advances in diagnosis of salmonellosis and characterization of salmonella

46
Advances in Diagnosis of Salmonellosis and Characterization of Salmonella Dr. Bhoj R singh, Principal Scientist (VM) I/C Epidemiology; Centre for Animal Disease Research and Diagnosis Indian Veterinary Research Institute, Izatnagar-243122, Bareilly, UP, India. TeleFax +91-581-2302188

Upload: bhoj-r-singh

Post on 11-May-2015

1.628 views

Category:

Health & Medicine


7 download

DESCRIPTION

About Diagnosis of Salmonella infection in human and animals and determining pathogenic potential of Salmonella.

TRANSCRIPT

Page 1: Advances in diagnosis of salmonellosis and characterization of salmonella

Advances in Diagnosis of Salmonellosis and

Characterization of Salmonella

Dr. Bhoj R singh, Principal Scientist (VM)

I/C Epidemiology; Centre for Animal Disease Research and Diagnosis

Indian Veterinary Research Institute, Izatnagar-243122, Bareilly, UP, India. TeleFax  +91-581-2302188

Page 2: Advances in diagnosis of salmonellosis and characterization of salmonella

Why we need early diagnosis for salmonellosis ?

• Early diagnosis means nipping the problem in bud, which is of utmost significance because:

• Any level of Salmonella leads to decreased production. • Treatment of Sick Animals is expensive and uneconomic

in poultry industry. • Death of animals means loss of money and product. • Outbreak of salmonellosis results in public backlash and

decreased sales of the associated food.• Increased work force is required to control the outbreak.• Sampling and testing costs a lot.• Extra record keeping is necessary for certification and

validation.

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 3: Advances in diagnosis of salmonellosis and characterization of salmonella

Method Accuracy Detection limit cfu/ml

Analysis time in hours

Ease of handling

Standard high 1-10 48-120 Complex

Modified conventional

High 10-100 24-60 Complex

Impedimetry Good 105-106 24-60 Easy

Immunological high 105-106 48-60 Intermediate

DNA probes high 103-105 22-60 Intermediate

PCR high 102-103 22-24 Intermediate

Real time PCR high 102-103 2-15 Intermediate

Different methods of Salmonella Detection and their sensitivity

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 4: Advances in diagnosis of salmonellosis and characterization of salmonella

Salmonella Antibody detection

• Whole blood agglutination test• Rapid plate agglutination test (RPAT)• Standard tube agglutination test (STAT)• Passive haemagglutination test (PHAT)• Antiglobulin test (AGT) • Radioimmunoassay (RIA) • Counter immuno-electrophoresis (CIE) & • ELISA • dot-ELISA• AGPT

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 5: Advances in diagnosis of salmonellosis and characterization of salmonella

Enzyme-linked immunosorbent assays for Salmonella Enteritidis and other Salmonella serovars

Two main basic systems are available for detection of IgG (IgY) specific for S. Enteritidis: the indirect ELISA and the competitive ‘sandwich type’ ELISA

The indirect ELISA involves the use of a detecting antigen coated on to the wells of a microtitre plate. After the application of a blocking reagent to reduce nonspecific binding, test samples are applied to the wells. Specifically bound antibody in the sample is detected by an antibody/enzyme conjugate. A variety of antigens, including LPS, flagella, SEF14 fimbriae, Salmonella cytotoxin I, outer membrane proteins and cruder antigen preparations have been used. The competitive sandwich ELISA employs a specific reagent - a monoclonal antibody (MAb) - for coating antigen to wells. This is then followed by a pure or crude antigen preparation. Test samples are applied followed by conjugated MAb, which will not bind to the antigen if the sample contained specific antibodies. The assay time can be shortened by adding both test sample and conjugate together. MAbs have been prepared for LPS, flagella and SEF14 for S. Enteritidis.There are advantages and disadvantages to both systems. The indirect assay is simpler and reagents are available for all Salmonella serotypes of chickens, turkeys, ducks and mammalian hosts. The competitive ELISA can be applied to all animal species and in general shows higher specificity. However, reagents are not available commercially for all serotypes. There are also some affinity problems and it may be less sensitive than the indirect assays. In the field, both systems have produced false-positive reactions.

