk 13s supplied to the Egyptian Air Force.

Via Martyn Chorlton

METEOR | 121

METEOR U MK 16 (LATER D MK 16)Target drone conversion of surplus F Mk 8, 108 modifi ed by Flight Refuelling Ltd at Tarrant Rushton.

METEOR TT MK 20The TT Mk 20 was a high speed target towing conversion of the NF Mk 11, for the Royal Navy, RAF and several MoD establishments. 20 ex-NF Mk 11s were converted by Armstrong Whitworth at Bitteswell and a further four RDAF NF Mk 11s were also converted ad fl own by civilians for the Danish air force.

‘REAPER’, GROUND ATTACK FIGHTERA Gloster private venture, the ‘Reaper’ was a modifi ed F Mk 8 for the ground attack role. One aircraft, G-7-1 was

converted to carry RPs, an external cannon, tip tanks and external RATOG (Rocket-Assisted Take-Off Gear).

METEOR U MK 15Target drone conversion of the F Mk 4, 90 modifi ed by Flight Refuelling Ltd at their Tarrant Rushton works under contracts 6/ACFT/9725 and 6/ACFT/10925. The fi rst aircraft, RA421 made its maiden fl ight on March 11, 1955.

Ex-F Mk 8 WH453 as it appeared as a U.16 drone from 1972, serving at RAE West Freugh and Llanbedr where

it was retired in 1990. Today the Meteor is being restored back to its original F Mk 8 con� guration at

the Bentwaters Cold War Museum in Suffolk. Andy Hay/www.fl yingart.co.uk

The private-venture ground-attack ‘Reaper’ G-7-1, which was modi� ed from F Mk 8 G-AMCJ. It was � rst � own on August 9, 1951

and, after trials in late 1952 with the A&AEE, was converted into T Mk 7 G-ANSO. Flight via Martyn Chorlton

First delivered to 151 Squadron as an NF Mk 11, service followed with 5 Squadron before the Meteor

was converted into a TT Mk 20. It then served with 3-4 CAACU until it was SOC on September 15, 1975

at 5 MU, Kemble. Andy Hay/www.fl yingart.co.uk

METEOR U MK 21 AND U MK 21AThis variant was a target drone conversion of the RAAFs F Mk 8s, carried out by Flight Refuelling Ltd in Britain and Fairey Aviation in Australia.

122

A trio of Meteor NF Mk 14s of 85 Squadron keep it tight for the camera in 1955 during a sortie from West Malling. The unit operated the NF Mk 14 from April 1954 until November 1958 when it was disbanded at Church Fenton on November 30, 1958. Both WS740 and WS741 served with 85 Squadron, while WS723 went on to 153 Squadron, 25 Squadron and � nally 228 OCU. All three had been SOC by late 1961 and early 1962. Via Martyn Chorlton

METEOR | 123

124

Meteor in serviceSquadrons, second line/training units, military

establishments and civilian establishments where the Meteor served (however brief) from August 1944 through

to the present day, compiled by Martyn Chorlton.

85 Squadron had been a night- ghter unit from 1941 and the arrival of the

Meteor NF Mk 14 in April 1954 was to be the last of a long line of dedicated types.

After service with 85 Squadron, WS744 was converted to a NF (T) Mk 14, later serving with 1 and 2 ANS. Aeroplane

METEOR | 125

ROyal aiR FORcEF Mk 1616, 1335 CU, A&AEE, NGTE, Power Jets

F Mk 31, 56, 63, 66, 74, 91, 92, 124, 222, 234, 245, 257, 263, 266, 500, 504, 541, 616, 1335 CU, A&AEE, CFE, CFS, CGS, DFLS, ECFS, EFS, Eastern Sector Flt, Metropolitan Sector HQ, NGTE, Station Flt Tangmere

PR Mk 3PRDU

F Mk 41, 19, 41, 43, 56, 63, 64, 65, 66, 74, 91, 92, 222, 245, 257, 263, 266, 500, 504, 600, 609, 610,

611, 615, 616, 8 FTS, 12 FTS, 203 AFS, 205 AFS, 207 AFS, 209 AFS, 215 AFS, 226 OCU, A&AEE, APS Acklington, CFE, CGS, DFLS, ETPS, FCCS, High Speed Flt, Jet Conversion Flt, NGTE, RAF Flying College, TFU, Yorkshire Sector Flt

T Mk 71, 2, 3, 4, 5, 6, 8, 11, 13, 14, 16, 19, 25, 26, 28, 29, 32, 33, 34, 39, 41, 43, 46, 54, 56, 60, 63, 64, 65, 66, 67, 68, 71, 72, 73, 74, 79, 81, 85, 87, 89, 92, 93, 94, 96, 98, 112, 118, 141, 145, 151, 152, 185, 208, 213, 219, 222, 245, 247, 249, 256, 257, 263, 264, 500, 501, 502, 504, 541, 600, 601, 602, 603, 604, 605, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 1 GWDS, 1 OFU, 1 TWU, 2 TAF Coms Flt, 3/4 CAACU, 3 Gp CF, 4 FTS, 5 CAACU, 5 FTS, 8 FTS, 12 Gp CF, 13 Gp CF, 23 Gp CF, 25 Gp CF, 41 Gp CF, 81 Gp CF, 83 Gp CF, 101

