aeg-1 regulates retinoid x receptor and inhibits retinoid ...however, a "lxxll" motif, by...

Molecular and Cellular Pathobiology

AEG-1 Regulates Retinoid X Receptor and Inhibits RetinoidSignaling

Jyoti Srivastava1, Chadia L. Robertson1,2, Devaraja Rajasekaran1, Rachel Gredler1, Ayesha Siddiq1,Luni Emdad1, Nitai D. Mukhopadhyay3, Shobha Ghosh4, Phillip B. Hylemon5, Gregorio Gil2, Khalid Shah6,7,Deepak Bhere6,7, Mark A. Subler1, Jolene J. Windle1,8, Paul B. Fisher1,8,9, and Devanand Sarkar1,8,9

AbstractRetinoid X receptor (RXR) regulates key cellular responses such as cell growth and development, and this

regulation is frequently perturbed in various malignancies, including hepatocellular carcinoma (HCC). However,the molecule(s) that physically govern this deregulation are mostly unknown. Here, we identified RXR as aninteracting partner of astrocyte-elevated gene-1 (AEG-1)/metadherin (MTDH), an oncogene upregulated in allcancers. Upon interaction, AEG-1 profoundly inhibited RXR/retinoic acid receptor (RAR)–mediated transcrip-tional activation. Consequently, AEG-1 markedly protected HCC and acute myelogenous leukemia (AML) cellsfrom retinoid- and rexinoid-induced cell death. In nontumorigenic cells and primary hepatocytes, AEG-1/RXRcolocalizes in the nucleus in which AEG-1 interferes with recruitment of transcriptional coactivators to RXR,preventing transcription of target genes. In tumor cells and AEG-1 transgenic hepatocytes, overexpressed AEG-1entraps RXR in cytoplasm, precluding its nuclear translocation. In addition, ERK, activated by AEG-1, phosphor-ylates RXR that leads to its functional inactivation and attenuation of ligand-dependent transactivation. In nudemice models, combination of all-trans retinoic acid (ATRA) and AEG-1 knockdown synergistically inhibitedgrowth of human HCC xenografts. The present study establishes AEG-1 as a novel homeostatic regulator of RXRand RXR/RAR thatmight contribute to hepatocarcinogenesis. Targeting AEG-1 could sensitize patientswithHCCand AML to retinoid- and rexinoid-based therapeutics. Cancer Res; 74(16); 4364–77. �2014 AACR.

IntroductionRetinoid X receptors (RXRs a, b, and g) are the master

coordinators of cell growth, metabolism, and development (1,2). RXRs heterodimerize with one-third of the 48 humannuclear receptor superfamily members, including retinoic acidreceptor (RAR; ref. 3). RXR/RAR heterodimer mediates theretinoid-dependent transcription of genes involved in cellproliferation, differentiation, and apoptosis. RXRs are fre-

quently dysregulated because of altered expression and inac-tivation in various cancers, including hepatocellular carcino-ma (HCC), thyroid carcinoma, and prostate cancer (4–6),which might lead to compromised RAR functions in thesemalignancies (7–9). However, molecular mechanisms or reg-ulators that govern the differential expression and function ofRXR still remain poorly understood.

AEG-1, also known asMTDHandLYRIC, is amultifunctionaloncogene that is overexpressed in a wide variety of malignan-cies (10, 11). AEG-1 is significantly upregulated in >90% ofhuman patients with HCC, affecting diverse aspects of HCCpathogenesis, including proliferation, angiogenesis, invasion,and metastasis (12, 13). Although numerous studies haveestablished clinicopatholgic correlation of AEG-1 in cancer,the underlying molecular mechanism by which AEG-1 exertsits oncogenic functions requires further clarification. AEG-1has been shown to interact with few proteins to drive tumor-igenesis (10). To identify crucial AEG-1–interacting partners,we screened a human liver cDNA library by yeast two-hybrid(Y2H) assay (14), and identified RXR as a novel interactingpartner of AEG-1.

Using human HCC cell lines with endogenous low and highAEG-1 expression corresponding with low to high aggressivetumorigenic features, HCC cells with stable AEG-1 overexpres-sion or knockdown and hepatocytes isolated from AEG-1transgenic (Alb/AEG-1; ref. 13) and knockout (AEG-1KO)mice,we have now deciphered how AEG-1 interaction with RXRaand RXRb drives RXR-mediated functions in HCC. Our studies

1Department of Human and Molecular Genetics, Virginia CommonwealthUniversity, Richmond, Virginia. 2Department of Biochemistry, VirginiaCommonwealth University, Richmond, Virginia. 3Department of Biostatis-tics, Virginia Commonwealth University, Richmond, Virginia. 4Departmentof Internal Medicine, Virginia Commonwealth University, Richmond, Virgi-nia. 5Department of Microbiology and Immunology, Virginia Common-wealth University, Richmond, Virginia. 6Department of Radiology, Massa-chusetts General Hospital, Harvard Medical School, Boston, Massachu-setts. 7Department of Neurology, Massachusetts General Hospital, Har-vard Medical School, Boston, Massachusetts. 8Massey Cancer Center,Virginia Commonwealth University, Richmond, Virginia. 9VCU Institute ofMolecular Medicine (VIMM), Virginia Commonwealth University, Rich-mond, Virginia.

Note: Supplementary data for this article are available at Cancer ResearchOnline (http://cancerres.aacrjournals.org/).

CorrespondingAuthor:DevanandSarkar,MasseyCancerCenter, VirginiaCommonwealth University, 1220 East Broad Street, Room 7044, P.O. Box980035, Richmond, VA 23298. Phone: 804-827-2339; Fax: 804-628-1176;E-mail: [email protected]

doi: 10.1158/0008-5472.CAN-14-0421

�2014 American Association for Cancer Research.

CancerResearch

Cancer Res; 74(16) August 15, 20144364

Cancer Research. by guest on August 22, 2020. Copyright 2014 American Association forhttps://bloodcancerdiscov.aacrjournals.orgDownloaded from

https://bloodcancerdiscov.aacrjournals.org

uncover the mechanism by which AEG-1 upregulation affectsRXR inactivation and retinoid response contributing to carci-nogenesis. Moreover, AEG-1 knockdown and chemical inhibi-tion of AEG-1–mediated signaling enhances the efficacy ofretinoids by sensitizing the cells, leading to inhibited tumorgrowth in in vitro and xenograft models. AEG-1 inhibitionmight be an effective strategy to augment effects of retinoidsin patients with diverse cancer indications.

Materials and MethodsGeneration of Alb/AEG-1 and AEG-1KO miceGeneration and characterization of a hepatocyte-specific

AEG-1 transgenic mouse (Alb/AEG-1) in B6/CBA backgroundhave been described previously (13). AEG-1KO mouse wasgenerated in C57B6/129Sv background and the procedure isdescribed in detail in the Supplementary Information. Allanimal studies were approved by the Institutional AnimalCare and Use Committee at Virginia Commonwealth Univer-sity, and were conducted in accordance with the AnimalWelfare Act, the PHS Policy on Humane Care and Use ofLaboratory Animals, and the U.S. Government Principles fortheUtilization andCare of Vertebrate Animals Used in Testing,Research, and Training.