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 6: Advances in diagnosis of salmonellosis and characterization of salmonella

Salmonella cytotoxin I based ELISA (Genus specific)

• Indirect ELISA (I-ELISA) is performed to determine Salmonella cytotoxin-I specific antibodies to asses the infections with Salmonella irrespective of infecting serovars of the pathogens involved. Cytotoxin I has been reported in all pathogenic strains of Salmonella serovars (Singh and Sharma, 2000). Cytotoxin I antigens is prepared (Singh and Sharma, 1999) using a known cytotoxigenic reference culture of S. Weltevreden (S-13 and reference anti cytotoxin (Singh and Sharma, 2000) is used.

• To determine Salmonella cytotoxin I (SCI-I) antibodies in serum samples, ELISA plates are coated with anticytotoxin (dog) and then plates are washed thrice with PBST (Phosphate buffer saline with 0.05% Tween-20). Remaining sites are blocked with 300µl freshly prepared 5% (w/v) skim milk. After overnight incubation at 370C, plates are washed with PBST thrice. Then to the wells of ELISA plates, 100µl antigen prepared at the concentration of 10 μg protein/well in 1M Tris is added into the wells and incubated for 2 h at 370C. Wells are emptied and washed with PBST and to each well , a 100 µl of diluted (1: 200 in PBS with 0.1% BSA) test serum is applied in triplicate and incubated for 2 h at 370C as above. Wells are emptied and washed as earlier and to each well, a 100µl of suitably diluted (1:5000 in PBS with 0.1% BSA) anti IgG (against the test animal) HRPO conjugate is added and incubated for 2 h at 370C, plates are washed thrice with PBST and then apply100µl of freshly prepared substrate (Orthophenyline diamine) to each well made in citrate phosphate buffer (pH 4.6, 0.1M) and plates are incubated for 20 min at 370C in dark. The reaction is stopped with100µl of IM H2SO4 in each well. O.D. of each well is read at 492 nm with ELISA reader. Serum titre is calculated as

• Average test OD – Average Negative control OD• ELISA titre = —————————————————————

×100 Average Negative control O.D.

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 7: Advances in diagnosis of salmonellosis and characterization of salmonella

Salmonella Cytotoxin-I based dot-ELISA (Genus specific)

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 8: Advances in diagnosis of salmonellosis and characterization of salmonella

Salmonella cytotoxin-I based AGPT (Genus specific)

P P

PN

N N

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 9: Advances in diagnosis of salmonellosis and characterization of salmonella

Widal’s Test

• Common antigens used in Widal’s test• Bacteria `O` Antigens `H`

Antigens• Typhi 9,12 (Vi) d• Paratyphi A 1,2,12 a• Paratyphi B 1,4,12 b• Paratyphi C 6,7 (Vi) c

• `O` antigens- 1,2,4,6,7,9,12• Capsular antigen- Vi;• `H` antigens- a,b,c,d

• Diagnostic titres:- H- 1 : 20; O- 1:50, and Vi- 1:5.

• Incubation for tests:- H- 50oC for 2 hr then RT for >3 hrs.• O- 37oC for 2-4 hrs then RT overnight.• Vi- 37oC or RT overnight.

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 10: Advances in diagnosis of salmonellosis and characterization of salmonella

Commercially available test kits• TEK-ELISA (Organon Teknika, Cambridge UK)• IFR-ELISA (Wyatt et al. 1995)• Report-EIA & TECRA Salmonella Visual A (Wilson et al. 1990)• Dulcitol-1-phosphate dehydrogenase (DPD) mab based kit (Tian et

al. 1996)• Cytotoxin-1-antibodies based Salmonella detection protocol (Singh

et al. 2000)• Chekit-S-enteritidis (ELISA) kit (Baumgartner et al. 1993)• Polymyxin cloth enzyme immunoassay (Blais et al. 1997)• 1-2 Test (Bio-control, Bothel, USA)• Single step Salmonella (SSS) by Ampcor, Camden USA• Iso-Grid ® of Dynal, Oslo• Vi-TEK & Vi ELISA (Sharma et al. 1997)• Meat Juice ELISA kit (Steinbach et al. 1999)