FRS, 102 FRS, 103 FRS, 202 AFS, 203 AFS, 205 AFS, 205 Gp CF, 206 AFS, 207 AFS, 209 AFS, 210 AFS, 211 AFS, 215 AFS, 226 OCU, 228 OCU, 229 OCU, 231 OCU, 237 OCU, 1689 Flt, A&AEE, APS Acklington, APS Sylt, Bomber Command CF/CS, CFE, CFS (inc. ‘Vintage Pair’), CGS, EAAS, ETPS, FEAFES, FCCS, FWS, Handling Sqn, HQ Middle East Air Force Com Flt/Sqn, ITF Nicosia, ITF Shallufa, JCU Marham, Levant CF, Malta C&TT Sqn, Martin-Baker, MEAF CF, Middle East Air Force TTF/Flt, RAE, RAF Flying College, Station Flts:- Abu Sueri, Ahlhorn, Benson, Church Fenton, Coltishall, Coningsby, Duxford, Geilenkirchen, Gütersloh, Hemswell, Khormaksar, Laarbrüch, Leuchars, Linton-on-Ouse, Nicosia, Odiham, Oldenburg, Scampton, Stradishall, Thorney Island, Upwood, Wahn, Wattisham, West Raynham, Wittering and Wunstorf, TFU

F Mk 81, 19, 29, 34, 41, 43, 54, 56, 63, 64, 65, 66, 72, 74, 92, 111, 222, 245, 247, 257, 263, 500, 504, 600, 601, 604, 609, 610, 611, 615, 616, 1 TWU, 5 CAACU, 12 Gp CF, 12 MU, 13 Gp CF, 211 AFS, 226 OCU, 229 OCU, 233 OCU, 1574 Flt, A&AEE, APS Acklington, APS Sylt, Caledonian Sector Flt, CFE, DFLS, FCCS, FWS, Handling Sqn, Metropolitan Sector Flt, Northern Sector Flt, RAF Flying College, Southern Sector Flt, TFU, THUM Flt, Western Sector Flt

F(TT) Mk 81, 85, 613 Middle East Air Force TTF/Flt

FR Mk 92, 8, 79, 187, 208, A&AEE, Aden FR Flt, CFE

Pilots of 500 (county of Kent) Squadron at West Malling, in 1949, with their Meteor F

Mk 3s in the background. The unit only operated the mark from July 1948 to

October 1951. Aeroplane

a large number of auxiliary air force units operated the Meteor F Mk 4 including 600 (city of london) Squadron, which flew the mark from March 1950 to april 1952. Aeroplane

One of the five Meteors still flying today is T Mk 7/F Mk 8 hybrid Wa638, which has been serving Martin-Baker at chalgrove since 1962. Andy Hay/www.flyingart.co.uk

126126

PR Mk 102, 13, 81, 541, 231 OCU, 237 OCU, A&AEE

NF Mk 1111, 29, 68, 85, 87, 96, 125, 141, 151, 219, 256, 264, 527, 228 OCU, A&AEE, CFE, CSE, ETPS, Ferranti, RAE, RRE, TFU, TRE

NF Mk 1225, 29, 46, 64, 72, 85, 152, 153, 264, 228 OCU, 238 OCU (238 AWOCU), A&AEE, CFE, CSE, FWS

NF Mk 1339, 219, A&AEE

NF Mk 1425, 33, 46, 60, 64, 72, 85, 152, 153, 264, 527, 1 ANS, 2 ANS, 13 Gp CF, 228 OCU, 238 OCU (238 AWOCU), A&AEE, CFE, ETPS, FCCS, Handling Sqn

TT Mk 203/4 CAACU, 5 CAACU, 1574 Flt, A&AEE, TTF Seletar

U Mk 15Hal Far, JSTU, RAE, RAE Llanbedr

U Mk 16JSTU, RAE, RAE Llanbedr

Fleet Air ArmF Mk 3703, 778

T Mk 7700Z, 702, 703, 728, 736, 759, 767, 771, 781, 806, 813, FRU

Fr mk 9 VW363 of 208 Squadron, the aircraft’s only unit, with which it served from late 1950 through to mid-1959. Via Martyn Chorlton

Pr mk 10 VS979, which only served with 541 Squadron in West Germany and was SOC three days after the unit disbanded on September 10, 1957. Via Martyn Chorlton

74 Squadron pilots pose in front of the new F mk 8s which began to arrive at Horsham St Faith in October 1950 and remained until march 1957 when they were replaced with Hunters. Behind is VZ558, which inexplicably crashed on the night of December 7, 1950 near Horsham St Faith, killing Fg Off W A Slater. Aeroplane

F(tt) mk 8 of 1 Squadron, one of 30 that were converted to target tugs. the modification entailed fitting a target towing lug under the

fuselage. Via Martyn Chorlton

METEOR | 127METEOR | 127

TT Mk 20700, 728, FRU

U Mk 15728B

U Mk 16728B

FOREign AiR FORcEsArgenTinAR4Caz F Mk 4 47 to late 70s(later Grupos 2 de Caza) R6Caz F Mk 4 47 to late 70s(later Grupos 3 de Caza)

AUsTrAliA (inclUding ciTizens Air Force)22 Sqn (CAF) F Mk 8

23 Sqn (CAF) F Mk 875 Sqn F Mk 8 From 5277 Sqn F Mk 8 From 51ATU U Mk 15 1 ATU U Mk 15 2 ATU U Mk 15WRE Woomera U Mk 16 & U Mk 21

BelgiUM4 Sqn (Beauvechain ‘SV’) F Mk 87 Sqn (Chievres ‘7J’) F Mk 88 Sqn (Chievres ‘OV’) F Mk 89 Sqn (Chievres ‘S2’) F Mk 810 Sqn (Beauvechain ‘KT’) NF Mk 1111 Sqn (Beauvechain ‘ND’) NF Mk 1122 Sqn (Bierset ‘IS’) F Mk 824 Sqn (Sylt ‘XO’) F Mk 825 Sqn (Brustem ‘VT’) F Mk 826 Sqn (Bierset ‘JE’) F Mk 8

