Journal of Cardiac Failure Vol. 18 No. 9 2012

Basic Science and Experimental Studies

Aerobic Exercise Training Delays Cardiac Dysfunctionand Improves Autonomic Control of Circulation in Diabetic

Rats Undergoing Myocardial Infarction

BRUNO RODRIGUES, PhD,1,2,* LUCIANA JORGE, MSc,2,* CRISTIANO T. MOSTARDA, PhD,2 KALEIZU T. ROSA, PhD,2

ALESSANDRA MEDEIROS, PhD,3 CHRISTIANE MALFITANO, PhD,2 ALCIONE L. DE SOUZA JR, MSc,4

KATIA APARECIDA DA SILVA VIEGAS, MSc,4 SILVIA LACCHINI, PhD,4 RUI CURI, MD, PhD,4 PATRICIA C. BRUM, PhD,5

K�ATIA DE ANGELIS, PhD,6 AND MARIA CL�AUDIA IRIGOYEN, MD, PhD2

S~ao Paulo, Brazil

From the 1HumS~ao Paulo-SP, BraSchool of Universpartment, FederalBiomedical Scien5School of PhysicPaulo-SP, Brazil a

Manuscript rece13, 2012; revised

Reprint requeststitute (InCor), AvS~ao Paulo, Brazile

ABSTRACT

Background: Exercise training (ET) has been used as a nonpharmacological strategy for treatment of di-abetes and myocardial infarction (MI) separately. We evaluated the effects ET on functional and molecularleft ventricular (LV) parameters as well as on autonomic function and mortality in diabetics after MI.Methods and Results: Male Wistar rats were divided into control (C), sedentary-diabetic infarcted (SDI),and trained-diabetic infarcted (TDI) groups. MI was induced after 15 days of streptozotocin-diabetes in-duction. Seven days after MI, the trained group underwent ET protocol (90 days, 50-70% maximal oxygenconsumption-VO2max). LV function was evaluated noninvasively and invasively; baroreflex sensitivity,pulse interval variability, cardiac output, tissue blood flows, VEGF mRNA and protein, HIF1-a mRNA,and Ca2þ handling proteins were measured. MI area was reduced in TDI (21 6 4%) compared withSDI (38 6 4%). ET induced improvement in cardiac function, hemodynamics, and tissue blood flows.These changes were probable consequences of a better expression of Ca2þ handling proteins, increasedVEGF mRNA and protein expression as well as improvement in autonomic function, that resulted in re-duction of mortality in TDI (33%) compared with SDI (68%) animals.Conclusions: ET reduced cardiac and peripheral dysfunction and preserved autonomic control in diabeticinfarcted rats. Consequently, these changes resulted in improved VO2max and survival after MI. (J CardiacFail 2012;18:734e744)Key Words: Diabetes, myocardial infarction, exercise training, cardiac function, calcium handling,VEGF, autonomic modulation.

The prevalence of diabetes in developed countries is ap- heart failure (HF) in the diabetic population, with diabetes

proaching epidemic proportions, and this disease has beenassociated with an increased risk of cardiovascular abnor-malities and microvascular complications.1 Evidence hasaccumulated with respect to a greater incidence of myocar-dial infarction (MI) and the subsequent development of

an Movement Laboratory, S~ao Judas Tadeu University,zil; 2Hypertension Unit, Heart Institute (InCor), Medicality of S~ao Paulo, S~ao Paulo-SP, Brazil; 3Biosciences De-University of S~ao Paulo, Santos-SP, Brazil; 4Institute ofces, University of S~ao Paulo, S~ao Paulo-SP, Brazil;al Education and Sports, University of S~ao Paulo, S~aond 6Nove de Julho University, S~ao Paulo-SP, Brazil.ived January 30, 2012; revised manuscript received Julymanuscript accepted July 17, 2012.s: Bruno Rodrigues, PhD, Hypertension Unit, Heart In-. Dr. Eneas de Carvalho Aguiar, 44eSubsolo, S~ao Paulo,05403-000. E-mail: bruno.rodrigues@incor.usp.br

734

presenting as a coexisting condition in 20 to 35% of HFpatients.2e4

In diabetic post-MI patients, autonomic function can beaffected by both the MI, including its complications, andthe preexisting cardiac autonomic neuropathy, which may

This work was supported by Fundac~ao de Amparo a Pesquisa do Estadode S~ao Paulo (FAPESP-07/58942-0), Conselho Nacional de Pesquisa e De-senvolvimento (CNPq-482520/2009-4; 306011/2010-7). B.R. had a post-doctoral fellowship from CNPq. L.J. had a master scholarship fromFAPESP (06/53800-0). M.C.I. and K.D.A. received financial supportfrom Conselho Nacional de Pesquisa e Desenvolvimento (CNPq-BPQ).See page 742 for disclosure information.* These authors contributed equally to this work.1071-9164/$ - see front matter� 2012 Elsevier Inc. All rights reserved.http://dx.doi.org/10.1016/j.cardfail.2012.07.006

Exercise Training in Diabetic Infarcted Rats � Rodrigues et al 735

worsen the clinical condition of these individuals.5 Further-more, diabetes has been a consistently powerful risk factorfor development of HF post-MI, accounting for 66% ofmortality during the first year.6 The combination of diabetesand HF after MI requires preventive action, because dia-betic patients may have a decreased capacity to remodelthe left ventricle after MI, and therefore develop HF atlower ventricular volumes than nondiabetic patients withsimilar sized infarcts.4

Accumulating evidence in the past 2 decades has shownthat exercise training (ET) is a remarkable nonpharmaco-logical strategy for the treatment of diabetes7 and chronicHF patients.8 Additionally, there is some evidence thatET significantly reduces the risk of cardiovascular diseasedevelopment in diabetic patients7 and the degree of all-cause mortality in HF subjects.9

Our group has previously reported that ET in streptozo-tocin (STZ) diabetic rats improves cardiovascular auto-nomic function and metabolic control, and these benefitsremain after a detraining period.10 Moreover, we recentlyobserved that early aerobic ET reduced cardiac and periph-eral dysfunction and preserved cardiovascular autonomiccontrol after MI, resulting in improved functional capacityand survival rate.11 However, the effects of ET in the MI as-sociated with diabetes have been poorly investigated. Thisstudy was undertaken to test the hypothesis that ET in dia-betic rats undergoing MI improves LF function and bloodflows (BF) and, concomitantly, cardiac autonomic functionand that this could affect functional capacity and survival.The present investigation was designed to evaluate the ef-fects of ET (started 1 week after MI) on 1) left ventricular(LV) dysfunction and molecular profile, 2) hemodynamicsand regional BF, 3) baroreflex sensitivity (BRS) and cardiacautonomic modulation, 4) functional capacity (maximumoxygen consumption), and 5) total mortality of diabeticrats after MI.