Tissue cultureHepG3, QGY-7703, THLE3, Hep3B, HuH7, and HEK-293 cells

were cultured as reported earlier (12). Generation of Hep-PC-4(control clone), Hep-AEG-1–14 (a C-terminal HA-tagged AEG-1–overexpressing clone), Hep-CTRLsi (control siRNA-expres-sing clone), and Hep-AEG-1si (expressing AEG-1 shRNA) inHepG3 background has been described before (12, 14). A C-terminal HA-tagged AEG-1 construct mutated at the LXXLLmotif was stably expressed in HepG3 cells, Hep-AEG1-Lxxmut,and was generated following the same protocol as for Hep-AEG1–14 cells. The clones were selected and maintained inhygromycin containing DMEM.

Primary cell culture and viability assayPrimary mouse hepatocytes were isolated from wild-type

(WT; B6/CBA), Alb/AEG-1, WT (C57B6/129Sv), and AEG-1KOmice in the Cell and Molecular Biology Core in VCU asdescribed previously (13) and were plated on collagen-coateddishes (BD BioCoat collagen type I; BD Biosciences) andcultured in Williams E. medium (SIGMA) containingNaHCO3, L-glutamine, insulin (1.5 mmol/L) and dexametha-sone (0.1 mmol/L). For MTT assays, a total of 1.0 to 1.5 � 104

mouse hepatocytes were plated in each well of a 96-well plateand treated with retinoids and rexinoids for respective timepoints as mentioned in the figure legends of Fig. 2 andSupplementary Fig. S3. Cell viability was determined by stan-dard MTT assay as described previously (12, 15, 16).

Transient transfection and luciferase reporter assaysTransfections and luciferase assays were done according to

the manufacturer's protocol for human HCC cells as describedelsewhere (14, 17, 18) andprimary hepatocytes (SupplementaryInformation). Each experiment was performed in triplicatesand repeated three times to calculate means and SE.

Total RNA extraction, cDNA preparation, and real-timePCR

Total RNA was extracted from human HepG3 cells, liversand hepatocytes of WT (B6/CBA and C57B6/129Sv), Alb/AEG-1, andAEG-1KOmouse using theQIAGENmiRNAeasyMini Kit(QIAGEN). cDNA preparation was done using the ABI cDNASynthesis Kit. Real-time polymerase chain reaction (RT-PCR)was performed using an ABI ViiA7 fast real-time PCR systemand TaqMan gene-expression assays according to the manu-facturer's protocol (Applied Biosystems). The best availableTaqMan primers–probes spanning two exons for RARB,CYP26A1, NROB2, CRABP2, FOXA1, TLL1, RXRA, and RXRB forhuman as well as mouse were purchased from ABI.

Chromatin immunoprecipitation assaySheared chromatin was prepared following the manufac-

turer's instructions and was immunoprecipitated using RXRa(Santa Cruz Biotechnology), AHH3 (Acetyl Histone H3) andSRC-1 (steroid receptor coactivator-1; Cell Signaling Technol-ogy) antibodies. The eluted DNA and inputs were subjected toPCR for RARB and HOXA1 genes. For RARB2 (sense: 50AGCT-CTGTGAGAATCCTGGGAG30, antisense: 50TAGACCCTCCTGCCTCTGAACA30) andHOXA1 (sense: 50CTGGGGCAATCAG-ATTCAAACC30, antisense: 50CTCAGATAAACTGCTGGGAC-TC30) primers were used for PCR amplification using the TaqPCRx Polymerase Kit (Invitrogen), following the manufac-turer's instructions. These PCRs were performed withoutenhancers and repeated at least three times.

Nude mice xenograft studiesSubcutaneous xenografts were established in flanks of

athymic nude mice using QGY-7703 cells (5 � 105). After1 week, these mice were injected with all-trans retinoic acid(ATRA; 10 mg/kg) or DMSO i.p., a total of seven injections,once every alternative day. One week after the final treat-ment, mice were sacrificed. Tumor volume was measuredtwice weekly with a caliper and calculated using the formula

p=6�larger diameter�ðsmaller diameterÞ2. Tumor sam-ples were immunostained using antibodies against AEG-1,PCNA (Cell Signaling Technology), and cleaved caspase-3(Cell Signaling Technology). All experiments were performedwith 6 to 8 mice in each group and were repeated at least twotimes.

Statistical analysisData were represented as mean � SEM and analyzed for

statistical significance using one-way ANOVA followed by theNewman–Keuls test as a post hoc test. A P value of <0.05 wasconsidered as significant.

ResultsIdentification of RXRa and RXRb as AEG-1–interactingpartners

AEG-1 is a 582 amino acid (a.a.) protein with a transmem-brane domain (51–72 a.a.) and multiple nuclear localizationsignals. A number of AEG-1–interacting proteins have beenidentified that interact with its large C-terminal region (14, 17).

AEG-1 Regulates Retinoid X Receptor to Drive HCC

www.aacrjournals.org Cancer Res; 74(16) August 15, 2014 4365



Figure 1. AEG-1 interactswithRXRa andRXRb abrogating RXR-dependentRAREpromoter activity. A, lysates fromQGY-7703 cellswere immunoprecipitated(IP) with anti–AEG-1 antibody andwere immunoblotted (IB orWB)with anti-RXRa and anti-RXRb antibodies, and vice versa. B, HEK-293 cells were transientlytransfected with Myc-tagged hRXRa or hRXRb with control pcDNA3.1 vector, and HA-tagged full-length AEG-1 (AEG-1FL, 1–582 a.a.), AEG-1 deletionconstructs: C1 (1–513 a.a.) and N1 (71–582 a.a.), and AEG-1 LXXLL-mutant construct. After 48 hours, lysates were immunoprecipitated with anti-Mycantibody and IB conducted using anti-HA antibody, and vice versa. Cells were also transfected with HA-tagged AEG-1 with control PCMV6 vector,hRXRa (1–461 a.a.), RXRa deletion constructs: RXRaDDBD/LBD (1–127 a.a.), RXRaDLBD (1–208 a.a.), and RXRaDAFD/DBD (226–461 a.a.). After 48 hours,lysates were immunoprecipitated using Myc and IB with HA antibodies, and vice versa. Long exposure of the blot showed nonspecific bands inthe lanes representing RXR deletionmutants, whichmight be because of nonspecific activity of the secondary antibody. C, lysates from control HepG3 (Hep-PC-4), AEG-1–overexpressing (Hep-AEG-1–14), and AEG-1 knockdown (Hep-AEG-1si) clones were subjected to immunoprecipitation using anti-RXRa andanti-RXRb antibodies, and IB with anti–AEG-1 antibody. D, representative fluorescent confocal micrographs showing colocalization of AEG-1 and RXRa/RXRb in HepG3 cells transfected with control (CTRLsi) or AEG-1 (AEG-1si) siRNA. E–H, cells were transfected with RARE luciferase reporter plasmid(RARE.Luc) and 48 hours posttransfection luciferase assay was performed. (Continued on the following page.)

Srivastava et al.