29 Sqn (Brustem ‘MS’) F Mk 833 Sqn (Brustem ‘K5’) F Mk 8349 Sqn (Beauvechain ‘GE’) F Mk 8350 Sqn (Beauvechain ‘MN’) F Mk 8TTF (ex 24 Sqn at Sylt ‘B2’) F Mk 8

BrAzilGAVCA 1°/1° F-8 & TF-7 53 to 66GAVCA 1°/14° F-8 & TF-7 53 to 66GAVCA 2°/1° F-8 & TF-7 53 to 66

cAnAdA421 sqn (rcAF)Aircraft T Mk 7Winter Experimental Establishment F Mk 4During 48

denMArk (Air Force & nAvy)3rd Air Flotilla (Karup) F Mk 4 49 to 50

723 Sqn (ex 3 AF, Karup) F Mk 4 50 to 52 NF Mk 11 From Nov 52 724 Sqn (Karup) F Mk 4 50 to 51 F Mk 8 From 51 OTU & Flying School F Mk 4 From 51 T Mk 7 From 51

ecUAdorEscuadrón de FR Mk 9 54 to late 70sCombate 2111 (Taura)

egypTF Mk 4 48 to 58T Mk 7 48 to 58NF Mk 13 55 to 58

FrAnceEC.30 (Tours) T Mk 7 50 to 57 NF Mk 11 53 to 57

nF Mk 11 WD790 never served with an operational squadron but did carry out valuable work with the TRE, Ferranti, the RRE and finally the RAE, when it gained its ‘raspberry ripple’ colour scheme. The

unique nose was used for radar trials for the TsR.2. Andy Hay/www.flyingart.co.uk

Meteor nF Mk 12 Ws719 of 25 squadron, which reformed at Waterbeach on July 2, 1958 with the nF Mk 12. Via Martyn Chorlton

Only two RAF squadrons operated the nF Mk 13, including

39 squadron. These four pilots are pictured at Kabrit on April 6, 1954.

39 Squadron Records Via Martyn Chorlton

One of eleven operational RAF squadrons to fly the Meteor nF Mk 14 was 264 squadron at Linton-on-Ouse, Middleton st george and finally Leeming. Aeroplane

F Mk 3 EE337 which briefly served with 778 squadron; a handful also served with 703 squadron. Andy Hay/www.flyingart.co.uk

128128

322 Sqn (Soesterberg ‘3W’) F Mk 4 From 48 F Mk 8 To 56323 Sqn (Leeuwarden ‘Y9’) F Mk 4 From 48 F Mk 8 To 56324 Sqn (Leeuwarden ‘3P’) F Mk 4325 Sqn (Leeuwarden ‘4R’) F Mk 4 F Mk 8 To 56326 Sqn (Leeuwarden ‘9I’) F Mk 4 From 48 F Mk 8 To 56327 Sqn (Soesterberg ‘7E’) F Mk 4 From 48 F Mk 8 To 56328 Sqn (Soesterberg ‘8S’) F Mk 4 F Mk 8 To 56

New ZealaNdJet Propulsion Unit (Ohakea) F Mk 3 46 to 47

South africaF Mk 3 During 49

SwedeNSvensk Flygtjänst AB T Mk 7 From 56 TT Mk 20

SyriaF Mk 8 52 to late 50sFR Mk 9 56 to late 50sNF Mk 13 56 to late 50s

CEV (Melun-Villaroche) NF Mk 11 From 53 T Mk 7 55 to 5 NF Mk 13 56 to late 60s NF Mk 14 55 to late 80s TT Mk 20 74 to late 80s CITT 346 (Merignac) NF Mk 11 From 57

iSrael (IDF/AF)117 Sqn IAF F Mk 8 From 53 117 Sqn IAF T Mk 7 From 53IAF FR Mk 9 From 55119 Sqn NF Mk 13 From 56

NetherlaNdSFighter School (Twenthe) F Mk 4 From 48 T Mk 7

Ex WD777, NF Mk 11 EN-3 was supplied to the Belgian Air Force on July 30, 1952. Via Martyn Chorlton

This long-serving T Mk 7 joined the FAA at Anthorn in May 1952, and continued to fly for the Royal Navy until 1971. The

aircraft remained with the senior service and today is on display at the FAA Museum at RNAS Yeovilton.

Andy Hay/www.flyingart.co.uk

Original built as an NF Mk 11, WD785 did not enter RAF service until September 1957 when it was delivered to 527 Squadron at Watton. The Meteor was then converted to a TT Mk 20 to serve with the FAA until it was SOC on July 20, 1970 at 5 MU, Kemble. Via Martyn Chorlton

‘A Meteor F Mk 4 Departs for Denmark’ – The first three of the 20 Meteor F Mk 4s ordered by the Danish Government were delivered from Moreton Valance on October 6, 1950. Aircraft were flown by Capt. E. Rasmussen (Navy), Lieut/Cdr. Brodersen (Navy) and Capt. T. Wickman (Army). Aeroplane

The Royal Netherlands Air Force initially ordered 34 brand new Meteor F Mk 4s (I-20 to I-54), followed by 27 ex-RAF machines (I-55 to I-80). The aircraft centre left, Y9-6 (I-48), served with 323 Squadron until it was written off on April 29, 1953. Aeroplane

METEOR | 129METEOR | 129

First delivered to the RAAF in January 1951, T Mk 7 A77-702 (ex WA732) served with 38 Squadron Communication Flight until 1963 when it was withdrawn from service. The Meteor is extant at the RAAF Museum, Point Cook, Victoria. Via Martyn Chorlton

Delivered to 264 Squadron at Linton-on-Ouse in late 1954 as WS747, this Meteor was transferred to the Armée de l’Air as

NF14-747 on August 28, 1955. The aircraft was heavily involved in radar, missile and ECM trials with the CEV until it

was retired in to Le Bourget museum in 1985. Andy Hay/www.flyingart.co.uk

Six ex-RAF Meteor NF Mk 13s were ordered by Israel in 1956, but because of the Suez war, three of these were embargoed until the conflict was over. All were assigned to 119 Squadron. Andy Hay/www.flyingart.co.uk

Between 1951 and 1958, the Syrian Air Force took delivery of 19 Meteor F Mk 8s, as

pictured, and two FR Mk 9s, six NF Mk 13s and possibly a pair of T Mk 7s as well.