Methods

Experiments were performed in adult male Wistar rats (230 to250 g) from the Animal House of the University of S~ao Paulo,S~ao Paulo, Brazil. Rats were fed standard laboratory chow andwater ad libitum. The animals were housed in collective polycar-bonate cages in a temperature-controlled room (22�C) witha 12-hour darkelight cycle (light 07:00e19:00). The experimentalprotocol was approved by the institutional animal care and usecommittee of the Medical School of the University of S~ao Paulo,and this investigation was conducted in accordance with the Guidefor the Care and Use of Laboratory Animals published by the USNational Institutes of Health (NIH Publication No. 85-23, revised1985; http://grants1.nih.gov/grants/olaw/references/phspol.htm).The rats were randomly assigned to 3 groups: control (C, n 5 8),sedentary diabetic þ MI (SDI, n 5 25), and trained-diabetic þMI (TDI, n 5 12). All-cause mortality was investigated beginningafter the MI surgery (to exclude the influence of anesthesia or stressfrom the surgical procedure) in all animals (n 5 45). Other evalu-ations in this study were performed in 8 rats from each group.

Diabetes Induction

Experimental diabetes was induced by an intravenous injectionof 50 mg/kg STZ (Sigma Chemical Co., St. Louis, MO) dissolvedin citrate buffer (pH 4.2). The rats were fasted overnight before theSTZ injection. The C rats were injected with buffer only (10 mMcitrate buffer, pH 4.5). Forty-eight hours after the STZ injection,diabetes was confirmed in fasted animals (6 hours) by the mea-surement of blood glucose levels O200 mg/dL.12,13

Myocardial Infarction

Fifteen days after the STZ injection, the SDI and TDI groupswere anesthetized (80 mg/kg ketamine and 12 mg/kg xylazine, ad-ministered intraperitoneally [i.p.]) and underwent MI induction bysurgical occlusion of the left coronary artery, as describedelsewhere.11e13 Briefly, a left thoracotomy was performed, thethird intercostal space was dissected, and the heart was exposed.The left coronary artery was occluded with a single nylon (6.0) su-ture approximately 1 mm distal to the left atrial appendage. Thechest was closed with a silk suture. The animals were maintainedunder ventilation until recovery. The C rats underwent the sameprocedures except that myocardial ischemia was not induced.The MI area was measured by echocardiography at the begin-

ning (2 days after MI) and end of the ET protocol (final evalua-tion). It was delimited taking into account the movement of LVwalls, by the observation of longitudinal, apical, and transversalviews of the LV as previously described.11e13 The MI size wasconfirmed by histological analyzes. Sections of 5 mm were stainedwith Picrosirius (red staining) for fibrosis evaluation as previouslydescribed.11

Echocardiography

Echocardiographic evaluation was performed by a double-blinded observerdunder the guidelines of the American Societyof Echocardiographyd2 days (initial evaluation) after MI andafter the ET protocol (final evaluation). Rats were anesthetized(80 mg/kg ketamine and 12 mg/kg xylazine, i.p.), and imageswere obtained with a 10 to 14 MHz linear transducer in a SE-QUOIA 512 (ACUSON Corporation, Mountain View, CA) formeasurement of morphometric parameters: LV mass (absoluteand corrected by body weight), LV diastolic diameter (LVDD),LV posterior wall thickness in diastole (LVPWTd), and relativewall thickness (RWT); systolic function: ejection fraction (EF);and diastolic function: LV isovolumetric relaxation time (IVRT)and E wave/A wave ratio (E/A ratio), as described in detailelsewhere.11e13

Maximal Oxygen Consumption (VO2max) and ExerciseTraining

Sedentary and trained rats were adapted to the treadmill (10 min/day; 0.3 km/h) for 7 days after MI. The VO2max was determinedby analyzing expired gas during a progressive exercise ramp proto-col, using an oxygen analyzer (S-3A/I, Ametek, Pittsburgh, PA), aspreviously described.11 Analyses were performed at the basal pe-riod, 15, 60, and 90 days after the start of the ET period. ET wasperformed on a motorized treadmill at low to moderate intensity(50 to 70% of VO2max) for 1 hour a day, 5 days a week for 90days, with a gradual increase in speed from 0.3 to 1.2 km/h.10,11

C and SDI rats were placed on the treadmill every day for thesame length of time as the TDI group.

736 Journal of Cardiac Failure Vol. 18 No. 9 September 2012

Cardiovascular Assessments

Twenty-four hours after the final echocardiographic evaluation, 2catheters filled with 0.06 mL of saline were implanted into the fem-oral artery and femoral vein of the anesthetized rats (80 mg/kg ket-amine and 12 mg/kg xylazine, i.p.). On the next day, the arterialcannula was connected to a strain-gauge transducer (Blood Pres-sure XDCR; Kent Scientific, Torrington, CT), and arterial pressure(AP) signals and pulse intervals (PI) were recorded over a 30-minute period in conscious animals, as previously described.11,13

Sequential bolus injections (0.1 mL) of increasing doses of phen-ylephrine (0.25e32 mg/kg) and sodium nitroprusside (0.05e1.6mg/kg) were given to induce increases or decreases in MAP re-sponses (for each drug), ranging from 5 to 40 mm Hg. Baroreflexsensitivity was expressed as bradycardic response (BR) and tachy-cardic response (TR) in beats per minute per millimeter of mercury,as described elsewhere.11,13

Cardiac Autonomic Modulation

The overall variability of the pulse interval (PIV) was assessedin the time and frequency domains by spectral estimation in the30-minute recorded basal period, as described elsewhere.11,14 Spec-tral power for very-low-frequency (0.00-0.20), low-frequency (LF:0.20-0.75 Hz), and high-frequency (HF: 0.75-4.0 Hz) bands werecalculated by power spectrum density integration within each fre-quency bandwidth, using a customized routine (MATLAB 6.0;Mathworks, Natick, MA).

LV Catheterization and Microspheres Infusion

Twenty-four hours after cardiovascular assessments, LV pres-sure signals were directly recorded (5 minutes) in anesthetizedrats (50 mg/kg sodium pentobarbital, i.p.) using the same systempreviously described. The following indices were obtained: LVsystolic pressure (LVSP), LV end-diastolic pressure (LVEDP),maximum rate of LV pressure rise and fall (þdP/dt and -dP/dt).After LV pressure basal records, yellow (150,000) 15-nm Dye-Trak microspheres (Triton Technology, San Diego, CA) were in-fused to measure blood flow (BF) in LV, right ventricle, lungs,kidneys, gastrocnemius muscle, cardiac output (CO), and to deter-mine peripheral vascular resistance (PVR). LV catheterization andmicrosphere infusion and processing were performed as describedpreviously.11 On the next day, the animals were killed by decapi-tation to perform the analysis described in the following section.