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 11: Advances in diagnosis of salmonellosis and characterization of salmonella

Factors affecting serological diagnosis

• Useful to identify infected flocks/herds rather than to identify infected individuals.• Serologically positive reactors may no longer be infected with Salmonella

organisms, similarly, actively excreting Salmonellae may be serologically negative. • Newborn animals are immunologically immature and do not respond serologically.• Chickens and neonates may also acquire Salmonella antibodies passively from

their parents without having any active infection.• Following Salmonella infections, immunoglobulin concentrations may be so high

that it may cause prozone phenomenon.• Necessitates differentiation between vaccine response & actual infection.• The effect of antibiotic therapy on the serological response remains unclear. • More than 2500 different Salmonella serovars exist. It is not easy to select an

antigen and test used.• Serological cross-reactions between different serovars could not be conclusive

about causative serovar.• In poultry, egg yolk may be tested for immunoglobulins to Salmonella and eggs

may provide a method to screen flocks. • Require readymade standard antigen: you need it from outside• Require bleeding• Sample are fragile and lost in transit• Sera sample may be having unknown pathogens of much more hazardous

disease for which we have never thought; Ebola, Marburg, Avian influenza, hepatitis B, HIV

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 12: Advances in diagnosis of salmonellosis and characterization of salmonella

Antigen identification• Isolation• Electrical Impedance measurement• Antigen Capture Immunoassays• PCR (Saiki et al. 1985 reported First PCR)• Capillary PCR• Multiplex PCR• RT-PCRDraw backs: • Different routes of excretion of the pathogen from

host-difficult to decide the right kind of sample to be collected.

• Irregularity in presence of antigen in host during disease process- antigen is present or excreted only for short time, and in different stages.

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 13: Advances in diagnosis of salmonellosis and characterization of salmonella

Samples

• Samples should not originate from birds or eggs that have recently been treated with antimicrobial drugs. They can be swabs or aseptically collected samples from affected tissues, or intestinal and cloacal contents. Other materials to sample include eggs, eggshell surfaces, embryos, faecal droppings and hatcher debris, especially fluff, dust and broken eggshells.

• The nature and quantity of the sample will depend on whether it is taken from live poultry or carcasses, and whether lesions or faecal contamination are present.

In case of delay, samples should be stored at 0-4°C.

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 14: Advances in diagnosis of salmonellosis and characterization of salmonella

Steps in isolation of Salmonella

For faecal and tissue samples• Pre-enrichment (1:10 in Buffered Peptone Water), at 35-37oC for 18-24 hours.• Selective enrichment broth (Tetrathionate broth, Rappaport Vassiliadis medium,

Selenite cystine medium; RV is much better, at room temp).• Plating after 24 hour and 48 hr: on Hektoen Enteric agar with novobiocin (HEN) or

Brilliant green agar with novobiocin (BGN) or Xylose lysine citrate agar (XLT-4).• If negative, transfer 0.1 ml to 10 ml RV after 120 hour and incubate at 37oC for 24-48

hour and then plate as above. • Pick up suspected colonies after 24 hour of plating on to Motility Indole Lysine (MIL)

stabs and triple sugar iron agar (TSI) slants.• Serological confirmation.

For blood cultures: 10 ml of blood should be added to enrichment media and incubated at 37oC and plated daily for up to 11 days. Addition of liquoid or bile in enrichment interferes with bactericidal action of blood and improves the Salmonella detection. Medium of choice is 0.5 % Taurocholate or ox bile broth. Blood clots give better results and require lesser medium. I.e. for clot from 10 ml blood 50 ml ox bile broth.