Aeroplane

Meteor Units KeyKey

A&Aee Aeroplane&Armament ExperimentalEstablishmentAB AirBaseAFS AdvancedFlyingSchoolAPS ArmamentPracticeStationATU AirTrialsUnitAWOCU All-weatherOperational ConversionUnitC&TT Communication&Target

TowingCAACU CivilianAnti-aircraft

Co-operationUnitCAF CitizensAirForceCeV Centred’EssaisenVolCF ConversionFlightCFe CentralFighterEstablishmentCFS CentralFlyingSchoolCGS CentralGunnerySchoolComs CommunicationsCS CommunicationSquadronCU ConversionUnitDFLS DayFighterLeadersSchooleAAS EmpireAirArmamentSchooleCFS EmpireCentralFlyingSchooleFS EmpireFlyingSchooleTPS EmpireTestPilotsSchoolF FighterFCCS FighterCommand

CommunicationSquadronFeAFeS FarEastAirForce ExaminingSquadronFlt FlightFR FighterReconnaissanceFRS FlyingRefresherSchoolFRU FleetRequirementsUnitFTS FlyingTrainingSchoolGp GroupGWDS GuidedWeapons

DevelopmentSquadronHQ HeadquartersIAF IsraeliAirForceIDF IsraeliDefenceForceITF InstrumentTrainingFlightJCU JetConversionUnit(Bomber

Command)JSTU JointServicesTrialsUnitMeAF MiddleEastAirForceNF NightFighterNGTe NationalGasTurbine

EstablishmentOCU OperationalConversionUnitOFU OverseasFerryUnitOTU OperationalTrainingUnitPR PhotographicReconnaissancePRDU PhotographicReconnaissance

DevelopmentUnitRAe RoyalAircraftEstablishmentRCAF RoyalCanadianAirForceT TrainerTAF TacticalAirForceTFU TelecommunicationFlying

UnitTHUM Temperature&HumidityTT TargetTugTTF TargetTowingFlightTWU TacticalWeaponsUnitU Unmanned

130

SUBSCRIPTION OFFER Yes! I wish to subscribe to Aeroplane Monthly magazinePAYER’S DETAILS:

Name:

Address:

Postcode:

Tel. no:

E-mail:

DELIVERY ADDRESS (if different from payer):

Name:

Address:

Postcode:

Tel. no:

E-mail:

• NO LONG-TERM COMMITMENT –YOU ONLY SIGN UP FOR THREE ISSUES*

• JUST PAY £1 PER ISSUE – SAVE £9.75 OVER THE FIRST 3 MONTHS

• NEVER MISS AN ISSUE – DELIVERED FREE DIRECT TO YOUR DOOR

* PLEASE NOTE: Direct Debit, UK subscription offer only. You can cancel at any time in writing in the first three months and £3 will be your only commitment. If you do NOT cancel in that time, a regular quarterly payment will continue of £10.75 taken via direct debit from your bank every three months. This is equivalent to £2.93 per issue over a year (12 issues) – a saving of 31%

SUBSCRIBE AUGUST

2012

AUGUST

201212

AUGUST

2012

Heaven will fall for the

enemy – 56 Sqn in 1917

DATABASE 16PAGESOFDETAIL

BristolBrigand

Win!Win!

First air-to-airs

iiiiiiiiiiilllllllllllllllll ffffffff lllllllllllllllllll fffffff hhhhhhhh

BattleHonours

FallenFortresses

B-24 Diamond Lil’s Arctic crossing

AUGUST 2012 £4.25

B-17s lost in non-combatcircumstances

The Fighter Collection’s

newly-flown “razorback”

TheGathering ofMustangs&Legends book

andmerchandise

P-47G ThunderboltP-47G Thunderbolt

®

www.aeroplanemonthly.com

P-47G ThunderboltP-47G ThunderboltP-47G ThunderboltP-47G ThunderboltP-47G ThunderboltP-47G ThunderboltP-47G ThunderboltP-47G ThunderboltP-47G ThunderboltP-47G ThunderboltP-47G ThunderboltP-47G ThunderboltP-47G ThunderboltP-47G ThunderboltP-47G ThunderboltP-47G ThunderboltP-47G ThunderboltP-47G ThunderboltP-47G ThunderboltP-47G ThunderboltP-47G ThunderboltP-47G ThunderboltP-47G ThunderboltP-47G ThunderboltP-47G Thunderbolt

More than a century of Historyin the Air

First air-to-airs

FaFaFallllllenenenFoFoFortrtrtrtrerereresssssseseseseseses

B-B-B-24242424 DiDiDiamamamamonononondd LiLiLiLil’l’l’ssl’sl’l’sl’

B-B-171717B-17B-B-17B- ss17s17 loloststst ininin nononon-n-n-cococombmbmbatatcicircrcumumststanancecess