Reverse Transcription for HIF1-a and VEGF

Total RNA was obtained from LV (50 mg) by the guanidine iso-thiocyanate extraction method,15,16 using Trizol reagent followingthe manufacturer’s protocol, as previously described.11,12 Hypoxia-inducible factor 1, alpha subunit (HIF1-a) (50TGGCTTTGGAGTTTCAGAGGC30; 30GACTTCGGCAGCGATGACAC50) and vascularendothelial growth factor A (VEGF) (50ACTGTGAGCCTTGTTCAGAGCG30; 30CGGATCTTGGACAAACAAATGC50) expressionswere evaluated by real-time polymerase chain reaction. The glyceral-dehyde-3-phosphate dehydrogenase (GAPDHd50 ATGGTGAAGGTCGGTGTG30; 30GAACTTGCCGTGGGTAGAG50) genewas used asan inner control (housekeeping geneeannealing temperature at 608C),as indicated by geNorm software (http://medgen.ugent.be/genorm/).

Enzyme-Linked Immunosorbent Assay for VEGF

Measurement of VEGF was performed in samples of the LVprotein by using enzyme-linked immunosorbent assay Duo-set

kits available for VEGF (R&D Systems Inc., Minneapolis, MN).The assay was performed according to the manufacturer’s proto-col. The sensitivity of the assays was 15 pg/mL. The resultswere normalized by LV total protein extracted using the Bradfordmethod.11,12,17

Western Blot Analysis for Ca2D Handling Proteins

LV homogenates were analyzed by using Western blotting toevaluate the expression of sarcoplasmic reticulum calcium ATPasepump (SERCA2), phospholamban (PLN), phosphorylated-PLN atserine 16 (phospho-ser16-PLN), phosphorylated-PLN at threonine17 (phospho-thr17-PLN), phosphatase protein 1 (PP1), and so-dium calcium exchanger (NCX), as described elsewhere.13,18 Tar-geted bands were normalized to cardiac GAPDH.

Statistical Analysis

Data are reported as mean6 SEM. After confirming that all con-tinuous variables were normally distributed using the Kolmogorov-Smirnov test, statistical differences between the groups wereobtained by 1-way analysis of variance (ANOVA) followed bythe Student-Newman-Keuls posttest. Statistical differences be-tween the data measured over time were assessed using repeated-measures ANOVA. Pearson’s correlation was used to study theassociation between different parameters. The survival curve wasestimated by the Kaplan-Meier method and compared by the log-rank test. All tests were 2-sided, and the significance level wasestablished at P ! .05. Statistical calculations were performedusing SPSS version 17.0.

Results

Animals

The animal characteristics, such as body weight, heartweight, glycemia and VO2max can be observed inTable 1. Body weight was similar among all study groupsat the beginning of the protocol (w232 6 15 g). At theend of the protocol, SDI and TDI rats had reduced bodyweight compared with C; however, ET prevented thebody weight reduction in TDI when compared with SDIrats. SDI and TDI animals displayed reduced heart weightin comparison with C animals. In contrast, heart weight/body weight ratio was increased in SDI and TDI rats com-pared with that in the C rats. Furthermore, ET reduced theheart weight/body weight ratio in the TDI compared withthe SDI group (Table 1).

Glycemia was increased in diabetic MI rats (SDI andTDI) at the beginning of the protocol compared with thatin C. Similarly, at the end of the protocol, diabetic MIgroups also had elevated levels of glycemia in relation tothat in C; however, TDI displayed a reduction in glycemiclevels compared with their initial evaluation and with SDIgroup levels.

The diabetic MI groups (SDI and TDI) had impairedVO2max at baseline, 15, 60, and 90 (only SDI group)days compared with that in the C group. C and SDI groupshad reduced values at 90 days compared with their initialevaluation. Importantly, 90 days of ET were effective inincreasing VO2max in the TDI group compared with the

Table 1. Characteristics of the Animals

Parameters/Group C SDI TDI

BW (g) Initial 228 6 7 243 6 4 235 6 5Final 510 6 3z 201 6 3z,* 249 6 3*,y

HW (g) Final 1.49 6 0.02 1.22 6 0.03* 1.29 6 0.02*HW/BW Final 3.11 6 0.02 6.12 6 0.04* 5.01 6 0.03*,y

Glycemia (mg/dL) Initial 88 6 2 384 6 12* 397 6 8*Final 90 6 1 371 6 9* 348 6 10z,*,y

VO2 max (mL�kg�min�1) Basal 85 6 3 54 6 1* 55 6 2*15 days 83 6 4 51 6 1* 59 6 1*,y

60 days 81 6 3 44 6 1z,* 68 6 2z,*,y

90 days 76 6 2z 40 6 2z,* 71 6 1z,y

BW, body weight; HW, heart weight; VO2 max, maximal oxygen consumption.Values are expressed as mean 6 SEM.*P ! .05 vs C.yP ! .05 vs SDI (n 5 8 for each group).zP ! .05 vs initial evaluation.

Exercise Training in Diabetic Infarcted Rats � Rodrigues et al 737

SDI group, reaching similar values compared with C(Table 1).

Mortality Rate

During the ET period, total mortality rate was higher inthe SDI group (17 deaths among 25 SDI rats, 68%) com-pared with the C group (no deaths). ET strongly reduced to-tal mortality in the TDI group (4 deaths among 12 TDI rats,33%; P ! .001) compared with the SDI group (Fig. 1).

LV Function

The akinetic LV area (MI area) was similar at the initialand final evaluations in the SDI group (36 6 3 vs 38 64%). In contrast, the TDI group had a reduction in akineticLV area after the ET protocol (final evaluation) (21 6 4%)compared with its initial evaluation (37 6 3%) and with theSDI group, as can be seen in Figure 2. In addition, we ob-served a strong correlation between the infarcted area eval-uated by echocardiography and Picrosirius red staining atthe end of the protocol (r 5 0.88, P ! .0001).The echocardiographic parameters are shown in Table 2.

The initial evaluation, performed 2 days after MI, showedthat LVDD was increased and that EF was reduced in the

0 15 30 45 60 75 900

25

50

75

100

Days of ET

% o

f Su

rviv

al

*

†

C

TDI

SDI

*

Fig. 1. The Kaplan-Meier survival curve from control (C),sedentary diabeticþmyocardial infarction (MI) (SDI), andtrained-diabeticþMI (TDI) groups. *P ! .001 vs C; yP ! .001vs SDI.

diabetic MI groups (SDI and TDI) compared with thosein the C group. Furthermore, the E/A ratio was higher atthe initial evaluation in the SDI and TDI groups than inthe C group; however, was reduced in the 2 experimentalgroups at the final evaluation, corresponding to a ‘‘pseudo-normalization’’ pattern. The final echocardiographic evalu-ations (after the ET period) showed that LVDD remainincreased in the SDI and TDI groups compared with thosein the C group. Furthermore, the LV mass corrected byweight that was increased in SDI animals was reduced byET, as can be observed in TDI animals. The association be-tween diabetes and MI induced reduction of LV posteriorwall thickness in diastole and relative wall thickness inSDI group. However, these values were normalized byET, as can be seen in TDI group (Table 2).