Draw backs: Take long time Ineffective when antibiotic treatment is on

Different methods of isolation for different serovarsIntermittent excretion

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 15: Advances in diagnosis of salmonellosis and characterization of salmonella

Differentiation of Salmonella species and subspeciesCharacters Dulcitol Lactose Sorbitol Mucate D-Tartarate Citrate Malo

nateONPG

S. bongori + - + + - + - +

S. enterica ssp. enterica

+ - + + + + - -

S. enterica ssp. arizonae

- (-) + + - + + +

S. enterica ssp. diarizonae

- (+) + D (-) + + +

S. enterica ssp. houtenae

- - + - D + - -

S. enterica ssp. indica

D (-) - + + (+) - d

S. enterica ssp. salamae

+ + + + d + + (-)

D, delayed; ( ), variableOther common tests are:- Indole –ve, MR +ve, VP –ve, Urease –ve, nitrate reduction +ve, Phenylalanine –ve, glucose +ve, salicin –ve, adonitol –ve, inositol D, raffinose –ve, erythritol, esculin -ve, sucrose –ve, oxidase –ve, H2S +(-), gelatinase –ve, lysine, ornithine +ve, arginine +ve, KCN –ve,

alginate –ve. Common confusion occurs with Citrobacter which are lysine –ve and melibiose fermenter, a few Enterobacter may also cause some problems, they are also usually –ve in lysine (gregoviae and aerogenes + but are + for melibiose) and for H2S and +ve for ONPG test.

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 16: Advances in diagnosis of salmonellosis and characterization of salmonella

Differentiation of common Salmonella serovars

Characters H2S Lysine Ornithine D-tartrate

Gas in glucose

Dulcitol Maltose Rhamnose Sorbitol

Choleraesuis D + + (+) + - + + (+)

Paratyphi A - - + - + + + + +

Typhi + + + + - - + - +

Gallinarum + + - + - + + - -

Pullorum + + + - + - - + (-)

Common Sal + + + + + + + + +

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 17: Advances in diagnosis of salmonellosis and characterization of salmonella

Common Non-isolation TechniquesImpedance/ conductance assays

Malthus assay:- based on antibiotic added pre-enrichment followed by selenite based enrichment and then measuring impedance in two cells one containing trimethylamine oxide (TMAO) and dulcitol, another cell contain lysine. Salmonella converts TMAO to TMA (trimethylamine). The test yields 12% false negatives and 10% false positives

BacTrac 4100 system: based on impedance splitting method measures impedance of medium and the electrode (M and E value respectively). Pre-enrichment is followed by novobiocin containing RV broth enrichment and then taking M and E value for next 22 h at 40oC. It yields 7.4% false negatives and 4.9% false positives.

Other systems are RABIT and BACTOMETER.

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 18: Advances in diagnosis of salmonellosis and characterization of salmonella

Other methods

Antigen capture immunoassays: Sensitivity is 103 to 106 cfu per ml and most of the commercially available ones are serovar specific.

Commercially available systems are: PATHSTICK, EIAFOSS, VIDAS SLM, TECRA OPUS DIPSTICKS, DYANA Beads, Magna Beads and VICAM beads (serovar specific).

• Genus specific Antigen Capture ELISA based on Salmonella cytotoxin-I (Singh and Sharma, 2000)

• FAT (Singh and Sharma, 2000)• Biken test (Singh and Sharma, 2000)Identification of antigen with these method is less sensitive

due to requirement of large number of antigen particles in the clinical samples.

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 19: Advances in diagnosis of salmonellosis and characterization of salmonella

Salmonella Cytotoxin-I based FAT (Genus specific)

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 20: Advances in diagnosis of salmonellosis and characterization of salmonella

Salmonella cytotoxin-I based Biken test (Genus specific)

NN

PP

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 21: Advances in diagnosis of salmonellosis and characterization of salmonella

Serobact Salmonella TestA simple one step latex slide agglutination test for both

clinical and food laboratories. Serobact Salmonella is a rapid latex slide agglutination test for the identification of Salmonella from selective enrichment broths. Serobact latex technology is more sensitive than direct agglutination methods and the use of Serobact Salmonella early presumptive identification of Salmonella spp. saving about 24 hours than using conventional techniques.

The test exploit Polyvalent H antisera prepared against a comprehensive range of Salmonella flagella antigens is coated onto latex particles.

False Positive: Specificity 97.2%. Predictive negative value 100%False Negative: Sensitivity 100%. Predictive positive value 98.2%

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 22: Advances in diagnosis of salmonellosis and characterization of salmonella

REVEAL for SalmonellaThe test can handle one or several samples concurrently.