ThThThThTheeeeee FiFiFiFiFiFiFighghghghghghghteteteterrrr CoCoCollllllllllecececectititititionononon’s’s’s’s

nenenewlwlwlwlwlwly-y-y-y-y-y-wly-wlwly-wlwly-wl flflflflflflowowowowowownnnnnnnnownowownowownowownowownowownow “r“r“r“r“r“r“r“r“r“r“razoazoazoazoazoazoazoazoazoazoazoazoazoazoazoazoazorbrbrbrbrbrbrbacacacackkkk””3 £3ththe1917hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh

leleururururursssss

®

rr

JULY

2012

DATABASE 16PAGESOFDETAIL

JULY 2012 £4.25

®

Win!Win!Lufthansa’s early daysLufthansa’s early days

F-4s in actionover Vietnam

440 Squadron Typhoonsd h

Battle Honours

F i i

Phu CatPhantoms

FaireyAlbacore

•OurQueen’s AeronauticalHeritage• CoronationReviewof the RAF• Flying Start to the 1953 Royal Tour

•OurQueen’s AeronauticalHeritage• CoronationReviewof the RAF• Flying Start to the 1953 Royal Tour

Memorial Flight LancasterMemorial Flight Lancaster

www.aeroplanemonthly.com

Jubilee featuresJubilee features

Queen’sDiamond JubileeNumberQueen’sDiamond JubileeNumber

Leading thewayLeading theway

Signed Falklandsfirstday covers andYeoviltonAirDay tickets

Signed Falklandsfirstday covers andYeoviltonAirDay tickets

DATADATADA BASEPAPA

SEBrBrisistototolll BrBrig

SEigSEigSEigSEigSEigSEiganan

ososossisisingngng

AUAUGUSGUSTT 20

1616PAPAPAGEGEGEPAGEPAPAGEPAPAGEPA SSDEDETATA

anandd

2012

DATADATADA BASE 1616PAPAPAGEGEGEPAGEPAPAGEPAPAGEPA SSOFOFOFDEDETATAILIL

JUJULYLY 2012 £4.25F-F-4s in actionoveroverov Vietnam

440 Squaduaduadron Typhphphoonsd h

BaBaBaBattlttlttlttlttleeee HoHoHoHoHononononourururururursssss

i i

PhPhPhuuu CaCaCattPhPhananantotototomsmsms

FaFairireyeyAlAlAlbabababacocococorerere

•• CoCoCorororoCoroCo nanatitiononReReviviewewofof ththee RARARARARARARARAFF•• FlFlyiyingng StStarartt tototo thththee 19195353195319195319 RoyRoyRoyRoyRoyalalRoyalRoy ToTourur