ET benefits were mainly observed by improvement in EFvalues in the TDI group in comparison not only with theSDI group but also with the initial evaluation in the samegroup. In addition, a negative correlation was observed be-tween MI area and EF (r 5 �0.78, P 5 .0005) in the dia-betic infarcted groups (SDI and TDI), showing that thereduction of MI area was associated with improvement ofsystolic function in these animals. The IVRT, which wassimilar between SDI and TDI animals at the initial evalua-tion, increased in SDI and was normalized by ET in TDIrats.

LV function was also estimated by LV catheterization, andthe data are presented in the Table 3. LVSP was reduced inSDI and TDI rats compared with C rats. Reductionsin þdP/dt (inotropic index) and -dP/dt (lusitropic index), aswell as increases in LVEDP were observed in the SDI groupcompared with that in the C group. ET improved þdP/dtand -dP/dt and reduced in LVEDP in the TDI group com-pared with the SDI group. In addition, the TDI animalshad LVEDP values similar to those in the C group.

Hemodynamic and Autonomic Functions

Hemodynamic and autonomic measurements were per-formed at the end of the ET protocol; the results are pre-sented in Table 4. AP and heart rate (HR) were reduced

0

5

10

15

20

25

30

35

40

45

laniFlaitinI

SDI

TDI

‡ †%

of

LV

A

B C

Fig. 2. Direct and indirect myocardial infarction area measurements. (A) Myocardial infarction area evaluated by echocardiography in sed-entary diabeticþMI (SDI), and trained-diabeticþMI (TDI) groups at the beginning and at the end of the protocol. Representative photo-micrographies of infarcted area in SDI (B) and TDI (C) groups at the end of the protocol. zP ! .05 vs initial evaluation; yP ! .05 vs SDI(n 5 8 for each group).

738 Journal of Cardiac Failure Vol. 18 No. 9 September 2012

in the SDI compared with the C group. However, ET nor-malized these hemodynamic parameters in the TDI group.The CO and stroke volume reduction, as well as PVR in-crease observed in SDI compared with C rats, were im-proved by ET in TDI rats. BRS, evaluated by BR and TRevoked by AP rises and falls, was impaired in the SDIand TDI groups in relation to that in the C group. However,ET improved BRS in the TDI animals in comparison toSDI, although these values were not normalized. PIV andabsolute LF and HF bands were reduced in the SDI groupcompared with the C group. ET increased the PIV, the ab-solute LF and HF bands in TDI animals compared with sed-entary ones.

Regional BFs

MI in sedentary diabetic rats diminished LV, RV, lungs,left and right kidneys, and gastrocnemius muscle BF inSDI compared with the C group. ET normalized all re-gional BF in TDI compared with C rats, except for lungs(Table 5).

Gene and Protein Expression of VEGF and HIF1-aGeneExpression

As Figure 3 illustrates, SDI and TDI groups had HIF1-a mRNA expression increased compared with the C group(Fig. 3A).ETincreasedVEGFmRNAexpression inTDI com-pared with C and SDI animals (Fig. 3B), triggering an im-provement in the VEGF protein expression in the TDIcomparedwith the SDI animals (Fig. 3C). Furthermore, a pos-itive correlation (r5 0.56, P5 .0287) was observed betweenVEGF protein expression and LV BF across all animals.

Expression of Ca2D Handling Proteins

GAPDH protein levels did not differ among the studygroups (Fig. 4A). The expression of SERCA2 (Fig. 4B) andNCX (Fig. 4C) were reduced in SDI rats. However, ET nor-malized SERCA2 protein expression and, consequently, in-creased SERCA2/NCX ratio (Fig. 4D). The expression ofPLN, a phosphoprotein that regulates the apparent calciumaffinity of SERCA2 and phosphorylated PLN in both Ser16and Thr17 residues (Fig. 5A), was reduced in both SDI and

Table 2. Echocardiographic Measurements in Control (C),Sedentary DiabeticþMI (SDI) and Trained-DiabeticþMI

(TDI) Groups

Parameter/Group C SDI TDI

MorphometricLV mass (g) Initial 1.02 6 0.02 1.00 6 0.05 1.13 6 0.04

Final 1.10 6 0.03 1.14 6 0.05 1.21 6 0.03LV mass corr.(mg/g)

Initial 4.41 6 0.09 4.70 6 0.12 4.72 6 0.13

Final 3.41 6 0.10 5.35 6 0.11* 4.61 6 0.09*,y

LVDD (cm) Initial 0.65 6 0.01 0.77 6 0.03* 0.81 6 0.03*Final 0.71 6 0.02 0.86 6 0.02* 0.84 6 0.04*

LVPWTd (cm) Initial 0.14 6 0.01 0.14 6 0.01 0.15 6 0.01Final 0.15 6 0.01 0.11 6 0.005* 0.16 6 0.005y

RWT Initial 0.43 6 0.03 0.39 6 0.04 0.35 6 0.02Final 0.40 6 0.02 0.29 6 0.02* 0.38 6 0.03y

Systolic FunctionEF (%) Initial 74 6 2 44 6 4* 43 6 3*

Final 71 6 1 54 6 4* 60 6 3z,*,y

Diastolic FunctionIVRT (ms) Initial 33 6 2 30 6 3 29 6 1

Final 30 6 1 37 6 2* 30 6 2y

E/A ratio Initial 1.6 6 0.1 2.7 6 0.2* 2.5 6 0.4*Final 1.6 6 0.2 1.6 6 0.1z 1.5 6 0.1z

LV mass, absolute left ventricular mass; LV mass corr., LV mass cor-rected by body weight; LVDD, left ventricular diameter during diastole;LVPWTd, left ventricular posterior wall thickness in diastole; MI, myocar-dial infarction; RWT, relative wall thickness; EF, ejection fraction; IVRT,left ventricular isovolumetric relaxation time; E/A ratio, E wave and Awave ratio.Values are expressed as mean 6 SEM.*P ! .05 vs C.yP ! .05 vs SDI (n 5 8 for each group).zP ! .05 vs initial evaluation.