Cancer Res; 74(16) August 15, 2014 Cancer Research4366



However, a "LXXLL" motif, by which coactivators and core-pressors interact with nuclear receptors (19), is located in theNH2-terminal region of AEG-1, suggesting that this regionmight be important for AEG-1 functions. On the basis of this,a human liver cDNA library was screened by Y2H assay usingthe NH2-terminal 1–57 a.a. of AEG-1 as bait, which lead toidentification of RXRb as an AEG-1–interacting protein (Sup-plementary Table S1). Coimmunoprecipitation (Co-IP) assaysusing lysates from the human HCC cell line QGY-7703 dem-onstrated pull-down of RXRa and RXRb by anti–AEG-1 anti-body and vice versa, confirming the interaction (Fig. 1A).Deletion of a.a. 1 to 70 from N-terminus (N1) of AEG-1 and

mutations in its LXXLL motif prevented the interaction ofAEG-1 with RXRa and RXRb (Fig. 1B). However, this interac-tion was maintained in full-length AEG-1 or upon deletion ofC-terminal region (1–513), validating that RXRs indeed interactwith AEG-1 at its LXXLL motif. Further to check at whichdomain of RXRAEG-1 interactswith, wemade domain-specificdeletion constructs of RXRa (Supplementary Fig. S1). Deletionof the C-terminus ligand-binding AF-2 domain of RXRaresulted in the loss of interaction, whereas deletion of itsNH2-terminus AF-1 and DNA-binding domain (DBD) did notaffect the interaction of AEG-1 with RXRa (Fig. 1B). Thesefindings demonstrated that AEG-1 binds RXRa at its ligand-binding domain (LBD), the same domain inwhich coactivatorsand corepressors also bind.Co-IP assays using stable clones of human HCC HepG3 cells

overexpressing AEG-1 (Hep-AEG-1–14), AEG-1 knockdown(Hep-AEG-1si), and control clone Hep-PC-4 cells (12) con-firmed that the interaction of AEG-1 with RXRa and RXRb isindeed AEG-1–dependent (Fig. 1C). Double immunofluores-cence analysis in HepG3 cells detected colocalization of AEG-1with RXRa and RXRb predominantly in the nuclear and peri-nuclear regions, which was not observed upon AEG-1 knock-down (Fig. 1D).

RAR/RXR–mediated promoter activities are inhibited byAEG-1RAR/RXR binds to retinoic acid response elements (RARE)

on the target promoters. Basal luciferase reporter activityof RARE-containing plasmid, pGL3–RARE–luc was decreasedin Hep-AEG-1–14 clone and increased in Hep-AEG-1si cellscompared with control Hep-PC-4 and Hep-CTRL-si clone,respectively (Fig. 1E). RARE activity remained suppressedeven upon treatment with different retinoic acid/retinoids(RA) and rexinoids (RXA) in Hep-AEG-1–14 cells, whereas itwas significantly augmented in Hep-AEG-1si cells (Fig. 1E,Supplementary Fig. S2A). As a corollary, both basal andligand-dependent RARE activity was significantly inhibited inAlb/AEG-1 hepatocytes (Fig. 1F) and amplified in AEG-1KOhepatocytes (Fig. 1G).

HepG3 cells express low levels of AEG-1 and are nontumori-genic in nudemice, whereas QGY-7703 cells express high levelsof AEG-1 that generate very aggressive tumors (12). Conse-quently, both basal and ligand-dependent RARE activities weremarkedly less in QGY-7703 cells as compared with HepG3 cells(Fig. 1H). Transient overexpression of AEG-1 in HepG3 andHEK-293 cells inhibited, whereas transient knockdown of AEG-1 by siRNA augmented ligand-dependent RARE activity (Sup-plementary Fig. S2B).

Transient expression of full-length AEG-1 that interacts withRXRs decreased RARE activity, whereas AEG-1 deletion con-structs N1 and N2 (lacking NH2-terminal 70 and 100 a.a.,respectively), and LXXLL-mutant expression construct failedto inhibit RARE activity in HepG3 (Fig. 1I) or HEK-293 cells(Supplementary Fig. S2C). AEG-1 expression level in the cellsused in this study is shown in Fig. 1J. Taken together, AEG-1–RXR interaction affected RXRs negatively and AEG-1 upregula-tion led to a decrease in RXR-dependent RARE reporteractivity. These activities were increased upon inhibiting thisinteraction, suggesting that AEG-1 provides a homeostaticbalance to RXR functions.

AEG-1 provides protection from retinoid- and rexinoid-induced inhibition of cell growth

Because the RAR/RXR pathway mediates antiproliferativeeffects of retinoids and rexinoids, we determined the extent towhich AEG-1 might provide protection. Using eight differentRA and RXA and their synthetic analogs at multiple doses(Supplementary Table S2), we documented that Hep-AEG1–14cells displayed 2- to 3-fold resistance and Hep-AEG-1si cellsshowed enhanced sensitivity to different RA/RXA treatment atdifferent doses up to 96 hours, when compared with controlHep-PC-4 cells (Fig. 2A; Supplementary Fig. S3A–S3H). Colonyformation assays also confirmed marked protection from RA-and RXA-mediated inhibition of cell growth in Hep-AEG-1–14cells and potentiation of cell growth inhibition in Hep-AEG-1sicells (Fig. 2B). Similarly, QGY-7703 cells with basal high AEG-1expression displayed resistance toward RA/RXA as comparedwith HepG3 (Supplementary Fig. S3Q).

WT hepatocytes showed <25% cell growth inhibition at 48hours, whereas only <5% in Alb/AEG-1 hepatocytes, even athigh doses of different RA/RXA (data not shown). At 96 hours,WT hepatocytes showed variable cell viability with differentdoses of retinoids and rexinoids. However, Alb/AEG-1 hepa-tocytes were noticeably protected from inhibition of cellgrowth with >80% viability (Fig. 2C). Conversely, AEG-1KOhepatocytes demonstrated marked decrease in cell growthwith retinoids and rexinoids at 48 to 96 hours in a dose-dependent manner (Fig. 2D; Supplementary Fig. S3I–S3P). Wenext testedwhetherAEG-1 had any effect on retinoid-mediatedkilling in other cancer cells such as human acute myelogenous

(Continued.) RAREactivitywasmeasured in untreated (UT) or upon treatmentwith 5mmol/L ATRA, 2mmol/L 9CRA, 400-nmbexarotene or 1mmol/L TTNPB for24 hours in PC-4, AEG1–14, CTRL-si, and AEG-1si cells (E), WT and Alb/AEG-1 (F), WT versus AEG-1KOmice hepatocytes (G), and HepG3 versus QGY7703cells (H). I, RARE activity was measured 48 hours after cotransfection of pcDNA3.1, AEG-1FL, AEG-1 deletion mutants N1 and N2 (101–582), andAEG-1 LXXLL-mut constructs in HepG3 cells. J, expression level of AEG-1 in different cells with AEG-1 overexpression or knockdown. A–C, 5%of cell lysateswere used as inputs. F–G, the luciferase data represent four different sets of mice, respectively. All data, mean� SEM of three independent experiments withsignificant P values denoted in the respective plots; �, P < 0.05; ��, P < 0.001.





leukemia (AML) HL-60 cells. Notably, profound resistance wasobtained with AEG-1 transient expression, and decreased cellviability was observed with AEG-1 knockdown upon treatmentof different RA/RXA (Fig. 2E).

AEG-1 inhibits expression of retinoids target genesRelative mRNA levels were measured for representative

RAR/RXR target genes, RAR beta (RARB), Cytochrome P45026A1 (CYP26A1), nuclear receptor subfamily 0, group B,

Figure 2. AEG-1 protects cells from retinoid- and rexinoid-induced apoptosis. A–D, cell viability of PC-4, AEG1–14, and AEG-1si cells was determinedupon treatment with the indicated RA or RXA for 48 hours by MTT assay (A) and by colony formation assay after treatment with 9CRA, ATRA, orTTNPB at the indicated concentrations in mmol/L (B). Colonies were scored after 12 days. Cell viability in WT versus Alb/AEG-1 at 96 hours (C) and inWT versus AEG1-KO mice hepatocytes at 48 hours (D) with indicated RA/RXA. E, HL-60 cells were transiently transfected with pcDNA, AEG1-FL, orsiAEG-1. Cell viability was detected upon treatment with the indicated drugs for 48 hours posttransfections. All data, mean � SEM of three independentexperiments; �, P < 0.02; ��, P < 0.001.

Srivastava et al.




member 2 (NR0B2), Homeobox A1 (HOXA1), cellular retinoicacid–binding protein 2 (CRABP2), and Forkhead box proteinA1 (FOXA1). Hep-AEG-1–14 cells showed significant down-regulation of all these genes at basal level and post 9-cis reinoicacid (9CRA) or ATRA treatment, when compared with controlHep-PC-4 (Fig. 3A and Supplementary Fig. S4A). Similardecrease and corresponding increase in the above-mentionedgenes were also observed in Alb/AEG-1 and AEG-1KO hepa-tocytes, respectively (Fig. 3B and C and Supplementary Fig.S4B–S4C). The RA negatively regulated gene, Tll1 showedsignificant upregulation in Alb/AEG-1 hepatocytes with orwithout ligand, and a reduction in AEG-1KO hepatocytes atbasal level (Supplementary Fig. S4B–S4C). Downregulation ofRA-responsive gene, RARB, which determines cell growth andapoptosis, was confirmed in additional Alb/AEG-1 mice (Sup-plementary Fig. S4D).

AEG-1 impairs the RXR-binding and coactivatorrecruitment to RXR/RAR target genesChromatin immunoprecipitation (ChIP) assays were per-

formed using the RA target genes RARB and HOXA1. In theabsence of ligand, significantly decreased and increasedrecruitment of RXRa was observed in both target gene pro-moters in Hep-AEG-1–14 and Hep-AEG-1si cells, respectively,as compared with Hep-PC-4 cells (Fig. 3D and SupplementaryFig. S4E). Similar effects were also observed for (AHH3) andSRC-1. Upon treatmentwith 9CRAorATRA, RXRa recruitmentdid not change substantially, whereas both AHH3 and SRC-1recruitment was significantly augmented in all three celllines. However, ligand-induced recruitment of AHH3 andSRC-1 was notably less in Hep-AEG-1–14 cells and more inHep-AEG-1si cells (Fig. 3D and Supplementary Fig. S4E). Tocheck whether AEG-1 interferes with DNA-binding propertyof RXR, EMSA was performed in a cell-free system usingin vitro translated RARb, RXRa, and AEG-1 using a DR5 RAREresponse element as probe. RARb/RXR heterodimer efficientlybound to DNA in the absence or presence of ATRA, which wasnot affected by addition of AEG-1 (data not shown). Thesefindings suggest that AEG-1 does not interfere with DNA-binding or heterodimerization of RXR with its partners ratherit might modulate coactivator/corepressor recruitment. Thedecreased recruitment of RXRa to RARB or HOXA1 promoterin Hep-AEG-1–14 cells might be due to reduced levels ofnuclear RXRs in these cells, a hypothesis we will address insubsequent sections.Next, we measured RARE reporter activity in control and

AEG-1–overexpressing cells with coexpression of a corepressorSilencing mediator for retinoid/thyroid hormone receptors(SMRT) or a coactivator, SRC-1. SMRT overexpression led toa minimal but significant reduction in RARE activity (Fig. 3E).Interestingly, SRC-1 overexpression profoundly elevated RAREactivity in Hep-AEG-1–14 cells similar to Hep-PC-4 cells with-out SRC-1 overexpression (Fig. 3E). Histone deacetylase inhib-itor, Trichostatin A (TSA), markedly induced basal RAREactivity in a dose-dependent manner (Fig. 3F). Collectively,these findings suggest that overexpressed AEG-1 competeswith the coactivators to bind RXR by interacting through theLXXLL motif maintaining histones in a deacetylated state.

AEG-1 upregulation leads to cytoplasmic translocationof RXRs

Co-IP analysis using nuclear and cytoplasmic fractions dem-onstrated that AEG-1 interaction with RXRs mainly occurs inthe cytoplasm of Hep-AEG-1–14 cells and in the nucleus incontrol cells (Fig. 4A). Immunofluorescence studies revealedthat AEG-1 resides mainly in the nucleus of control Hep-PC-4cells and WT hepatocytes, which show low AEG-1 expression(Fig. 4B and C and Supplementary Fig. S5). However, in Hep-AEG-1–14 cells and Alb/AEG-1 hepatocytes, AEG-1 displayspredominantly cytoplasmic localization (Fig. 4B and C andSupplementary Fig. S5), which has been attributed to theenhanced monoubiquitination and stabilization (13, 20). Inter-estingly, AEG-1 overexpression and cytoplasmic translocationalso resulted in the coordinated translocation of RXRa andRXRb from nucleus to the cytoplasm in Hep-AEG-1–14 cells.Although in Hep-PC-4 cells, AEG-1/RXR interaction took placepredominantly in the nucleus (Fig. 4B and Supplementary Fig.S5). As nuclear receptors shuttle between the cytoplasmand thenucleus, we determined whether cytoplasmic retention of RXRsmight depend on ligand. Treatment with 9CRA or ATRA atvarious doses up to 24 hours, failed to induce nuclear translo-cation of RXRa and RXRb in AEG-1–overexpressing cells,suggesting that AEG-1 entraps RXRs into cytoplasmobstructingtheir nuclear import (Fig. 4B and Supplementary Fig. S5).

In WT hepatocytes, RXRa is distributed throughout thecell but more in the nucleus, and RXRb showed universalstaining. 9CRA treatment induced the import of RXRa andRXRb into the nucleus (Fig. 4C). In contrast, both RXRa andRXRb were mostly cytoplasmic in Alb/AEG-1 hepatocytesand 9CRA treatment did not alter this profile significantly(Fig. 4C). Dominant to complete cytoplasmic localization ofAEG-1 and RXRs was dependent upon AEG-1 expressionlevel (Supplementary Fig. S6A–S6E). Cytoplasmic transloca-tion of AEG-1 and RXR was not affected upon culturing themon collagen–fibronectin matrix and synchronization (Sup-plementary Fig. S6F–S6G).