•••••••••••••••••••••••••• CoCororoCoCoCororoCoroCororonanarororonanananananananananatitititititionontitiononononononReReReReReReReReReReviviviviviviReRe ewewviviewewewewewewofof ththththththththeeththth RARAeeRARARARARARAFFRARARARARARARACoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCoroCoCoroCororororororoCoroCoroCoroCoCoroCoroCoroCoCoroCoCoroCororororororoCoroCororororororoCoroCoroCoroCorororororororororororororororororororororororororororororororororoCoroCoCoroCoCoroCorororororororororoCoroCoroCoroCoCoroCoroCoroCoCoroCoroCoroCororororororororororororoCoCoCoroCoCoCoCoCoCoroCoCoCoCoCoCoroCoCoCoCoCoCoroCoCoCoCoCoCoroCoCoCo nanaronaroronaronananananananananananananaronaronananananananananananananananananananananananananananananananananananananananaronaroronaronananaronaroronaroronaronanananananananananananananananananatitititititititititititititititititititititititititititinatinanatinatititititititititinatinanatinatititititititititiontiontitiontionononononononontiontiononononononononononononononononononononononononononononononontiontitiontiononononontiontitiontiononononononononononononononononononReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReReviviviviviviviviviviviviviviviviviviviviviviviviviviReviReReviReviviviviviviviviviviviReviReReviReviviviviviviviviviewviewviviewviewewewewewewewewewewewviewviewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewviewviviewviewewewewewviewviviewviewewewewewewewewewewewewofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofof thththththththththththththththththththththththththththththththththththththththththththththththetheththetheeeeeeeeeeeeeeeeeeetheththetheeeeeetheththetheeeeeeeeeeeeRARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARARAFRAFRAFFFFFFFFFFFFFFFFFFRAFRARAFRAFFFFFF••••••••••••••••••••••••••••••• FlFlFlFlyiyiyiyiyiyiyingngyiyingngyiyi StStStStStStStStarStararararttarttarar totototototo ththeethththththththee 19195353535353535353 RoyRoyRoyalalalRoyalalRoyalRoyRoyalRoyalalalal ToToToToToToToToururToToururururFlFlFlFlFlFlFlFlFlFlFlFlFlFlFlFlFlFlFlFlFlFlFlFlFlFlFlFlFlFlFlFlFlFlFlFlFlyiyiyiyiyiyiyiyiyiyiFlyiFlyiFlyiFlFlyiFlyiFlyiFlyiyiyiyiyiyiyiyiyiyiyiyiyiyiyiFlyiFlyiFlyiFlyiyiyiyiyiyiyiyiyiyiyiyiyiyiFlyiFlFlyiFlyiyiyiyiyiyiFlyiFlyiFlyiFlFlyiFlyiFlyiFlFlyiFlyiFlyiFlyiyiyiyiyiyiyiyiyiyiyiyiyiyiFlyiFlyiFlyiFlFlyiFlyiFlyiFlFlyiFlyiFlyiFlFlyiFlFlyiFlyiFlyiFlFlyiFlyiFlyiFlyiyiyiyiyiyiyiyiyiyiyiFlyiFlFlyiFlyiyiyiyiyiyiyiyiyiFlyiFlyiFlyiFlFlyiFlyiFlyiFlFlyiFlyiFlyiFlFlyiFlyiFlyiFlyiyiyiyiyiyiyiyiyiyiyiyiyiyiyiyiyiyiFlyiFlFlyiFlFlFlFlyiFlFlFlFlFlFlyiFlFlFlFlFlFlyiFlFlFlFlFlFlyiFlFlFlFlyiFlFlFlyiFlyiFlyiFlFlFlyiFlFlyiFlFlFlyiFlyiFlyiFlFlFlyiFlFlyiFlFlFlyiFlyiFlyiFlFlFlyiFlFlyiFlFlFlyiFlyiFlyiFlFlFlyiFlFlFlFlyiFlFlFlFlyiFlFlyiFlFlFlFlyiFlFlFlFlFlFlyiFlFlFlyiFlyiyiyiFlyiyiFlyiyiyiFlyiFlyiFlFlFlyiFlyiFlyiFlFlFlyiFlFlyiFlFlFlyiFlyiFlyiFlFlFlyiFlFlyiFlFlFlyiFlyiFlyiFlFlFlyiFlFlyiFlFlFlyiFlyiFlyiFlFlFlyiFl ngyingyiyingyingngngngngngngngngngngngyingyingngngngngngngngngngngngngngngngyingyiyingyiyingyingngngngngngngngngngngngngngngngngngngngyingyiyingyiyingyingngngngngngngngngngngngyingyi StStStStStStStStStStStStStStStStStStStStStStStStStStStStStStStStStStStStStStStStStStStStStStStStStStStStStStStararStarStStarStarararararararararararStarStStarStStarStarararararararararararararararararararararararararStarStStarStararararararararararararStarStStarStarararStarStStarStarararStarStStarStStarStararararararararararararararararararStarStararararararararttttttttttttttttartarttttttttttttttartarartartttttttttttartarartarartarartarttttttttartarartar totototototototototototototototototototototototototototototototototototototototototototototototototototototototototototototototototototototototototoththththththththththththththththththththththththththththththththththththththththththththththththththththththththththththththththththththththththththththththetheththetheeeeeeeeeeeeeeeeeeetheththetheeeeetheththetheeeeeeeeeeee1919191919191919191919191919191919191919191919191919191919191919191919191919191919191919191919191919191919191919191919191919191919191919191919191919195319531919531953535353535353535353535319531953195319195319531953195353535353535353535319531953535353535353535319531953195319535353535353535353535353535353535353535353535353535319531919531953535319531953195319195319531953191953191953195353195319195319195319535353535353535353535353195319531953191953195319531919531953195319195319191919531919191919195319191919191953191919191919531919191919195319191919191953191919 RoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyRoyalRoyalRoyRoyalRoyRoyalRoyalalalalalalRoyalRoyalRoyalRoyRoyalRoyalRoyalRoyRoyalRoyRoyalRoyRoyalRoyalalalalalalalalalalalalalalRoyalRoyRoyalRoyalalalalalalRoyalRoyalRoyalRoyRoyalRoyalRoyalRoyalalalalalalalalalalalalRoyalRoyalalalalalalalalalalalRoyalRoyRoyalRoyRoyalRoyRoyalRoyalalalalalalalalalRoyalRoyalRoyalRoyRoyalRoyalRoyalRoyRoyalRoyalRoyalRoyalalalalalalalalalRoyalRoyRoyRoyRoyalRoyRoyRoyRoyRoyRoyalRoyRoyRoyRoyRoyRoyalRoyRoyRoyRoyRoyRoyalRoyRoyRoyRoyRoyRoyalRoyRoyRoyRoyRoyRoyalRoyRoyRoyRoyRoyRoyalRoyRoyRoyRoyRoyRoyalRoyRoyRoyRoyRoyRoyalRoyRoyRoy ToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToToururururururururururururururururururururururururururururururururururururururururururTourToTourTourururururururTourToururururururTourToTourTourururururur