Table 4. Hemodynamic and Autonomic Parameters inControl (C), Sedentary DiabeticþMI (SDI), and Trained-

DiabeticþMI (TDI) Groups

Parameter/Group C SDI TDI

HemodynamicSAP (mm Hg) 125 6 2 108 6 2* 121 6 1y

DAP (mm Hg) 91 6 2 83 6 2* 96 6 1y

MAP (mm Hg) 108 6 2 96 6 2* 109 6 1y

HR (beats/min) 352 6 12 282 6 15* 323 6 10y

CO (mL/min) 111 6 8 57 6 4* 90 6 7*,y

Stroke volume (mL) 0.32 6 0.02 0.21 6 0.03* 0.28 6 0.02PVR (mm Hg�mL�min) 0.95 6 0.1 1.75 6 0.3* 1.16 6 0.1y

Baroreflex SensitivityBR (beats/min�mm Hg) �2.08 6 0.1 �1.01 6 0.1* �1.77 6 0.1*,y

TR (beats/min�mm Hg) 3.23 6 0.1 1.29 6 0.2* 2.59 6 0.2*,y

Pulse Interval VariabilityPI Variance (ms2) 100 6 13 32 6 5* 105 6 15y

LF band (ms2) 3.97 6 0.6 0.67 6 0.1* 5.05 6 0.9*,y

HF band (ms2) 13.94 6 0.9 6.79 6 0.8* 23.03 6 2.9*,y

BR, bradycardic response; CO, cardiac output; DAP, diastolic arterialpressure; HF band, high-frequency band; HR, heart rate; LF band, low-frequency band; SAP, systolic arterial pressure; MAP, mean arterial pres-sure; MI, myocardial infarction; PI variance, pulse interval variance;PVR, peripheral vascular resistance; TR, tachycardic response.Values are expressed as mean 6 SEM.*P ! .05 vs C.yP ! .05 vs SDI (n 5 8 for each group).

Exercise Training in Diabetic Infarcted Rats � Rodrigues et al 739

TDI groups (Fig. 5B), whereas the SERCA2/PLN ratio, animportant index of sarcoplasmic reticulum calcium uptakecapacity, was increased in TDI compared with C and SDIgroups (Fig. 5C). The expression levels of phospho-ser16-PLNwere increased in SDI and TDI animals (Fig. 5D), whilephospho-thr17-PLN,whichwas higher in the SDI group, wasnormalized by ET, as observed in Figure 5E. PP1 expression,a PLN phosphorylation regulator, was unchanged in the ex-perimental groups (Fig. 5F).

Discussion

Since the classic Framingham Study in the 1970s, evi-dence has accumulated regarding the higher cardiovascular

Table 3. Invasive Measurements of Left VentricularFunction in Control (C), Sedentary DiabeticþMI (SDI) and

Trained-DiabeticþMI (TDI) Groups

Variable/Group C SDI TDI

LVSP (mm Hg) 134 6 5 93 6 4* 105 6 4*LVEDP (mm Hg) 5 6 0.3 12 6 2.1* 7 6 2.0y

þdP/dt (mm Hg/sec) 9447 6 420 5402 6 752* 7422 6 540*,y

�dP/dt (mm Hg/sec) �7190 6 169 �4030 6 484* �6056 6 360*,y

þdP/dt and �dP/dt, maximum rate of left ventricle pressure rise andfall; LVSP e left ventricle systolic pressure; LVEDP, left ventricularend-diastolic pressure; MI, myocardial infarction.Values are expressed as mean 6 SEM.*P ! .05 vs C.yP ! .05 vs SDI (n 5 8 for each group).

morbidity and mortality in diabetic patients,2 mainly in in-dividuals with a history of MI.3 Despite the fact that thecardiovascular consequences in diabetic patients after MIcan lead to higher morbidity and mortality, the effects ofET in these individuals have been poorly studied. It is rec-ognized that ET is a powerful tool in the management ofcardiovascular diseases,19 reducing the mortality rate in di-abetic19 and MI patients.20,21 Our group has previouslydemonstrated innumerous beneficial effects of ET ina STZ diabetes model10,22,23 and experimental ischemicHF.11,24 However, the mechanisms by which ET can triggerbeneficial changes and reduce mortality in diabetic patientsafter MI are not completely understood. In the presentwork, we have demonstrated that ET in diabetic rats afterMI induced 1) an improvement in systolic and diastolicfunctions, probably related to a better expression of pro-teins related to intracellular Ca2þ homeostasis; 2) normali-zation of hemodynamics and regional BF, and an increasein VEGF gene and protein expression; and 3) an

Table 5. Regional Blood Flows in Control (C), SedentaryDiabeticþMI (SDI), and Trained-DiabeticþMI (TDI)

Groups

Blood Flow/Group(mL�min�g) C SDI TDI

Left ventricle 3.37 6 0.5 1.94 6 0.2* 2.76 6 0.4Right ventricle 2.08 6 0.3 0.48 6 0.1* 1.97 6 0.2y

Lungs 1.31 6 0.11 0.40 6 0.09* 0.73 6 0.20*Right kidney 3.69 6 1.1 0.91 6 0.3* 2.73 6 0.4Left kidney 3.57 6 1.1 0.97 6 0.3* 2.89 6 0.4Gastrocnemius 0.34 6 0.01 0.12 6 0.04* 0.50 6 0.05*,y

Values are expressed as mean 6 SEM.*P ! .05 vs C.yP ! .05 vs SDI (n 5 8 for each group).

*

0

1

2

3

4

5

6

7

8

C SDI DIT

*

*

HIF

1/G

AP

DH

VE

GF

mR

NA

(arb

itra

ry d

ensi

ty u

nits

)

0

1000

2000

3000

4000

5000

6000

C SDI TDI

VE

GF

pro

tein

pg/m

g of

pro

t/m

lA

B

C

0.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

C SDI TDI

Fig. 3. Gene expression of (A) hypoxia-inducible factor-1 mRNAalpha subunit (HIF1-a); (B) vascular endothelial growth factormRNA (VEGF); and (C) protein expression of VEGF in control(C), sedentary diabeticþmyocardial infarction (MI) (SDI), andtrained-diabeticþMI (TDI) groups. *P ! .001 vs C; yP ! .001vs SDI (n 5 8 for each group).

740 Journal of Cardiac Failure Vol. 18 No. 9 September 2012

improvement in cardiovascular autonomic function. Thesebenefits resulted in an increased functional capacity and re-duced mortality in TDI animals.

In the previous study from our group, early ET (started1 week after MI) reduced the MI area in trained normogly-cemic infarcted rats, and these data were related to im-provement in mRNA VEGF expression in the LV of theseanimals.11 In the present investigation, a significant reduc-tion in MI area in TDI compared with SDI rats was also ob-served, and here, besides the increased mRNA VEGF, animprovement in VEGF protein expression and LV bloodflow normalization may have been the plausible mecha-nisms that explain the MI area reduction in trained rats.In fact, since the study of McElroy et al,25 ET has been con-sidered an effective approach to reduce MI area and protect

rat hearts that undergo ischemic injury.26,27 The improve-ment in myocardial vascularization,28 better maintenanceof coronary flow, increase in VEGF mRNA and proteinlevels,29 and protein kinase C activation during exercise27

have been pointed out in other studies as possible causesfor the reduction in MI area.