Double immunofluorescence analysis of AEG-1 with RXRaand RXRb was performed using HepG3 stable clone over-expressing AEG-1 mutated at the LXXLL motif (Hep-AEG1-LXXmut). Interestingly, both RXRa and RXRb remain nuclearand do not translocate to cytoplasm in these cells (Fig. 4D),confirming that AEG-1 indeed brings RXRs to the cytoplasm,which is prevented upon losing the interaction.

AEG-1 inducesphosphorylationand inactivationofRXRsby activating ERK and p38MAPK signaling

Both RXRa andRXRb levels were significantly higher inHCCcells compared with normal immortal human hepatocytes(THLE-3) cells (Fig. 5A). Moreover, truncated form of RXRa(tRXRa, arrow in Fig. 5A) accumulated more in different HCCcell lines. RXRa and RXRb were also upregulated in AEG-1–overexpressing systems: Hep-AEG-1–14 cells and Alb/AEG-1hepatocytes and downregulated in AEG-1 knockdown cells(HepAEG-1si; Fig. 5B and Supplementary Fig. S7A). However,their mRNA levels were reduced in Hep-AEG-1–14 cells andAlb/AEG-1 hepatocytes (Fig. 5C and Supplementary Fig. S7B–S7C). These findings suggested potential posttranslational





Srivastava et al.




modification of RXRs by AEG-1. Interestingly, phosphorylationof RXRa and RXRb at serine residues was conspicuouslyinduced in different AEG-1 overexpression systems: Alb/AEG-1 hepatocytes, QGY-7703, and Hep-AEG-1–14 cells (Fig.5D and E). Phosphorylation was inhibited in Hep-AEG-1si cellsin comparison with control cells, which might reflect thereduction of total RXR (Fig. 5D). More phosphorylated RXRawas detected in both the nucleus and cytoplasm of Hep-AEG-1–14 cells although phospho forms of tRXRa and RXRbremained prevalent in the nucleus (Supplementary Fig.S7D). Inhibition of nuclear phosphorylated RXRa and RXRbin Hep-AEG-1si cells might explain increased RARE reporteractivity, expression of RAR/RXR target genes, and apoptosis(Fig. 1 and 2).Different kinases have been reported to phosphorylate

RXRa in HCC (21–23). We tested which kinase might beresponsible for AEG-1–dependent RXR phosphorylation inHCC cells by using specific inhibitors (Supplementary TableS2). Inhibition of PKA, PKC, JNK, ERK, and p38MAPK led todownregulation of pRXRa and p-tRXRa in AEG-1–specificmanner (Fig. 5F and G and Supplementary Fig. S7E–S7G).pRXRb was also reduced to a greater extent in Hep-AEG1–14cells upon inhibiting PI3K, JNK, ERK, p38MAPK, and TK (Fig.5F and G and Supplementary Fig. S7E–S7G). RXRDN anti-body detecting all isotypes of RXR showed none to minimaleffect of the inhibitors on the full-length RXR. However,RXRa-specific antibody detected inhibition of both pRXRaand p-tRXRa (Fig. 5F and G). Moreover, combined inhibitionof PI3K and p38MAPK synergistically decreased phosphor-ylation of tRXRa.RARE activity was significantly augmented in AEG-1 sta-

ble and transient overexpressing cells upon inhibition ofERK, PKA, and p38MAPK (Fig. 5H and Supplementary Fig.S8A–S8B). ERK has been shown to phosphorylate RXRa atthe serine 260 residue in HCC, and inhibition of ERK-mediated RXR phosphorylation led to most increase in RAREactivity in a dose- and AEG-1–dependent manner (Supple-mentary Fig. S8C). We also checked the expression ofrepresentative RXR/RAR target genes; RARB, HOXA1,CYP26A1, and NR0B2 upon inhibition of various kinases(Fig. 5I and Supplementary Fig. S8D). ERK inhibitionretrieved the expression of all the genes at various extentsin AEG-1–overexpressing cells. PKA and p38MAPK inhibi-tors specifically increased the expression of RARB andHOXA1/FOXA1, respectively. Notably, siRNA mediatedknockdown of AEG-1 in HepG3 (�1.3-fold) and QGY-7703cells (�2-fold) and RXRa overexpression in only QGY-7703cells augmented ligand-dependent RARE activity (Supple-

mentary Fig. S8E), confirming the AEG-1 caused inactivationof RXR in tumorigenic HCC cells, which was significantlyretrieved by AEG-1 knockdown or RXRa overexpression.

Synergistic antitumor effect of AEG-1 inhibition andATRA administration in HCC xenografts in nude mice

The in vitro growth-suppressing function of retinoids uponAEG-1 knockdown was extended by in vivo assays. Because,QGY-7703 cells develop aggressive tumors in nude mice, wetransduced them with none, control lentivirus–expressingscrambled shRNA (shControl) and AEG-1 knockdown lentivi-rus (shAEG-1; ref. 24). These cells were then subcutaneouslyxenografted into the flanks of male athymic nude mice. Oneweek after implantation, when tumor is well established, themice were treated with i.p. injections of DMSO (vehicle) orATRA (10-mg/kg body weight). In DMSO-treated-only andDMSO-treated shControl groups, tumor gradually increasedin size as reflected by tumor volume measured twice a week,and tumor weight at the final day of experiment (Fig. 6A–C). InATRA-treated groups, only two of the 8mice showed reductionin tumor growth, which was not significant. In the shAEG-1DMSO–treated animals, the tumor growth was significantlysuppressed as compared with controls and the ATRA-treatedgroup. Interestingly, the shAEG-1 ATRA-treated animals grewnone to minimal tumors in size and weight (Fig. 6A–C). Threeof 8 shAEG-1 ATRA–treated mice showed no tumor or smallertumor than 0 day of treatment. Their combination effect wascalculated as 0.78 (<1 ¼ synergistic), indicating synergism.Histologic analysis of the tumors revealed significantlyincreased necrosis/apoptosis in the shAEG-1 ATRA–treatedgroup compared with others (Fig. 6D top). Immunohistochem-ical studies confirmed knockdown of AEG-1 in shAEG-1 groups(Fig. 6D and E). In addition, there was marked downregulationof the cell proliferating marker PCNA and upregulation ofapoptosis marker cleaved caspase-3 in tumors derived fromshAEG-1ATRA, shAEG-1, andATRA, respectively, as comparedwith the DMSO control and shControl DMSO groups (Fig. 6Dand E).

DiscussionMolecular mechanism(s) by which RXR controls diverse

cellular functions, including cell proliferation andmetabolism,has been thoroughly investigated. However, only a few reportshave addressed the molecular regulators of RXR itself, whichmight be indispensable in evaluating and improving retinoid-and rexinoid-based chemotherapy. Our current observationssuggest that AEG-1 negatively regulates functions of RXRs byinteracting through the LXXLL motif at the AF-2 ligand-

Figure 3. AEG-1 suppresses RAR/RXR target genes by interfering with RXR binding and coactivators recruitment to the gene promoters. A–C, relative mRNAlevels of representative RAR/RXR target genes in PC-4 and AEG1–14 UT cells (left), and that of RARB, HOXA1, and NROB2 (A), in WT and Alb/AEG-1 (B),and WT and AEG-1KO mice hepatocytes (C) in untreated (left plots) or treated with 2 mmol/L 9CRA or 5 mmol/L ATRA (right plots). D, ChIP assayswere performed using anti-RXRa, anti-Acetyl Histone H3, and anti–SRC-1 antibodies in PC-4, AEG1–14, AEG-1si cells with or without 9CRA and ATRA, andPCR primers amplifying the promoter regions of RARB. The graphical representation for densitometry quantification of the immunoprecipitated RARBpromoter has been given on the right. E–F, RARE activity in PC-4, AEG1–14, and AEG-1si cells cotransfected with pcDNA3.1, SMRT, or SRC-1 expressionplasmids with or without ligands (E), or treated with indicated doses (in nmol/L) of TSA (F). Data, mean � SEM of three independent experiments withsignificant P values indicated in respective plots or �, P < 0.05; ��, P < 0.001.





Figure 4. AEG-1 regulates intracellular localization of RXRs. A, nuclear and cytoplasmic extracts prepared from PC-4 and AEG1–14 cells were subjectedto immunoprecipitation (IP) using anti-RXRDN (that recognizes all RXR isotypes), anti-RXRa, and anti-RXRb antibodies and WB with anti–AEG-1antibody. B–D, representative confocal photomicrographs to analyze colocalization of AEG-1 and RXRs using anti–AEG-1, anti-RXRa, and anti-RXRbantibodies in PC-4/AEG1–14 cells (B) and WT/Alb/AEG-1 mice hepatocytes (C) with no or 9CRA treatment for 2 hours; and in HepG3 cellsstably overexpressing LXXLL-mutated AEG-1 (D). C, multinucleation is a common feature of primary mouse hepatocytes, which mostly have two nucleiand frequently one to four nuclei.

Srivastava et al.




Figure 5. AEG-1 inducesRXRphosphorylationbyactivatingERK,p38MAPK, andPKAsignaling.A, expressionanalysis ofRXRa andRXRb in differentHCCcell linesand human immortalized hepatocytes THLE3 cells. B–C, expression of RXRa, RXRb, RXRg , and AEG-1 in human Hep-PC-4 versus Hep-AEG1–14 cells and WTversus Alb/AEG-1mice hepatocytes at protein level detected withWestern blot analysis (B) and at mRNA levels by qPCR (C). D–E, phosphorylation levels of RXRaandRXRbwere determined by immunoprecipitating cell lysates with anti-RXRDN, anti-RXRa, and anti-RXRb antibodies followed byWBwith anti–phospho-serine(p-serine) antibody and vice versa for WT versus Alb/AEG-1 mice hepatocytes, Hep-PC4 versus Hep-AEG-1 si (D), HepG3 versus QGY-7703, and PC-4 versusAEG1–14 cells (E). F–G, decreased levels of phosphorylated RXRa and RXRb in Hep-AEG1–14 cells after treatment with inhibitors of the indicated kinases.Immunoprecipitation (IP) was performedwith anti-RXRDNandanti-RXRa and anti-RXRb antibodies andWBwas performed for p-serine. Graphical representationsof densitometry quantification are shown in G. Cells were treated with different inhibitors in DMEM containing 1% charcoal-stripped FBS for 24 hours. Forconcentrations used and detailed information, please see Supplementary Table S2. H and I, RARE activity (H), expression of representative RXR/RAR target genesRARB andHOXA1 (I) inHep-PC-4 andHep-AEG1–14 cells after inhibition of different kinases. F–I, selective inhibitors for PI3K, ERK, JNK, andTKwere used at final15 mmol/L concentration and PKA, PKC, and p38 MAPK at 2 mmol/L. Data, mean � SEM of three independent experiments; �, P < 0.02; ��, P < 0.001.





binding domain of RXR, thereby interfering with coactivatorrecruitment and subsequent histone acetylation. AEG-1 is ahighly evolutionary conserved gene present only in vertebrates.In rodents, the "LXXLL" motif is present as "LRELL" whereas in

primates, it is present as "LREML." This change from leucine tomethionine in primates might affect binding affinity betweenAEG-1 and RXRs and determine the strength, degree, andduration of inhibition.

Figure 6. Combination of AEG-1 knockdown and ATRA treatment synergistically inhibits tumor growth in nude mice. Subcutaneous xenografts wereestablished inathymicnudemice, usingQGY-7703cells, either untreatedor transducedwith lenti.shControl or lenti.shAEG-1.A, representativephotographoftumor-bearingmice at the end of the study. B andC,measurement of tumor volume at the indicated time points (B) and tumorweight at the end of study (C). D,tumor sections were stained for hematoxylin and eosin (H&E) and immunostained for AEG-1, PCNA, and cleaved caspase-3. E, graphical representation forquantification of immunostaining of four representative images for each group. Data, mean � SEM; �, P < 0.05; ��, P < 0.001.


Srivastava et al.



Figure 7. The schematic model illustrating the molecular mechanism by which AEG-1 regulates RXR signaling. In the second plot, 1, in normal cells, AEG-1 isadequately expressed and resides in the nucleus influencing histone (de)acetylation. As AEG-1 expression level increases, it potentially inhibits RXRs in threedifferent manners (third and fourth plots); 1, AEG-1 preferentially entraps RXR into cytoplasm; 2, AEG-1 induces phosphorylation of RXRs; 3, also, remainingAEG-1 in nucleus modulates the binding of coactivators or corepressors.





We document that AEG-1 not only inhibits RXR-mediatedtranscriptional regulation, but also induces RXR phosphory-lation via ERK and p38MAPK pathways, which are known to beactivated by AEG-1 (12). Phosphorylated RXRs are resistant toubiquitin proteasome–mediated degradation and act domi-nant negatively for normal RXR functions by abrogating het-erodimerization and coactivator(s) recruitment (25, 26), whichis indispensable to drive the oncogenic functions. Therefore,inhibition of these molecules suppressed AEG-1–mediatedphosphorylation of RXR and rescued transcriptional activationof genes regulating cell proliferation in HCC. RXRa is proteo-lytically degraded generating N-terminally truncated 44-kDareceptor (tRXRa) that interacts with the p85a subunit of PI3Kand activates protumorigenic PI3K/AKT signaling (27). Acti-vation of the PI3K/Akt pathway regulates AEG-1–mediatedresistance to apoptosis (28), and AEG-1–induced tRXRa gen-eration might lead to PI3K/Akt activation.

Ourfindings reveal that overexpressed cytoplasmicAEG-1 intumorigenic cells leads to dominant to exclusive cytoplasmictranslocation of RXRa and RXRb. RXRs shuttle between thecytoplasmic and nuclear compartments during certain stagesof development, in response to ligand, differentiation, apopto-sis, and inflammation (29–32). Furthermore, tRXRa has beenshown to be exclusively cytoplasmic (27). Overall, RXRs mightbe regulated by AEG-1 through histone (de)acetylation innormal cells and via cytoplasmic entrapping and phosphory-lation in human cancer cells. It should be noted that treatmentwith ERK inhibitor increased RA-dependent gene expressionbut did not increase nuclear translocation of RXR (data notshown). We observed phosphorylation of both nuclear andcytoplasmic RXR in AEG-1–overexpressing cells (Supplemen-tary Fig. S7D). ERK inhibition might dephosphorylate nuclearRXR, leading to its increased activity without resulting innuclear translocation of cytoplasmic RXR, which remainsentrapped in the cytoplasm because of physical interactionwith AEG-1.

One important consequence of RXRs inhibition by AEG-1is abrogation of RA-induced gene transcription. Inactivationor downregulation of RARB and other RAR/RXR downstreamgenes have been reported in various malignancies withincreased cell survival and augmentation of disease (8). Atransgenic mouse expressing dominant negative RARadevelops spontaneous HCC (9). By negatively regulating theretinoid-inducible genes, such as RARB and CRABP2, impor-tant regulators of normal cell growth, AEG-1 providedsignificant protection from cell growth inhibition by differ-ent retinoids/rexinoids whereas AEG-1 knockdown poten-tiated these effects. Similar level of AEG-1–mediated resis-tance in HL-60 cells provided the importance of AEG-1 indetermining response to retinoid, a frontline therapy forleukemia.

Retinoids and rexinoids have been evaluated as candidatesfor cancer chemoprevention from past two decades (33, 34);however, there have been multiple drawbacks and limitations.One important factor is that retinoid signaling is often lost orcompromised in carcinogenesis, leading to retinoid ineffec-tiveness and resistance (35–37). An important reason is theinactivation/inhibition of RXRand/or RARpathways in various

cancers, including breast cancer, HCC, and AML (36–38).Combination of AEG-1 inhibition with ATRA treatmentresulted in tremendous synergistic inhibition of tumor growthin HCC xenograft assays, and demonstrated reduced prolifer-ation and increased apoptosis. Targeting AEG-1 could enhancethe efficacy of retinoids- and rexinoids-based therapeuticsovercoming drawbacks in HCC and other malignancies,including leukemia. This hypothesis needs to be confirmedusing orthotopic xenograft models in nude mice and endog-enous tumor models.

In summary, a schematic representation is presented todescribe AEG-1–driven regulation of RXRa and b (Fig. 7).Generally, RXR heterodimerizes with RAR and binds to targetgene promoters recruiting the corepressor complex in theabsence of ligand, and coactivators in the presence of ligand,thus regulating transcription of target genes for normal cellproliferation and apoptosis. AEG-1 in the nucleus of normalnontumorigenic cell balances this phenomenon by interferingwith coactivator recruitment. When AEG-1 increases andaccumulates in the cytoplasm of tumorigenic cells, this equi-librium is perturbed. First, AEG-1 translocates and entrapsRXRa and b into cytoplasm obstructing RXR binding andtranscriptional activation of target genes. Second, AEG-1induces phosphorylation of RXRs that act dominant negativelyon normal RXR. Finally, RXRa truncation is also elevated byAEG-1. All together, AEG-1 upregulation causes inactivation ofRXRs, thereby negatively affecting downstream signaling, thusfavoring unrestrained cancer cell proliferation leading to HCCand other cancers.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: J. Srivastava, P.B. Hylemon, D. SarkarDevelopment of methodology: N.D. Mukhopadhyay, D. SarkarAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): C.L. Robertson, D. Rajasekaran, R. Gredler, S. Ghosh,K. Shah, D. Bhere, M.A. Subler, J.J. Windle, D. SarkarAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): J. Srivastava, D. Rajasekaran, A. Siddiq, N.D. Mukho-padhyay, P.B. Hylemon, M.A. Subler, D. SarkarWriting, review, and/or revision of the manuscript: J. Srivastava, N.D.Mukhopadhyay, P.B. Hylemon, M.A. Subler, J.J. Windle, P.B. Fisher, D. SarkarAdministrative, technical, or material support (i.e., reporting or orga-nizing data, constructing databases): R. Gredler, L. Emdad, N.D. Mukho-padhyay, D. SarkarStudy supervision: P.B. Fisher, D. SarkarOther (performed and analyzed experiments): J. SrivastavaOther (supplied reagents and carried out discussion): G. Gil

Grant SupportThis study was supported in part by grants from The James S. McDonnell

Foundation and National Cancer Institute Grant R01 CA138540 (D. Sarkar) andNIH grants R01 CA134721 (P.B. Fisher). D. Sarkar is the Harrison EndowedScholar in Cancer Research and Blick scholar. P.B. Fisher holds the ThelmaNewmeyer Corman Chair in Cancer Research.

The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indicate thisfact.

Received February 11, 2014; revised May 22, 2014; accepted June 13, 2014;published online August 14, 2014.


Srivastava et al.



References1. Mangelsdorf DJ, Ong ES, Dyck JA, Evans RM. Nuclear receptor that

identifies a novel retinoic acid response pathway. Nature 1990;345:224–229.

2. De Luca LM. Retinoids and their receptors in differentiation, embryo-genesis, and neoplasia. FASEB J 1991;5:2924–2933.

3. Lefebvre P, Benomar Y, Staels B. Retinoid X receptors: commonheterodimerization partners with distinct functions. Trends EndocrinolMetab 2010;21:676–683.

4. Matsushima-Nishiwaki R, Shidoji Y, Nishiwaki S, Yamada T, MoriwakiH, Muto Y. Aberrant metabolism of retinoid X receptor proteins inhuman hepatocellular carcinoma. Mol Cell Endocrinol 1996;121:179–190.

5. TakiyamaY,MiyokawaN,SugawaraA,KatoS, ItoK,SatoK,OikawaK,et al. Decreased expression of retinoid X receptor isoforms in humanthyroid carcinomas. J Clin Endocrinol Metab 2004;89:5851–5861.

6. Zhong C, Yang S, Huang J, Cohen MB, Roy-Burman P. Aberration inthe expression of the retinoid receptor, RXRalpha, in prostate cancer.Cancer Biol Ther 2003;2:179–184.

7. Picard E, Seguin C, Monhoven N, Rochette-Egly C, Siat J, Borrelly J,Martinet Y, et al. Expression of retinoid receptor genes and proteins innon–small cell lung cancer. J Natl Cancer Inst 1999;91:1059–1066.

8. Altucci L, Leibowitz MD, Ogilvie KM, de Lera AR, Gronemeyer H. RARand RXR modulation in cancer and metabolic disease. Nature RevDrug Discov 2007;6:793–810.

9. Yanagitani A, Yamada S, Yasui S, Shimomura T, Murai R, Murawaki Y,Hashiguchi K, et al. Retinoic acid receptor alpha dominant negativeform causes steatohepatitis and liver tumors in transgenic mice.Hepatology 2004;40:366–375.

10. Yoo BK, Emdad L, Lee SG, Su ZZ, Santhekadur P, Chen D, Gredler R,et al. Astrocyte elevated gene-1 (AEG-1): a multifunctional regulator ofnormal and abnormal physiology. Pharmacol Ther 2011;130:1–8.

11. Hu G, Wei Y, Kang Y. The multifaceted role of MTDH/AEG-1 in cancerprogression. Clin Cancer Res 2009;15:5615–5620.

12. Yoo BK, Emdad L, Su ZZ, Villanueva A, Chiang DY, MukhopadhyayND, Mills AS, et al. Astrocyte elevated gene-1 regulates hepatocellularcarcinoma development and progression. J Clin Invest 2009;119:465–477.

13. Srivastava J, Siddiq A, Emdad L, Santhekadur PK, Chen D, Gredler R,Shen XN, et al. Astrocyte elevated gene-1 promotes hepatocarcino-genesis: novel insights from a mouse model. Hepatology 2012;56:1782–1791.

14. Yoo BK, Santhekadur PK, Gredler R, Chen D, Emdad L, Bhutia S,Pannell L, et al. Increased RNA-induced silencing complex (RISC)activity contributes to hepatocellular carcinoma. Hepatology 2011;53:1538–1548.

15. Yoo BK, Chen D, Su ZZ, Gredler R, Yoo J, Shah K, Fisher PB, et al.Molecular mechanism of chemoresistance by astrocyte elevatedgene-1. Cancer Res 2010;70:3249–3258.

16. Sarkar D, Lebedeva IV, Su ZZ, Park ES, Chatman L, Vozhilla N, Dent P,et al. Eradication of therapy-resistant human prostate tumors using acancer terminator virus. Cancer Res 2007;67:5434–5442.

17. Sarkar D,Park ES, EmdadL, LeeSG,SuZZ, Fisher PB.Molecular basisof nuclear factor-kappaB activation by astrocyte elevated gene-1.Cancer Res 2008;68:1478–1484.

18. Santhekadur PK, Das SK, Gredler R, Chen D, Srivastava J, RobertsonC, Baldwin AS Jr, et al. Multifunction protein staphylococcal nucleasedomain containing 1 (SND1) promotes tumor angiogenesis in humanhepatocellular carcinoma through novel pathway that involves nuclearfactor kappaB and miR-221. J Biol Chem 2012;287:13952–13958.

19. Heery DM, Kalkhoven E, Hoare S, Parker MG. A signature motif intranscriptional co-activators mediates binding to nuclear receptors.Nature 1997;387:733–736.

20. Thirkettle HJ, Girling J, Warren AY, Mills IG, Sahadevan K, Leung H,Hamdy F, et al. LYRIC/AEG-1 is targeted to different subcellular

compartments by ubiquitinylation and intrinsic nuclear localizationsignals. Clin Cancer Res 2009;15:3003–3013.

21. Mascanfroni ID, Montesinos Mdel M, Alamino VA, Susperreguy S,Nicola JP, Ilarregui JM, Masini-Repiso AM, et al. Nuclear factor (NF)-kappaB-dependent thyroid hormone receptor beta1 expression con-trols dendritic cell function via Akt signaling. J Biol Chem 2010;285:9569–9582.

22. Harish S, Ashok MS, Khanam T, Rangarajan PN. Serine 27, a humanretinoid X receptor alpha residue, phosphorylated by protein kinase Ais essential for cyclicAMP-mediated downregulation of RXRalphafunction. Biochem Biophys Res Comm 2000;279:853–857.

23. Adam-Stitah S, Penna L, Chambon P, Rochette-Egly C. Hyperpho-sphorylation of the retinoid X receptor alpha by activated c-Jun NH2-terminal kinases. J Biol Chem 1999;274:18932–18941.

24. Yoo BK, Gredler R, Vozhilla N, Su ZZ, Chen D, Forcier T, Shah K, et al.Identification of genes conferring resistance to5-fluorouracil. ProcNatlAcad Sci U S A 2009;106:12938–12943.

25. Macoritto M, Nguyen-Yamamoto L, Huang DC, Samuel S, Yang XF,Wang TT, White JH, et al. Phosphorylation of the human retinoid Xreceptor alpha at serine 260 impairs coactivator(s) recruitment andinduces hormone resistance to multiple ligands. J Biol Chem 2008;283:4943–4956.

26. Matsushima-Nishiwaki R, Okuno M, Adachi S, Sano T, Akita K,Moriwaki H, Friedman SL, et al. Phosphorylation of retinoid X receptoralpha at serine 260 impairs its metabolism and function in humanhepatocellular carcinoma. Cancer Res 2001;61:7675–7682.

27. Zhou H, Liu W, Su Y, Wei Z, Liu J, Kolluri SK, Wu H, et al. NSAIDsulindac and its analog bind RXRalpha and inhibit RXRalpha-depen-dent AKT signaling. Cancer Cell 2010;17:560–573.

28. Lee SG, Su ZZ, Emdad L, Sarkar D, Franke TF, Fisher PB. Astrocyteelevated gene-1 activates cell survival pathways through PI3K-Aktsignaling. Oncogene 2008;27:1114–1121.

29. Fukunaka K, Saito T, Wataba K, Ashihara K, Ito E, Kudo R. Changes inexpression and subcellular localization of nuclear retinoic acid recep-tors in human endometrial epithelium during the menstrual cycle. MolHum Reprod 2001;7:437–446.

30. GhoseR,ZimmermanTL, ThevanantherS,KarpenSJ.Endotoxin leadsto rapid subcellular re-localization of hepatic RXRalpha: a novel mech-anism for reduced hepatic gene expression in inflammation. NuclearRecep 2004;2:4.

31. Tanaka T, Dancheck BL, Trifiletti LC, Birnkrant RE, Taylor BJ, GarfieldSH, Thorgeirsson U, et al. Altered localization of retinoid X receptoralpha coincides with loss of retinoid responsiveness in human breastcancer MDA-MB-231 cells. Mol Cell Biol 2004;24:3972–3982.

32. Cao X, Liu W, Lin F, Li H, Kolluri SK, Lin B, Han YH, et al. Retinoid Xreceptor regulates Nur77/TR3-dependent apoptosis [corrected] bymodulating its nuclear export and mitochondrial targeting. Mol CellBiol 2004;24:9705–9725.

33. Altucci L, Gronemeyer H. The promise of retinoids to fight againstcancer. Nature Rev Cancer 2001;1:181–193.

34. Tanaka T, De Luca LM. Therapeutic potential of "rexinoids" in cancerprevention and treatment. Cancer Res 2009;69:4945–4947.

35. Xu XC. Tumor-suppressive activity of retinoic acid receptor-beta incancer. Cancer Lett 2007;253:14–24.

36. Farias EF, Arapshian A, Bleiweiss IJ, Waxman S, Zelent A, Mira YLR.Retinoic acid receptor alpha2 is a growth suppressor epigeneticallysilenced in MCF-7 human breast cancer cells. Cell Growth Diff2002;13:335–341.

37. TangXH,GudasLJ.Retinoids, retinoic acid receptors, andcancer. AnnRev Pathol 2011;6:345–364.

38. Johansson HJ, Sanchez BC, Mundt F, Forshed J, Kovacs A,Panizza E, Hultin-Rosenberg L, et al. Retinoic acid receptor alphais associated with tamoxifen resistance in breast cancer. Nat Comm2013;4:2175.





aeg-1 regulates retinoid x receptor and inhibits retinoid ...however, a "lxxll" motif, by...

Documents