www.aeroplanemonthly.com

••OuOuOuOurrQuQuQueeeeeen’n’n’n’n’een’ee ssn’sn’n’sn’ AeAeAerororoAeroAe nanaututicicalalHeHeHeHeHeririHeriHe tatagege•••••••••••••••••••••••••••••••OuOuOuOuOuOuOuOurrOuOuOuOurrQuQuOuOu QuQuQuQuQuQueeeeeeeeeeeen’n’een’een’n’n’n’ssssn’n’sn’sn’n’sn’ AeAeAeAeAeAeAeroroAeAeAeroroAeroAeroronanarororonanananananananananaututnaututututututututututicicututicicicicalalicicalalalalalalalic HeHeHeHeHeHeHeririririririHeHeHeririHeriHeriririritatatatatatatatagegetatataOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOuOurrrrOurOuOurOurrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrOurOuOurOuOurOurrrrrrrrrrrrrrrOurOu QuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQuQueeeeQueeQuQueeQueeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeQueeQuQueeQueeeeeeeeeeeeeeQueeQuQueeQueeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeen’een’eeeen’een’n’n’n’n’n’n’n’n’n’n’n’n’n’n’n’n’n’n’n’n’n’n’een’een’n’n’n’n’n’een’een’een’eeeen’eeeen’een’n’n’n’n’n’een’een’een’eeeen’een’een’een’n’n’n’n’n’n’een’eeeen’eeeen’eeeen’een’n’n’n’n’n’een’een’een’eeeen’een’een’een’n’n’n’n’n’n’n’n’n’n’n’n’n’n’n’n’een’eeeeeeeen’eeeeeeeeeeeen’eeeeeeeen’eeeeeeeen’eeeeeeeeeeeen’eeeeeeeeeeeen’eeeeeeeeeeeen’eeeeee sn’sn’n’sn’ssssssssssssssn’sn’sn’sn’n’sn’sn’sn’n’sn’sn’sn’n’sn’sn’sn’ssssssssssssn’sn’sn’sn’n’sn’sn’sn’ssssssssssssssn’sn’n’sn’ssssssssssssn’sn’sn’sn’n’sn’sn’sn’n’sn’sn’sn’n’sn’sn’sn’n’sn’sn’sn’n’sn’sn’sn’n’n’n’sn’n’n’n’n’n’sn’n’n’n’sn’n’n’sn’sn’sn’n’n’sn’n’n’n’sn’n’n’n’n’n’sn’n’n’n’sn’n’n’sn’sn’sn’n’n’sn’n’sn’n’n’sn’sn’sn’n’n’sn’n’n’n’sn’n’n’n’sn’n’n’sn’sn’sn’n’n’sn’n’n’n’sn’n’n’n’n’n’sn’n’n’n’sn’n’n’sn’sn’sn’n’n’sn’n’sn’n’n’sn’sn’sn’n’n’sn’ AeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeAeroAeAeroAeAeroAeAeroAerorororororoAeroAeroAeroAeAeroAeroAeroAeAeroAeAeroAerorororororororororoAeroAerorororororoAeroAeroAeroAerorororororororororororororororororororororororororororororororororororororororoAeroAeAeroAeAeroAeAeroAeAeroAerorororororoAeroAeroAeroAeAeroAeroAeroAeAeroAerorororororororororororoAeAeAeroAeAeAeAeAeAeroAeAeAeAeAeAeroAeAeAeAeAeAeroAeAeAeAeAeAeroAeAeAeAeAeAeroAeAeAe nanaronaroronaronananananananananananananananaronaronananananananananananananananananananananananananananananananananananananananananaronaroronaronananaronaroronaroronaronanananananananananananananananananautututututututututututututututututututututututututututututututututututututututututututututututututututututututututututututicicuticuticicicicicicicicicicicicicicicicicicicicicicicicicicicicicicicuticututicuticicicicicicicicicicicicicicicicicuticututicuticicicicicicicicicicicicicicicicicicicicicalicalicicalicalalalalalalalalalalalalalalalalalalalalalalicalicalalalalalalalalalalalalalicalicalalalalalalalalalicalicicalicalalalalalalalalalalalalicalicicalicalalalalalalalalalalalalalalalHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeriHeriHeHeriHeririririririHeriHeriHeriHeHeriHeHeriHeririririririHeriHeriHeriHeHeriHeriHeriHeHeriHeHeriHeririririririririHeriHeririririririHeriHeriHeriHeririririririririririririririririririririririririririririririririHeriHeHeriHeHeriHeririririririHeriHeriHeriHeHeriHeriHeriHeHeriHeririririririHeriHeHeHeHeriHeHeHeHeHeHeriHeHeHeHeHeHeriHeHeHeHeHeHeriHeHeHeHeHeHeriHeHeHeHeHeHeriHeHeHe tataritariritaritatatatatatatatatatatatataritaritatatatatatatatatatatatataritariritaritatatatatatatatatatatatatatatatatatatatataritaritataritariritaritatatatatatatatatatatatagegetagetatagetagegegegegegegegegegegegegegegegegegegegegegegegegegegegegegegegegegegegegegetagetatagetagegegegegegegegegetagetatagetagegegegegegegegegegegegegegegegegegegegegegegegegege

JuJuJuJuJubibiJubiJu lelebilebi eeleeleleele fefefefefefefeatatfeatfe ururaturataturat esesuresururesurJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJubibibibibibiJubiJubibibibibibiJubiJubiJubiJubibibibibibibibibibibibibiJuJuJubiJuJuJu lelelelelelelelelelelelelelelebilebilelelelelelebilebilebilebilelelelelelelelebibibilebibibileeleleeleeeeleeleeleeleleeleeleeleeeeleeleeeeleeleeleeleleeleeleeleeleleleeleleleleleleeleleleleleleeleleleleele fefefefee fee fefefefefefefefefefefefefefefefefefee fee fee feee fee fee fee fefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefeatfefefeatfefeatfefefeatfefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefeeee feeeeeee feeeee feeee fee fee feeee feee feeee fee fee feeee feee feeee fee fee feeee feee fee atatatatatatatatatatatatatatatatatatfeatfeatfeatfefeatfeatfeatfeatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatfefefeatfefefefefefeatfefefefefefeatfefefefeatfefefeatfeatfeatfefefeatfefeatfefefeatfeatfeatfefefeatfefeatfefefeatfeatfeatfefefeatfefeatfefeatfefefeatfeatfeatfefefeatfefeatfefefeatfeatfeatfefefeatfefefefeatfefefefeatfefefeatfeatfeatfefefeatfefeatfefefeatfeatfeatfefefeatfefeatfe ururururururururururururururururururaturaturaturataturaturaturataturaturaturataturaturaturatururururururururururururururururururururururururururururururaturataturaturaturataturaturaturatururatataturatatatatataturatatatatataturatatatatataturatatataturataturaturesuresesesesesesuresuresuresuresesesesesesesesesesesesesesesesesesuresururesuresesesesesesesesesuresuresuresururesuresuresururesuresuresuresesesesesesesesesesesesesesesesesesesesesesuresuresesesuresuresuresururesuresuresuresurururesururururesururururesururururururesururururururesururururesururururesururururesur

ArArArctctctctcticic crcr

ValiantVibrations

SEPTEMBER 2012 £4.25

Flt Lt Ron Clark DFCflies on board

Californiangatheringof Vultee’sfinest

FULLPAGEOLYMPICSPOSTER!OSTTTEERR!OSTTTEERR!

1940

®

www.aeroplanemonthly.com

SEPTEMBER

2012

More than a century of History in the Air

DATABASEWestland LysanderWestland Lysander

FFlltt LLtt RR CCll kkkkkk DDDDDDDDDDDDFFFFFFFDDDDDDDFFFFFFFFFFFFFFFCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC FFFFFFFFFFFFll kkkkkk DDDDDDDDDDRRFFlltt LL DDRFlt Lt R Cl k DFC

Lancasterpoppy drop for

BCM unveiling

Maintaining StirlingsFleet Air Arm style

18PAGESOFDETAIL

issuesfor just

✁

Offer code: P135

Subscription hotline 0845 872 7385 & quote “P135”

FlFlFltt LtFlFFlFFlFFlFlFFlFFllFlFllFlllttttttttttt LLtLLtLFlFFlFFlFFlFlFFlFFllFlFllFlFllFllFllFll

LaLaLaLaLaLaLaLaLancncncncncncncncncncncncncncncncasasasasasasasasasasasasasteteteteteteteteteteteteteteteteterrrrrrrrpopopoppppppyyyyyyy drdrdropopopopopopopopop fofo

BCBC

SUBSCRIPTION OFFER

LtLtLtLt RoLtLLtLLtLLtLLttLtLttLttLttLttLttLtt RRoRRoRRRoRRoRoRRoRRLtLLtLtLLtLtLLtLLLtLLtLLt Lt RBCBCBCBCBCMMM un OFFER

OPEN TO UK RESIDENTS ONLY WHEN PAYING BY

DIRECT DEBIT ONLY

Name and full postal address of your bank or building society

Bank / Building Society Name:

Address:

Postcode:

Account in the name(s) of:

Branch sort code Bank/Building society account number

INSTRUCTION TO YOUR BANK OR BUILDING SOCIETYPlease pay Kelsey Publishing Ltd. Direct Debits from the account detailed in this instruction subject to the safeguards assured by the Direct Debit guarantee. I understand that this instruction may remain with Kelsey Publishing Ltd and, if so, details will be passed electronically to my Bank or Building Society.

Signature(s):

Date: Originator’s Id number

Banks and buildings societies may not except Direct Debit instructions for some types of account

8 3 7 3 8 3

• BEST DEAL • BEST DEAL • BEST DEAL • BEST DEAL • PAY BY DIRECT DEBIT (UK ONLY)

£3.00 initially and then £10.75 every 3 months until I cancel my direct debit instruction with my bank/building society

SUBSCRIPTION OFFER• BEST DEAL • BEST DEAL • BEST DEAL • BEST DEAL •

)

SAVE31%

UK £45.00 EUROPE/Ireland £61.80 RoW £66.00 I enclose a cheque made payable to Kelsey Publishing Ltd.

Maestro only

Card Number:

Security no: Valid from: / Expiry date: /

Maestro issue: Card holder:

Signature:

PAY BY CREDIT / DEBIT CARD OR CHEQUE 12 ISSUES OF AEROPLANE MONTHLY

Please debit my Visa Visa Debit MasterCard Amex Maestro

SAVE 12%

4th digit: Amex only

Kelsey Publishing Group LTD uses a Multi Layered Privacy Notice giving you brief details about how we would like to use your personal information. For full details visit www.aeroplanemonthly.co.uk or call 01733 353368. If you have any questions please ask as submitting your data indicates your consent, until you choose otherwise, that we and our partners may contact you about products and services that will be of relevance to you via direct mail, phone, email and SMS. You can opt-out at ANY time via email data.controller@kelseypb.co.uk or 01733 353368.

Complete coupon & post to: Aeroplane Monthly Subs, Freepost RSXY-XXGK-EUYS, Kelsey Publishing Ltd, MARKET HARBOROUGH, LE16 9EF.From outside the UK: Aeroplane Monthly Subs, Kelsey Publishing Ltd, Tower House, Sovereign Park, Lathkill Street, MARKET HARBOROUGH, LE16 9EF, UK.

Please note this number is provided for UK residents only. Calls charged at your local call rate, for further information please check with your service provider. International callers please use 0044 (0)1858 438 856. Hotline Open: Mon-Fri 8am-9.30pm, Sat 8am-4pm.

The CLASSIC AIRCRAFT TRUSTLet’s keep them flying!

Think of it! 1 absolute classics preserved and maintained fl yable by The Classic Aircraft

Trust, a new Trust formed specifi cally to ensure that these historically important aircraft

remain in British skies, and are not sold

and exported to countries like Australia,

Canada, New Zealand & the USA.

The Trust’s aircraft have been either

donated or loaned to TCAT, where they

will be preserved or restored to fl ying

condition.

TCAT is based within AIRBASE, located at Coventry Airport. (Free entry to AIRBASE for Classic Flight Club members)

The Trust currently has 13 vitally important aircraft on its charter with more to come, visit the new website for full details about the Trust, its aircraft and the

Classic Flight Flying Club, a part of TCAT.

www.keepthemfl ying.co.uk

Above: Gloster Meteor T.7 WA591 / G-BWMF

Left: English Electric Canberra B.2/6 WK163 B-BVWC

Below: Avro 652a Anson C.21 G-VROE

How can you help ?

Join the Classic Flight Club !

Memberships from just £1 a week just send a short email to info@keepthemfl ying.co.uk stating an interest in joining the club and we’ll contact you.or call TCAT on 02476 882615.

The Trust currently has 13 vitally important aircraft on its charter with more to come, visit the new website for full details about the Trust, its aircraft and the

Classic Flight Club, a part of TCAT.

Registered Charity Number 11467370