The progression of HF after MI is associated with LV re-modeling, which manifests as gradual increases in LV end-diastolic and end-systolic volumes, wall thinning, anda change in chamber geometry, being usually associatedwith a continuous decline in EF.30,31 Although intensive in-vestigations have been conducted over the years, it is notclear how exercise affects this variable in thosewith diabetesafter a cardiac ischemic injury. In the present study, despitethe fact that LVDD was not different between the diabeticMI groups, the heart weight/body weight ratio and LVmass corrected by body weight were reduced in TDI whencompared with that in SDI. Furthermore, LV posterior wallthickness in diastole and relative wall thickness were in-creased by ET. Thus, it is possible that LV reverse remodel-ing may have occurred in the trained group, resulting incardiac physiological adaptation to ET. In this sense, long-term moderate ET has been shown to induce reverseremodeling in patients with stable chronic HF, and this wasassociated with significant increases in work capacity andpeak oxygen uptake.32 Furthermore, early ET after MI inrats improved the balance between matrix metalloproteinaseand the tissue inhibitor matrix metalloproteinase 1 expres-sions, attenuating myocardial fibrosis and preserving post-MI cardiac function.33

Confirming our hypothesis that ET promotes a reverseLV remodeling in TDI rats, an improvement in systolicand diastolic functions, represented by EF, þdP/dt, -dP/dt,CO, IVRT, and LVEDP, were observed in trained comparedwith sedentary rats. Additionally, we observed a negativecorrelation between MI area and EF in the diabetic in-farcted animals, evidencing that the reduction of MI areaby ET was related with the improvement of systolic func-tion in trained animals. In this sense, experimental studieshave been successful in demonstrating improvement in car-diac function in animals with diabetes34 and MI11 by ET;however, this is the first study to demonstrate that ET re-duces LV dysfunction in diabetic rats after MI.

Because cardiac function is strongly associated witha better profile of cardiac proteins related to intracellularcalcium homeostasis, we tested the possibility that theamelioration of LV function observed in TDI rats couldbe related to molecular changes related to calcium homeo-stasis. It was previously reported that in diabetic cardiomy-opathy, HF, or both, the cardiac dysfunction is, at least inpart, a consequence of changes in intracellular calcium ho-meostasis, which may be related to an altered expression,function, or regulation of SERCA2.11,13,34,35 Corroboratinga previous report from our group,13 SDI animals had a re-duction in SERCA2, with a compensatory increase in phos-pho-ser16-PLN and phospho-thr17-PLN expression levels.Despite this compensatory mechanism of phosphorylation

0

20

40

60

80

100

120

C SDI TDI

*

0

20

40

60

80

100

120

C SDI TDI

**

0

20

40

60

80

100

120

140

160

180

200

C SDI TDI

*

SER

CA

2 pr

otei

n(%

of

cont

rol)

NC

X p

rote

in(%

of

cont

rol)

SER

CA

2 / N

CX

B

C D

C SDI TDI

NCX

SERCA2

GAPDH

120 KDa

110 KDa

38 KDa

A

Fig. 4. Expression levels of regulatory proteins related to intracellular calcium homeostasis from control (C), sedentary diabe-ticþmyocardial infarction (MI) (SDI), and trained-diabeticþMI (TDI) groups. Targeted bands were normalized to cardiac GAPDH. (A)Representative blots of GAPDH, SERCA2, Naþ-Ca2þ exchanger (NCX); (B) SERCA2; (C) NCX; and (D) SERCA2/NCX ratio. *P !.001 vs C; yP ! .001 vs SDI (n 5 8 for each group).

Exercise Training in Diabetic Infarcted Rats � Rodrigues et al 741

of PLN in their active sites, the reduced expression of SER-CA2 may have been a determinant in the reduction of -dP/dt observed in diabetic rats after MI. In a previous studywith isolated STZ-diabetic hearts, Ligeti et al36 observedthat the reduced capacity of SERCA2 to sequester calcium,with consequently increased end-diastolic Ca2þi level maybe involved in the transitional state between the apparentlynormal functioning of the heart and the manifestation ofcardiomyopathy. Furthermore, prolongation of the Ca2þ

transient because of reduced sequestration into the sarco-plasmic reticulum by SERCA2, abnormal extrusion bythe NCX, and abnormalities of the contractile proteinsthemselves, has been identified as precursors of diastolicdysfunction in HF.37

ET has been pointed out as an important therapeutic toolto increase intracellular Ca2þ transient in diabetic mice34

and expression of proteins related to Ca2þ management inHF animals,11,18 improving cardiac inotropism and lusi-tropism. In the present study, we observed that ET in-creased SERCA2, SERCA2/PLN, SERCA2/NCX, andnormalized phospho-thr17-PLN protein expression com-pared with that in sedentary rats. Under this scenario, onemay consider that ET promotes changes in intracellular sig-naling that favors Ca2þ reuptake by sarcoplasmic reticu-lum, and prevents Ca2þ extrusion by sarcolemma. Thus,it is likely that these mechanisms are the precursors of im-provement in ventricular function observed in the trainedanimals in our study. Supporting our hypothesis that the im-provement of LV function has been associated with the ex-pression and/or regulation of SERCA2, studies have shownthat the induction of overexpression of SERCA2 in dia-betic38 and HF39 hearts improves cardiac contractility andrelaxation as well as LV remodeling.

The reduction of HR in diabetic animals at rest has beenattributed to changes in the sinoatrial node,10,23 althoughfunctional alterations in the cholinergic mechanism cannotbe excluded as a causal factor. In this regard, the attenua-tion of resting bradycardia in the postexercise period inthe present study may be related to changes in intrinsicHR or sympathovagal cardiac balance, as previously ob-served in trained diabetic rats.10,23

Taken together, our results clearly suggest that ET inter-vention may be favorable for improving cardiac function,normalization of PVR, stroke volume, and HR as well as in-creasing EF and CO, which could explain the normalizationof MAP observed in the TDI rats. Thus, it is possible thatthe MAP normalization has been responsible for maintain-ing or increasing the ventricles, kidneys, and gastrocnemiusmuscle blood flows in the TDI group. Considering that ox-ygen consumption is related to CO and arterial venous dif-ference and arterial venous difference is regulated byperipheral blood flow, the normalization of cardiac and pe-ripheral dysfunctions observed in TDI rats can be a keypoint in determining the improvement in functional capac-ity (VO2max) in the trained study animals.