Contents of the sample are wicked through the pad to a specimen reaction zone containing colloidal gold-labeled antibodies specific to Salmonella. Reactive Salmonella combine with the gold-labeled antibodies and migrate through the support until they encounter a binding reagent zone which includes a second antibody specific to Salmonella. When this occurs, a line appears in the test window indicating a positive result. The rest of the sample continues to migrate until it encounters a second binding reagent zone. This results in the formation of a line in the control window.

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 23: Advances in diagnosis of salmonellosis and characterization of salmonella

Transia Card Salmonella

This test is used directly on an enrichment broth. It is on a sandwich - type, immunochromatographic reaction using highly- specific antibodies immobilised onto a membrane and conjugated to a dye. This allows the detection of all Salmonella serotypes present in sample. It is based on lipopolysaccharide (LPS) detection

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 24: Advances in diagnosis of salmonellosis and characterization of salmonella

Genus specific PCR- primers• 1. Product 163bp

P1 : TTATTAGGATCGCGCCAGGC

P2 : AAAGAATAACCGTTGTTCAC• 2. inv product 284 bp (Oliveira et al., 2002)

139 : GTGAAATTATCGCCACGTTCGGGCAA141 : TCATCGCACCGTCAAAGGAACC

• 3. Random genomic product 429 bp ST 11: AGCCAACCATTGCTAAATTGGCGCAST 15 : GGTAGAAATTCCCAGCGGGTACT

• 4. Hin H2 flagellin gene (236 bp)Hin 1750 L : CTAGTGCAAATTGTGACCGCAHin 1750 R : CCCCATCGCGCTACTGGTATC

• 5. H-li flagellin gene (173 bp)H-li 1788 : AGCCTCGGCTACTGGTCTTG

H-li1789 R : CCGCAGCAAGAGTCACCTCA• 6. GVV PQ fimbriae agf, product (261 bp)

TAF 3 : TCCGGCCCGGACTCAACG

TAF 4 : CAGCGCGGCGTTATACCG• 7. inv A and inv gene (457 bp product)

S1: TGCTACAAGCATGAAATGGS2: AAACTGGACCACGGTGACAA

• 8. Spv A gene based 450 bp product.382: CAGACCACCAGTCCGGCAC

383: CAGTCAATGCTCTCTCGCTG• 9. hisJ gene (Cohen et al. 1994) 496 bp product

Cohen 1: ACT GGC GTT ATC CCT TTC TCT GGT G Cohen 2: ATC TTG TCC TGC CCC TGG TAA GAG A

• 10. invA product (Ferretti, et al., 2001) of 389 bpSal F GCTGCGCGCGAACGGCGAAG Sal R TCCCGGCAGAGTTCCCATT

• 11. Fli-Typ 620 bp. F CGGTGTTGCCCAGGTTGGTAAT R ACTGGTAAAGATGGCT

• 12. A0 488 bpAO1 GATACTGCTGAACGTAGAAGG

AO2 GCGTAAATCAGCATCTGCAGTAGC

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 25: Advances in diagnosis of salmonellosis and characterization of salmonella

Serogroup specific PCR : Important diagnostic tool particularly in identification of

rough strains (Hoorfar et al. 1999).

• Serogroup Primers (5’-3’) Amplicon size bps

• B B1 : AGAATATGTAATTGTCAG 882• B2 : TAACCGTTTCAGTAGTTC

• C 1 C1 : GGTTCCATAAGTATATCT 471C2 : CTGGATACGAACCCGTAT

• C2-C3 C21 : ATGCTTGATGTGAATAAG 820• C31 : CTAATCGAGTCAAGAAAG• A&D D1 : TCACGACTTACATCCTAC 720• D2 : CTGCTATATCAGCACAAC

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 26: Advances in diagnosis of salmonellosis and characterization of salmonella

Multiplex PCR for Salmonella in faecesAmplifies 491 bp product for inv (chromosomal) gene segment,

795 bp product for spvA gene segment on virulence plasmid

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 27: Advances in diagnosis of salmonellosis and characterization of salmonella

Various probes for Salmonella genus1. Random chromosomal fragemnt• TS11: GTCACGGAAGAAGAGAAATCCGTACG Tsen et al. 1991

• TS21: TACATCGTAAAGCACCATCGCAATA• TS31: AGACCACTGACCCAGCCTAATCAA2. Random chromosomal fragment• ST15 rev: GAGTACCCGCTGGGAATTTCTAC Olsen et al.