In a diabetic post-MI patient, cardiac and peripheral auto-nomic functions can be affected by diabetes sequelae, by MIsequelae, or by a combination of both. Either pathology (ie, di-abetes and MI-related autonomic dysfunction) has been sepa-rately linked to an increased mortality risk.40,41 To furtherinvestigate mechanisms underlying the improved cardiacfunction, tissue perfusion, and the reduced mortality rate ob-served in TDI animals, we evaluated autonomic function inthe study animals. Corroborating recent clinical data,5 thecombination of diabetes and MI, associated with consistentcardiac autonomic impairment, observed by a reduction in

0

20

40

60

80

100

120

C SDI TDI

* *

PL

N p

rote

in(%

of

cont

rol)

020406080

100120140160180200220

C SDI TDI

SER

CA

2 /

PL

N

*

0

50

100

150

200

250

300

350

400

C SDI TDI

Pho

spho

-Ser

16-P

LN

(% o

f co

ntro

l)

**

0

50

100

150

200

250

300

350

400

450

500

C SDI TDI

*

Pho

spho

-Thr

17-P

LN

(% o

f co

ntro

l)

0

20

40

60

80

100

120

140

160

C SDI TDI

PP

1 pr

otei

n(%

of

cont

rol)

C

B

D

E F

GAPDH

Phospho-Ser16-PLN

PLN

Phospho-Thr17-PLN

PP1

38 KDa

25 KDa

25 KDa

25 KDa

38 KDa

C SDI TDIA

Fig. 5. Expression levels of intracellular calcium efflux mediators from control (C), sedentary diabeticþmyocardial infarction (MI) (SDI),and trained-diabeticþMI (TDI) groups. Targeted bands were normalized to cardiac GAPDH. (A) Representative blots of GAPDH, Phos-pholamban (PLN), Phosho-Ser16-PLN, Phosho-Thr17-PLN, and protein phosphatase 1 (PP1); (B) PLN; (C) SERCA2/PLN ratio; (D) Phos-ho-Ser16ePLN normalized to total PLN; (E) Phosho-Thr17-PLN normalized to total PLN; and (F) PP1. *P ! .001 vs C; yP ! .001 vs SDI(n 5 8 for each group).

742 Journal of Cardiac Failure Vol. 18 No. 9 September 2012

arterial pressure, BRS, andPIV, resulted in increasedmortalityin SDI rats. However, ET improved BRS and PIV in TDI rats.Furthermore, despite that the absolute LF band was higher inTDI than in C animals, absolute HF band was also substan-tially increased, culminating in normal autonomic balance.

Separately, ET seems to improve autonomic function in di-abetic patients42 and those afterMI,21 inducing a reduction inmortality rate. Furthermore, in the present study we cannotdisregard the possibility that the improvement in autonomicfunction may have triggered an increase in functional capac-ity, represented by VO2max, and normalization of hemody-namic parameters, represented by CO and PVR, importantpredictors of risk and cardiovascular mortality.

This work has some limitations. First, although in this studycomparative data with other training groups are not presented,such as diabetics or nondiabetics post-MI, our group has beenconsistently showing the effects of ET in these experimentalconditions.Moreover, themain focus of this studywas to eval-uate the effects of ETon the association between diabetes andMI. Second, the hemodynamic and autonomic parameterswere evaluated at the end of the protocol, and comparisonswere made by including a control group in the experimentaldesign. Indeed, the direct method to record blood pressure de-pends on the catheterization of arterial vessels that are

functional during a short time period. Consequently, the bio-logical signalswere recorded only at the end of the experimen-tal period, leading to the lack of baseline values in the sameanimals at the start of the study. Third, because the experimen-tal animals (SDI and TDI) started the ET protocol with similarvalues ofMI area, LF function, andVO2max, the prediction ofsurvival (ormortality) based on these parameters becomes dif-ficult and is limited to methods used in this study.

In conclusion, ET intervention reduced cardiac andperipheral dysfunctions in diabetes associated with coronaryocclusion. These benefits were associated with preservationof cardiovascular autonomic control, improvement in func-tional capacity, and increased survival in diabetic rats afterMI.

Disclosures

None.

References

1. Wild S, Roglic G, Green A, Sicree R, King H. Global prevalence of

diabetes: estimates for the year 2000 and projections for 2030. Diabe-

tes Care 2004;27:1047e53.

Exercise Training in Diabetic Infarcted Rats � Rodrigues et al 743

2. Garcia MJ, McNamara PM, Gordon T, Kannel WB. Morbidity and

mortality in diabetics in the Framingham population sixteen-year fol-

low-up study. Diabetes 1974;23:105e11.

3. Haffner SM, Lehto S, R€onnemaa T, Py€or€al€a K, Laakso M. Mortality

from coronary heart disease in subjects with type 2 diabetes and in

nondiabetic subjects with and without prior myocardial infarction. N

Engl J Med 1998;339:229e34.

4. Solomon SD, St John Sutton M, Lamas GA, Plappert T, Rouleau JL,

Skali H, et al. Ventricular remodeling does not accompany the devel-

opment of heart failure in diabetic patients after myocardial infarction.

Circulation 2002;106:1251e5.5. Barthel P, Bauer A, M€uller A, Junk N, Huster KM, Ulm K, et al. Re-

flex and tonic autonomic markers for risk stratification in patients with

type 2 diabetes surviving acute myocardial infarction. Diabetes Care

2011;34:1833e7.6. Malmberg K, Ryd�en L, Wedel H, Birkeland K, Bootsma A,

Dickstein K, et al. Intense metabolic control by means of insulin in pa-

tients with diabetes mellitus and acute myocardial infarction (DIGA-

MI 2): effects on mortality and morbidity. Eur Heart J 2005;26:

650e61.

7. Chudyk A, Petrella RJ. Effects of exercise on cardiovascular risk fac-

tors in type 2 diabetes: a meta-analysis. Diabetes Care 2011;34:

1228e37.8. O’Connell JB. Economic burden of heart failure. Clin Cardiol 2000;

23:III6e10.

9. Esler M, Kaye D. Measurement of sympathetic nervous system activ-

ity in heart failure: the role of norepinephrine kinetics. Heart Fail Rev

2000;5:17e25.

10. Mostarda C, Rogow A, Silva IC, De La Fuente RN, Jorge L,

Rodrigues B, et al. Benefits of exercise training in diabetic rats persist

after three weeks of detraining. Auton Neurosci 2009;145:11e6.

11. Jorge L, Rodrigues B, Rosa KT, Malfitano C, Loureiro TC,

Medeiros A, et al. Cardiac and peripheral adjustments induced by

early exercise training intervention were associated with autonomic

improvement in infarcted rats: role in functional capacity and mortal-

ity. Eur Heart J 2011;32:904e12.

12. Malfitano C, Alba Loureiro TC, Rodrigues B, Sirvente R, Salemi VM,

Rabechi NB, et al. Hyperglycaemia protects the heart after myocardial

infarction: aspects of programmed cell survival and cell death. Eur J

Heart Fail 2010;12:659e67.

13. Rodrigues B, Rosa KT, Medeiros A, Schaan BD, Brum PC, De

Angelis K, et al. Hyperglycemia can delay left ventricular dysfunction

but not autonomic damage after myocardial infarction in rodents. Car-

diovasc Diabetol 2011;10:26.

14. Mostarda C, Rodrigues B, Vane M, Moreira ED, Rosa KT, Moraes-

Silva IC, et al. Autonomic impairment after myocardial infarction:

role in cardiac remodelling and mortality. Clin Exp Pharmacol Physiol

2010;37:447e52.15. Pfaffl MW. A new mathematical model for relative quantification in

real-time RT-PCR. Nucleic Acids Res 2001;29:e45.

16. Chomczynski P, Sacchi N. Single-step method of RNA isolation by

acid guanidiniumthiocyanate-phenol-chloroform extraction. Anal Bio-

chem 1987;162:156e9.

17. Bradford MM. A rapid and sensitive method for the quantitation of

microgram quantities of protein utilizing the principle of protein-dye

binding. Anal Biochem 1976;72:248e54.18. Medeiros A, RolimNP, Oliveira RS, Rosa KT,Mattos KC, Casarini DE,

et al. Exercise training delays cardiac dysfunction and prevents calcium

handling abnormalities in sympathetic hyperactivity-induced heart fail-

ure mice. J Appl Physiol 2008;104:103e9.19. Shephard RJ, Balady GJ. Exercise as cardiovascular therapy. Circula-

tion 1999;99:963e72.

20. Colberg SR, Sigal RJ, Fernhall B, Regensteiner JG, Blissmer BJ,

Rubin RR, et al. Exercise and type 2 diabetes: the American College

of Sports Medicine and the American Diabetes Association: joint po-

sition statement. Diabetes Care 2010;33:e147e67.

21. La Rovere MT, Bersano C, Gnemmi M, Specchia G, Schwartz PJ.

Exercise-induced increase in baroreflex sensitivity predicts im-

proved prognosis after myocardial infarction. Circulation 2002;

106:945e9.

22. Harthmann AD, De Angelis K, Costa LP, Senador D, Schaan BD,

Krieger EM, et al. Exercise training improves arterial baro- and che-

moreflex in control and diabetic rats. Auton Neurosci 2007;133:

115e20.23. Souza SB, Flues K, Paulini J, Mostarda C, Rodrigues B, Souza LE,

et al. Role of exercise training in cardiovascular autonomic dysfunc-

tion and mortality in diabetic ovariectomized rats. Hypertension

2007;50:786e91.

24. Rondon E, Brasileiro-Santos MS, Moreira ED, Rondon MU,

Mattos KC, Coelho MA, et al. Exercise training improves aortic de-

pressor nerve sensitivity in rats with ischemia-induced heart failure.

Am J Physiol Heart Circ Physiol 2006;291:H2801e6.

25. McElroy CL, Gissen SA, Fishbein MC. Exercise-induced reduction in

myocardial infarct size after coronary artery occlusion in the rat. Cir-

culation 1978;57:958e62.26. Yamashita N, Hoshida S, Otsu K, Asahi M, Kuzuya T, Hori M. Exer-

cise provides direct biphasic cardioprotection via manganese superox-

ide dismutase activation. J Exp Med 1999;189:1699e706.

27. Yamashita N, Baxter GF, Yellon DM. Exercise directly enhances myo-

cardial tolerance to ischaemia-reperfusion injury in the rat through

a protein kinase C-mediated mechanism. Heart 2001;85:331e6.

28. Brown DA, Jew KN, Sparagna GC, Musch TI, Moore RL. Exercise

training preserves coronary flow and reduces infarct size after

ischemia-reperfusion in rat heart. J Appl Physiol 2003;95:2510e8.

29. Wu G, Rana JS, Wykrzykowska J, Du Z, Ke Q, Kang P, et al. Exercise-

induced expression of VEGF and salvation of myocardium in the early

stage of myocardial infarction. Am J Physiol Heart Circ Physiol 2009;

296:389e95.

30. White HD, Norris RM, Brown MA, Brandt PW, Whitlock RM,

Wild CJ. Left ventricular end-systolic volume as the major determi-

nant of survival after recovery from myocardial infarction. Circulation

1987;76:44e51.

31. Pieske B. Reverse remodeling in heart failuredfact or fiction? Eur

Heart J 2004;6(Suppl D):D66e78.

32. Giannuzzi P, Temporelli PL, Corr�a U, Tavazzi L, ELVD-CHF Study

Group. Antiremodeling effect of long-term exercise training in pa-

tients with stable chronic heart failure: results of the Exercise in

Left Ventricular Dysfunction and Chronic Heart Failure (ELVD-

CHF) Trial. Circulation 2003;108:554e9.

33. Xu X, Wan W, Ji L, Lao S, Powers AS, Zhao W, et al. Exercise train-

ing combined with angiotensin II receptor blockade limits post-infarct

ventricular remodelling in rats. Cardiovasc Res 2008;78:523e32.

34. Stølen TO, Høydal MA, Kemi OJ, Catalucci D, Ceci M, Aasum E,

et al. Interval training normalizes cardiomyocyte function, diastolic

Ca2þ control, and SR Ca2þ release synchronicity in a mouse model

of diabetic cardiomyopathy. Circ Res 2009;105:527e36.

35. Periasamy M, Bhupathy P, Babu GJ. Regulation of sarcoplasmic retic-

ulum Ca2þ ATPase pump expression and its relevance to cardiac mus-

cle physiology and pathology. Cardiovasc Res 2008;77:265e73.

36. Ligeti L, Szenczi O, Prestia CM, Szab�o C, Horv�ath K, Marcsek ZL,

et al. Altered calcium handling is an early sign of streptozotocin-

induced diabetic cardiomyopathy. Int J Mol Med 2006;17:1035e43.

37. Kass DA, Bronzwaer JGF, Paulus WJ. What mechanisms underlie di-

astolic dysfunction in heart failure? Circ Res 2004;94:1533e42.

38. Trost SU, Belke DD, BluhmWF, Meyer M, Swanson E, DillmannWH.

Overexpression of the sarcoplasmic reticulum Ca(2þ)-ATPase im-

proves myocardial contractility in diabetic cardiomyopathy. Diabetes

2002;51:1166e71.

39. Kawase Y, Ly HQ, Prunier F, Lebeche D, Shi Y, Jin H, et al. Reversal

of cardiac dysfunction after long-term expression of SERCA2a by

gene transfer in a pre-clinical model of heart failure. J Am Coll Car-

diol 2008;51:1112e9.

744 Journal of Cardiac Failure Vol. 18 No. 9 September 2012

40. Maser RE, Mitchell BD, Vinik AI, Freeman R. The association be-

tween cardiovascular autonomic neuropathy and mortality in individ-

uals with diabetes: a meta-analysis. Diabetes Care 2003;26:1895e901.

41. La Rovere MT, Bigger JT Jr, Marcus FI, Mortara A, Schwartz PJ,

ATRAMI (Autonomic Tone and Reflexes After Myocardial Infarction)

Investigators. Baroreflex sensitivity and heart-rate variability in

prediction of total cardiac mortality after myocardial infarction. Lan-

cet 1998;351:478e84.

42. Pagkalos M, Koutlianos N, Kouidi E, Pagkalos E, Mandroukas K,

Deligiannis A. Heart rate variability modifications following exercise

training in type 2 diabetic patients with definite cardiac autonomic

neuropathy. Br J Sports Med 2008;42:47e54.