1995• InvA gene S3: CTGGTTGATTTCCTGATCGC Stone et al. 1994

3. IS200 is not present in S. Agona, S. Arizonae, S. Dar-es-Salam, S. Panama, S. Infantis, S. Virchow and S. I.9, 12 : Z. Detection limit for S. Typhi is 103-4 cfu/ml. In IS 200 a tandem repeat of 0.3 kb I used for cross hybridization (Gilbert et al. 1990). Colorimetric single phase hybridization assay (CdorDNAH) can detect Salmonella by use of 16S and 23 S rRNA based probes but it can not detect S. subspp. V. and gave 7% false positive due to cross reaction with Citrobacter freundii (Curiale et al. 1990) and detection limit is 108-109cfu/ml. It is produced by Genetrack (earlier used radiolabelled probe but now enzyme labelled probes are used) AOAC approved (Flowors et al., 1987). Specificity and sensitivity of non-radioactive rRNA based oligonucleotide probs are comparable with culture method and results are given usually in 48 hr.

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 28: Advances in diagnosis of salmonellosis and characterization of salmonella

Salmonella BAX System (Automated PCR)

Time to Perform: 1-hour-to-1-day An automated system to quickly and accurately. The BAX system cycler/detector is used to load the

prepared samples. In less than four hours, computer-generated results are clearly displayed on the screen. A single tablet of integrated PCR reagents combines sample and control primers, plus reagents that overcome inhibition in chocolate and other challenging food types. There is no need to run a separate control. Process up to 96 samples in one batch. BAX for screening Salmonella can work with even the most difficult samples.

Specificity 98%; Sensitivity 98%

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 29: Advances in diagnosis of salmonellosis and characterization of salmonella

Commercial probe based tests

• Gene-Trak Salmonella Microwell and tube assays: Test is based on microtiter colorimetric absorbance reading. The DNA hybridization test employs Salmonella-specific DNA probes which are directly labeled with horseradish peroxidase. A colorimetric endpoint is then used for the detection of Salmonella in food samples following broth culture enrichment.

• Sensitivity: 1-5 CFU/25g. Testing time: 1.5 hours (after 40 to 48 hour enrichment).

• Tests per kit: Up to 98

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 30: Advances in diagnosis of salmonellosis and characterization of salmonella

Real time PCRQuantitative real-time polymerase chain reaction (PCR) provides an accurate

method for determination of levels of specific DNA and RNA sequences in tissue and clinical samples. It is based on detection of a fluorescent signal produced proportionally during amplification of a PCR product. Data acquisition and analysis by real-time PCR is short due to automation. DNA and RNA can be quantified using this detection system without laborious post-PCR processing.

The key to the detection is estimation of fluorescence emitted either from fluorescent probes, primers or dyes binding to dsDNA. A probe (ie, TaqMan) is designed to anneal to the target sequence between the traditional forward and reverse primers. The probe is labeled at the 5' end with a reporter fluorochrome (usually 6-carboxyfluorescein [6-FAM]) and a quencher fluorochrome (6-carboxy-tetramethyl-rhodamine [TAMRA]) added at any T position or at the 3' end.3 The probe is designed to have a higher Tm than the primers, and during the extension phase, the probe must be 100% hybridized for success of the assay. As long as both fluorochromes are on the probe, the quencher molecule stops all fluorescence by the reporter. However, as Taq polymerase extends the primer, the intrinsic 5' to 3' nuclease activity of Taq degrades the probe, releasing the reporter fluorochrome. The amount of fluorescence released during the amplification cycle is proportional to the amount of product generated in each cycle. Although, primers originally designed for end-point PCR, works well for real time PCR, needs standardization to have adequate specificity or sensitivity.

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 31: Advances in diagnosis of salmonellosis and characterization of salmonella

Sources:Chen S, Yee A, Griffiths M, et al. Int J Food Microbiol 1997;35:239-250. Eyigor AA, and Tayfun K, Carli B. Avian Diseases: Vol. 47, No. 2, pp. 380–386

Some primers and probes used in RT-PCR of Salmonella: Although same probes and primers can be used for diagnosis with RT-PCR as used otherwise in PCR, some people have tried other probes and primers too

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 32: Advances in diagnosis of salmonellosis and characterization of salmonella

Characterization of Salmonella isolates

Virulence markers

• In vitro tests-– Conventional &– Molecular

• In vivo tests-– Conventional & – New biomodels

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 33: Advances in diagnosis of salmonellosis and characterization of salmonella

Conventional in vitro tests

Congo red dye binding assay

P

N

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 34: Advances in diagnosis of salmonellosis and characterization of salmonella

Conventional in vitro tests

DNase test

P

P

P

P

P

P

P

N

N

NN

N

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 35: Advances in diagnosis of salmonellosis and characterization of salmonella

Conventional in vitro tests

Rings around mercuric chloride disk

Golden hallo around acriflavine disks,

Ring around crystal violet disk

(All three are believed to be plasmid mediated characterts)

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 36: Advances in diagnosis of salmonellosis and characterization of salmonella

Effect of plasmid curing on golden hallo reaction around acrifalavine disk

Original A14 strainA14 strain after curing

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 37: Advances in diagnosis of salmonellosis and characterization of salmonella

Detection of Haemolysins

Haemolysis of washed goat RBCs by S. Paratyphi E436 (A), E44b (B) and S. Typhi, E206(C), (D) E345 strains. After incubation at 37OC for 24 hours.

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 38: Advances in diagnosis of salmonellosis and characterization of salmonella

Haemolysis of washed goat RBCs by S. Gallinarum S54 (A), and B haemolytic strains of Streptococcus aureus (B, C, D). After incubation at 37OC for 24 hours.

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 39: Advances in diagnosis of salmonellosis and characterization of salmonella

Molecular in vitro tests• Virulence plasmid detection by isolation of plasmid

– Detection by PCR– Detection by Probes

• Detection of stn gene for enterotoxin, hly/ sly gene for haemolysins

– cytolysin gene (sly A)Sal L 1 AGG AGA TGA AAT TGG AAT CGC CA Sal L 2 TGC CCC TGC ACC TCA ATC GTG AGstm-O1 CGC AGG TTC TGA ATG CGG AASTM-O2 TAA TAC CTG CTG TAG CAA GG

– Detection of stn (Product size 617 bp) gene for enterotoxin, hly/ sly gene for haemolysins etc.Stn-1 5’ TTG TGT CGC TAT, CAC TGG CAA CC 3’STN-2 5’ ATT CGT AAC CCG CTC TCG TCC 3’

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 40: Advances in diagnosis of salmonellosis and characterization of salmonella

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 41: Advances in diagnosis of salmonellosis and characterization of salmonella

Plasmid profiling(Many different kinds of plasmids are there in Salmonella strains)

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 42: Advances in diagnosis of salmonellosis and characterization of salmonella

Conventional in vivo modelsMouse model

Retention of urine in chronic salmonellosis

Loss of hair, necrosis of tail

Control

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 43: Advances in diagnosis of salmonellosis and characterization of salmonella

Conventional in vivo models

• 12 day old chick embryo inoculation

HealthyIntra-allantoic S. Gallinarum inoculated on 12th day

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 44: Advances in diagnosis of salmonellosis and characterization of salmonella

Conventional in vivo modelsRabbit ligated ileal loop assay

Inoculated with cytotoxic enterotoxin

Inoculated with cytotonic enterotoxin

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 45: Advances in diagnosis of salmonellosis and characterization of salmonella

Conventional in vivo models

Vasopermeability factor test assay

Dermonecrosis associated with Salmonella cytotoxin Red zone associated with Salmonella enterotoxin

Negative

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar

Page 46: Advances in diagnosis of salmonellosis and characterization of salmonella

New in vivo models

Germinating maize seed model

Inoculated with non-pathogenic rough S. Typhimurium

Inoculated with pathogenic S. Typhimurium

BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar