acrolein stimulates the synthesis of il-6 and c-reactive protein (crp) in thrombosis model mice and...

,

,

*Graduate School of Pharmaceutical Sciences, Chiba University, Chuo-ku, Chiba, Japan

†Amine Pharma Research Institute, Innovation Plaza at Chiba University, Chuo-ku, Chiba, Japan

‡Faculty of Pharmacy, Chiba Institute of Science, Choshi, Chiba, Japan

AbstractMeasurements of protein-conjugated acrolein (PC-Acro), IL-6,and C-reactive protein (CRP) in plasma were useful foridentifying silent brain infarction with high sensitivity andspecificity. The aim of this study was to determine whetheracrolein causes increased production of IL-6 and CRP inthrombosis model mice and cultured cells. In mice withphotochemically induced thrombosis, acrolein produced atthe locus of infarction increased the level of IL-6 and then CRPin plasma. This was confirmed in cell culture systems –

acrolein stimulated the production of IL-6 in mouse neuro-blastoma Neuro-2a cells, mouse macrophage-like J774.1cells, and human umbilical vein endothelial cells (HUVEC),and IL-6 in turn stimulated the production of CRP in human

hepatocarcinoma cells. The level of IL-6 mRNA was increasedby acrolein through an increase in phosphorylation of thetranscription factors, c-Jun, and NF-jB p65. Furthermore,CRP stimulated IL-6 production in mouse macrophage-likeJ774.1 cells and HUVEC. IL-6 functioned as a protective factoragainst acrolein toxicity in Neuro-2a cells and HUVEC. Theseresults show that acrolein stimulates the synthesis of IL-6 andCRP, which function as protecting factors against acroleintoxicity, and that the combined measurement of PC-Acro, IL-6,and CRP is effective for identification of silent brain infarction.Keywords: acrolein, brain infarction, c-Jun, CRP, IL-6, NF-jBp65.J. Neurochem. (2013) 127, 652–659.

Polyamines (putrescine, spermidine, and spermine) exist atmillimolar concentrations in cells and are essential fornormal cell growth, mainly through stimulation of specifickinds of protein synthesis by changing the structure ofbulged-out region of double-stranded RNA (Higashi et al.2008; Igarashi and Kashiwagi 2010). However, when cellsare damaged, polyamines unbind from RNA and the toxiccompounds acrolein (CH2=CHCHO) and H2O2 are producedfrom polyamines, in particular from spermine, by polyamineoxidases (PAO, spermine oxidase, and acetylpolyamineoxidase) (Igarashi and Kashiwagi 2011). When the toxicitiesof acrolein and H2O2 were compared in a cell culture system,acrolein was more toxic than H2O2 (Sharmin et al. 2001).We found that levels of PAO and protein-conjugated acrolein(PC-Acro) are well correlated with the severity of stroke(Tomitori et al. 2005) and chronic renal failure (Igarashiet al. 2006). It was also shown that the level of PC-Acro in

saliva is well correlated with severity of primary Sj€ogren’ssyndrome (Higashi et al. 2010), and that the level of PC-Acro in plasma is increased in Alzheimer’s disease (Waragaiet al. 2012).There are reports that silent brain infarction (SBI) increases

the risk of subsequent stroke and dementia (Kobayashi et al.

Received February 11, 2013; revised manuscript received May 11, 2013;accepted June 10, 2013.Address correspondence and reprint requests to Kazuei Igarashi,

Graduate School of Pharmaceutical Sciences, Chiba University, 1-8-1,Inohana, Chuo-ku, Chiba 260-8675, Japan.E-mail: [email protected] used: CRP, C-reactive protein; ELISA, enzyme-linked

immunosorbent assay; HPRT, hypoxanthine phosphoribosyltransferase;HUVEC, human umbilical vein endothelial cells; IL-6, interleukin-6;PC-Acro, protein-conjugated acrolein; PIT, photochemically inducedthrombosis; SBI, silent brain infarction.

652 © 2013 International Society for Neurochemistry, J. Neurochem. (2013) 127, 652--659

JOURNAL OF NEUROCHEMISTRY | 2013 | 127 | 652–659 doi: 10.1111/jnc.12336

1997; Vermeer et al. 2007). It is, therefore, valuable to beable to estimate SBI at an early period by biochemicalmarkers. We have reported that measurement of PC-Acrotogether with interleukin-6 (IL-6) and C-reactive protein(CRP) in plasma makes it possible to identify SBI with84.1% sensitivity and 83.5% specificity (Yoshida et al.2010). These biochemical markers also increased in theplasma of subjects with carotid atherosclerosis and whitematter hyperintensity (Yoshida et al. 2010), which are riskfactors of stroke (Bokura et al. 2006; Inoue et al. 2007). Inthis communication, we tried to determine whether acroleinproduced during cell damage like brain infarction causes theincrease of IL-6 and CRP in plasma of thrombosis modelmice and also in cell culture systems.

Materials and methods

Materials

Acrolein and human CRP were purchased from Tokyo ChemicalIndustry Co. Ltd. (Tokyo, Japan) and Sigma-Aldrich (Tokyo,Japan), respectively. Human and mouse IL-6 and antibody againsthuman IL-6 were obtained from R&D Systems (Minneapolis, MN,USA) and antibody against mouse IL-6 was from ENDOGEN(Woburn, MA, USA). Antibodies against c-Jun and NF-jB p65were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz,CA, USA), and those against phospho-c-Jun and phosho-NF-jB p65were from Cell Signaling Technology, Inc. (Beverly, MA, USA).

Photochemically induced thrombosis (PIT) model mice

All animal experiments were approved by the Institutional AnimalCare and Use Committee of Chiba University and carried outaccording to the Guidelines for Animal Research of ChibaUniversity. Male C57B/L mice (7 weeks old) were purchased fromJapan SLC Inc (Hamamatsu, Japan). The thrombotic occlusion ofthe middle cerebral artery was induced by the photochemicalreaction using 8-week-old mice weighting 22–26 g (Tanaka et al.2007). Immediately after intravenous injection of photosensitizer,Rose Bengal (20 mg/kg), green light (wavelength: 540 nm) wasilluminated the middle cerebral artery for 10 min. At indicated timesafter the induction of PIT, 2 mm thick coronal slices were incubatedwith 5% triphenyltetrazolium chloride solution at 37°C for 30 min.The volume of the infarction was analyzed on Macintosh computerusing the National Institutes of Health Image program. Experimentswere performed using seven mice in each group.

Cell culture

Mouse neuroblastoma Neuro-2a cells (Cheng et al. 2009) andmouse macrophage-like J774.1 cells (Moreau et al. 2007) werecultured in Dulbecco’s modified Eagle’s medium (Invitrogen Co.,Carlsbad, CA, USA) containing 10% heat-inactivated fetal bovineserum, 50 U/mL penicillin G and 50 U/mL streptomycin, in ahumidified atmosphere with 5% CO2 at 37°C. Human umbilicalvein endothelial cells (HUVEC) (Tanabe et al. 2004) were grownin EGM-2 Bullet Kit (Lonza Co., Allendale, NJ, USA). The viablecell number was counted by microscope in the presence of 0.05%trypan blue. Human hepatocarcinoma FLC-4 cells were cultured asdescribed previously (Kobayashi et al. 2012).

Measurement of PC-Acro, IL-6, CRP, and glutathione

Brain tissue (approximately 20 mg) was homogenized as reportedpreviously (Saiki et al. 2009). The level of PC-Acro [Ne-3-formyl-3,4-dehydropiperidino lysine (FDP-lysine) in protein] was measuredby western blotting (Nielsen et al. 1982) using 20 lg protein andpolyclonal antibody against bovine serum albumin-conjugatedacrolein (MoBiTec, Gottingen, Germany). Protein was determinedby the method of Lowry et al. (1951). The level of PC-Acro inplasma was determined by the method of Uchida et al. (1998) usingACR-Lysine Adduct ELISA System (NOF Corporation, Tokyo,Japan). The level of IL-6 in plasma or in the culture mediumobtained by centrifugation at 500 g for 5 min was determined usingEndogen Human IL-6 ELISA kit (Pierce Biotechnology, Inc.,Rockford, IL, USA) or Mouse IL-6 ELISA kit (Bender MedSys-tems, Inc., Vienna, Austria) according to the manufacturer’sprotocol. The level of CRP in plasma or in the culture mediumwas determined by western blotting using monoclonal antibodyagainst human and mouse CRP (R&D Systems). The level ofglutathione in cells was determined using NWLSS GlutathioneAssay Kit (Northwest Life Science Specialties, Vancouver, WA,USA) according to the manufacturer’s protocol.

Measurement of IL-6 mRNA and its transcription factors

c-Jun and p65 subunit of NF-jBTotal RNA was isolated from 5 9 105 Neuro-2a or macrophage-like J774.1 cells using the TRIzol reagent (Invitrogen), and cDNAwas synthesized using the iScript cDNA synthesis kit (Bio-Rad,Hercules, CA, USA) according to the manufacturer’s protocol. Real-time PCR and data analysis were performed in a total volume of50 lL using 96-well microwell plates and an ABI PRISM 7700sequence detector (Applied Biosynthesis, Foster City, CA, USA)with standardization of levels to the house keeping gene hypoxan-thine phosphoribosyltransferase (HPRT). The primers used were asfollows. IL-6; forward primer (5′-GTCACAGAAGGAGTGGCTA-3′) and reverse primer (5′-AGAGAACAACATAAGTCAGATACC-3′), and HPRT; forward primer (5′-CCTAAGATGAGCGCAAGTTGAA-3′) and reverse primer (5′-CCACAGGACTAGAACACCTGCTAA-3′). SYBR green real-time PCR wasperformed according to the manufacturer’s protocol. Neuro-2a orJ774.1 cells (2 9 106) cultured as described above were suspendedin 0.1 mL of a buffer containing 20 mM Tris/HCl (pH 7.5),150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 50 mM NaF, and0.05 mM FUT-175, and lysed by repeated (three times) freezing andthawing with intermitted mechanical mixing. The supernatant wasobtained by centrifugation at 17 000 g for 15 min and used as celllysate. Levels of c-Jun and p65 subunit of NF-jB and theirphosphorylated forms were determined using western blotting using20 lg cell lysate protein.

Measurement of CRP mRNA and protein

Total RNA was isolated from 5 9 105 human FLC4 hepatocarci-noma cells, and synthesis of cDNA, real-time PCR, and data analysiswere performed as described above. The primers used were asfollows. CRP; forward primer (5′-CACCCAGAAAGGAGAAATGATG-3′) and reverse primer (5′-TGAGAAAGTGGAGGGACTGC-3′), and glyceraldehyde 3-phosphate dehydrogenase(GAPDH); forward primer (5′-GGTATCGTGGAAGGACTCATGAC-3′) and reverse primer (5′-ATGCCAGTGAGCTTCCCGTT

© 2013 International Society for Neurochemistry, J. Neurochem. (2013) 127, 652--659

Increase in synthesis of IL-6 and CRP by acrolein 653

CAGC-3′). The level of CRP in medium was measured by westernblotting using 10 lL of the medium after 24 h culture of FLC4 cells.

Statistics

Values are indicated as mean � SE. Data were analyzed byStudent’s t-test, and a statistical difference was shown by probabilityvalues.

Results

Increase in IL-6 and CRP in plasma together with

increase in PC-Acro in PIT model miceIt was determined whether IL-6 and CRP in plasma increasedtogether with PC-Acro after brain infarction using the PITmodel mice. As shown in Fig. 1a, the size of infarction andthe level of PC-Acro at the locus of the infarction increasedgradually from 6 to 24 h after the onset of infarction in thePIT model mice. Then, the level of PC-Acro, IL-6 and CRPin plasma was measured (Fig. 1b). The level of PC-Acro andCRP in plasma was increased gradually at 6 to 24 h after theonset of brain infarction. However, the level of IL-6 inplasma was the highest at 6 h and gradually decreased until24 h. The level of IL-6 at 24 h was still much highercompared to the level of IL-6 in plasma of control mice.These results suggest that acrolein may first induce IL-6production, and then IL-6 induces CRP production.

Induction of IL-6 production by acrolein, and that of CRP

production by IL-6 in cell culture systems

It has been reported that IL-6 is produced in astrocytes,monocytes, and endothelial cells (Kishimoto 1989). Thus, itwas tested whether acrolein induces IL-6 production usingmouse Neuro-2a cells, mouse macrophage-like J774.1 cells,and HUVEC. Acrolein (25 to 50 lM) inhibited cell growthof Neuro-2a cells, J774.1 cells, and HUVEC, and the degreeof inhibition was slightly different in the order HU-VEC � J774.1 cells > Neuro-2a cells (Fig. 2). Then, thedegree of stimulation of IL-6 production by acrolein wasexamined. As shown in Fig. 2, basal levels of IL-6production (in the absence of acrolein) were differentdependent on cell lines, and the ability to produce IL-6was more than 15 times higher in Neuro-2a cells than J774.1cells and HUVEC. Acrolein (25 and 50 lM) increased IL-6production in all three cell lines, and the degree ofstimulation by 50 lM acrolein at 24 h culture was in theorder J774.1 (2.7-fold) > HUVEC (2.3-fold) > Neuro-2a(twofold).It has been reported that CRP is mainly synthesized in liver

and excreted into blood (Arnaud et al. 2005). Thus, theeffects of acrolein and IL-6 on CRP production wereexamined using human hepatocarcinoma FLC4 cells. It wasconfirmed that 5 and 10 ng/mL IL-6 induced CRP production

(a) Brain

**

*

60

45

30

15

75Western blotting

200250300 ***

*****

***

**456

Rel

ativ

e am

ount

of

PC-A

cro(

FDP-

Lys)

in in

farc

t

(b) Plasma

81012 *

Control 6 h 12 h 24 h

Infarct


Infarct


Infarct


Infarct


Infarct

Infa

rct v

olum

e (m

m3 )

0

*

Western blotting

050

100

0123

IL-6

in p

lasm

a(p

g/m

l pla

sma)

Rel

ativ

e am

ount

of

CR

P in

pla

sma

0246

PC-A

cro(

FDP-

Lys)

in p

lasm

a(n

mol

/ml p

lasm

a)

*

30252015105

35

0

150

Fig. 1 Increase in protein-conjugated acrolein (PC-Acro), IL-6 andC-reactive protein (CRP) in thrombosis model mice. (a) The size ofinfarction and the level of PC-Acro at the locus of infarction, and (b) thelevel of PC-Acro, IL-6 and CRP in plasma were measured at 6, 12, and

24 h after the induction of infarction as described in ‘Materials and

methods’. The level of PC-Acro, IL-6, and CRP was measured using50, 50, and 1 lL plasma, respectively. Data are shown as mean � SEof seven mice. Data were analyzed by Student’s t-test, and a statisticaldifference was shown by probability values. *p < 0.05; **p < 0.01;

***p < 0.001 compared with control mice.


654 R. Saiki et al.

at the level of transcription (Arnaud et al. 2005), but5–20 lM acrolein did not induce CRP production in theabsence or presence of IL-6, which was measured by theCRP level in the medium (Fig. 3). The addition of more than30 lM acrolein to the medium caused severe damage inhuman hepatocarcinoma FLC4 cells (data not shown). Thesefindings support the idea that acrolein induces IL-6 produc-tion, and that IL-6, in turn, induces CRP production.

Mechanism of IL-6 induction by acroleinTo clarify how acrolein increases IL-6 production, the levelof IL-6 mRNA was estimated using real-time PCR. Asshown in Fig. 4b, IL-6 mRNA increased at the early period(3 to 6 h) after the addition of acrolein in both macrophage-like J774.1 cells and HUVEC, and it increased at 24 h inNeuro-2a cells in the presence of 25 and 50 lM acrolein. Ithas been reported that transcription of IL-6 mRNA isstimulated by AP-1 (c-Fos and phosphorylated c-Jun) andNF-jB (p50 and phosphorylated p65) (Ndlovu et al. 2009).As shown in Fig. 4a, there are two AP-1 and one NF-jBrecognized sequences at the upstream of the transcriptionalstarting site of IL-6 gene. Thus, the level of c-Jun,phosphorylated c-Jun, NF-jB p65, and phosphorylatedNF-jB p65 was measured using western blotting, at the periodinwhich themaximal increase in IL-6 mRNA was observed inthree types of cells. It was found that phosphorylation levelof both c-Jun and NF-jB p65 was stimulated significantly by50 lM acrolein in 3 h-treated J774.1 cells, 6 h-treatedHUVEC and in 24 h-treated Neuro-2a cells (Fig. 4c). Theresults indicate that transcription of IL-6 mRNA is enhancedby acrolein through acrolein stimulation of phosphorylationof c-Jun and NF-jB p65.

Protection of acrolein toxicity by IL-6

It was then determined how IL-6 and CRP influence acroleintoxicity in cultured cells. It has been reported that CRPstimulates IL-6 production in neutrophils (Jones et al. 1999)

Cell growth IL-6 production

***

***

*

10Neuro-2a

J774.1 macrophage

**

Cel

l num

ber

(x 1

05 c

ells

/mL)

Cel

l num

ber

(x 1

05 c

ells

/mL)

Cel

l num

ber

(x 1

05 c

ells

/mL)

1

**

***10

**

150

4000

3000

2000

1000

0

150

125

100

100

75

50

50

0

1

HUVEC

12 24Time (h)

12 240

12 24Time (h)

0 12 24Time (h)

12 24Time (h)

0

IL-6

(pg/

mL)

IL-6

(pg/

mL)

IL-6

(pg/

mL)

Time (h)

12 24Time (h)

0

25

***

**

***

**

10

1

(a)

(b)

(c)

Fig. 2 Effect of acrolein on cell growth and IL-6 production in Neuro-2acells (a), J774.1 cells (b), and human umbilical vein endothelial cells(HUVEC) (c). Cells were cultured in the absence and presence of 25 or50 lM acrolein. Cell number or IL-6 in medium was counted or

measured at 12 and 24 h after the onset of cell culture. The volume ofmedium used for IL-6 measurement in Neuro-2a cells, J774.1 cells,and HUVEC was 5, 50, and 50 lL, respectively. Data are shown as

mean � SE of triplicate determinations. *p < 0.05; **p < 0.01;***p < 0.001 compared with cells cultured in the absence of acrolein.

RT-PCRIL-6 (ng/mL) – – – – 5 10 10 10 10

5 10 10 10 10

Acro ( M) – 5 10 20 5 10 20

5 10 20 5 10 20

– –

CRP

GAPDH

Western blotting

GAPDH

IL-6 (ng/mL)

Acro ( M)

–

–

– – –

– –

CRP

(a)

(b)

Fig. 3 Increase in C-reactive protein (CRP) production by IL-6 inhepatocarcinoma FLC4 cells. FLC4 cells were cultured for 24 h in theabsence and presence of either 5 or 10 ng/mL IL-6 and/or 5, 10, or

20 lM acrolein as shown in the figure. The level of CRP mRNA in cells(a) and CRP protein in the medium (b) was measured as described in‘Materials and methods’ using RT-PCR and western blotting, respec-tively.



and whole blood samples (Asanuma et al. 2008). Thus, wetested whether CRP stimulates IL-6 production in thepresence and absence of acrolein. As shown in Fig. 5,CRP led to increased IL-6 production in macrophage-likeJ774.1 cells and HUVEC, an effect that was enhanced in thepresence of 40 lM acrolein. The effect of CRP was moreclearly obtained in macrophage-like J774.1 cells thanHUVEC. CRP did not stimulate IL-6 production of Neuro-2a cells in the presence and absence of 40 lM acrolein (datanot shown), probably due to the high expression of IL-6 inNeuro-2a cells.It was then determined whether IL-6 protects acrolein

toxicity or not. For this purpose, an antibody against IL-6was added to the culture medium of Neuro-2a cells andHUVEC. Addition of antibody against IL-6 did not influencethe cell growth of Neuro-2a cells and HUVEC withoutacrolein, but it inhibited the cell growth of Neuro-2a cellsand HUVEC cultured in the presence of 20 lM acrolein(Fig. 6a). Increase in cell toxicity by an antibody against IL-6 was parallel with the decrease in glutathione content incells (Fig. 6b), which is a major detoxicating compound foracrolein in cells (Yoshida et al. 2012). Similar results were

obtained with human neuroblastoma SH-SY5Y cells and ratpheochromocytoma PC12 cells (data not shown). Antibodyagainst IL-6 did not inhibit the cell growth of J774.1 cells inthe presence of acrolein (data not shown), suggesting thatexpression of IL-6 receptor in J774.1 cells may be somehowreduced. The results indicate that IL-6 protects acroleintoxicity of several types of cells including Neuro-2a cells andHUVEC, and CRP indirectly protects acrolein toxicityagainst Neuro-2a cells through stimulation of IL-6 produc-tion from macrophage-like or endothelial cells such as J774.1cells and HUVEC.

Discussion

In this study, it was examined whether acrolein producedfrom spermine, which is released from damaged cells duringbrain infarction (Saiki et al. 2011), triggers the production ofIL-6 and CRP. Using the PIT model mice and cultured cells,it became clear that acrolein induces IL-6 production, andthen IL-6 induces CRP production. The results support theidea that detection of SBI with high sensitivity and specificity(Yoshida et al. 2010) is possible by measuring PC-Acro,

TGAGTCTGGGATTTTCCTGAGTCT IL-6 geneAP-1

(–296 to –290)NF-κκB

(–92 to –82)AP-1

(–79 to –73)

(b)

(a)

RT-PCR of IL-6 mRNA (c) Western blotting of transcription factors

Time (h)Neuro-2a J774.1 HUVEC0 μM 25 μM 50 μM

+ +

324

––50 μM Acro

c-Jun

1 0 0 1 2 0 0 11 0 0 1 1 6 0 1

+

6

–

1 0 0 2 3 1 0 1

Neuro-2a J774.1**

*

HUVEC20

***4

5 6

5

Phospho-c-Jun

. + . : . + .

1.0 + 0.1 : 3.1 + 0.2

. + . : . + .

1.0 + 0.1 : 2.2 + 0.1

Relative ratio . + . : . + .

1.0 + 0.3 : 7.6 + 0.5

**

**

*

15

10

*

3

23

2

4

*

p65

Phospho-1.0 + 0.1 : 1.4 + 0.11.0 + 0.1 : 1.1 + 0.1 1.0 + 0.1 : 0.9 + 0.1

0

5

Rel

ativ

e am

ount

of I

L-6

0

1

6 12 240

1

3 6 9 3 6 9

p651.0 + 0.1 : 1.8 + 0.11.0 + 0.1 : 1.8 + 0.1 1.0 + 0.3 : 6.2 + 0.1

Time (h) Time (h) Time (h)

c-Fos c-Jun p50 p65 c-Fos c-Jun

P P P

Fig. 4 Increase in the levels of IL-6 mRNA and of phosphorylation of

transcription factors c-Jun and NF-jB p65 in the presence of acrolein.(a) Nucleotide sequences and sites for AP-1 and NF-jB recognitionon the upstream of IL-6 gene are shown. (b) Level of IL-6 mRNA in

Neuro-2a and J774.1 cells, and human umbilical vein endothelial cells(HUVEC) cultured for different hours shown in the figure in the

absence and presence of 25 or 50 lM acrolein was presented as IL-

6/HPRT. *p < 0.05; **p < 0.01; ***p < 0.001 compared with cellscultured in the absence of acrolein. (c) Levels of c-Jun, NF-jB p65and their phosphorylated forms were measured using western

blotting. Experiments were repeated three times, and the resultswere reproducible.


656 R. Saiki et al.

IL-6, and CRP in plasma of SBI patients. The data alsosupport a previous report that IL-6 and CRP increase inplasma of SBI patients (Hoshi et al. 2005). At present, thecombined measurements of these three markers, that is,PC-Acro, IL-6, and CRP, are the only reliable biochemicalmarkers for SBI. Therefore, these biochemical markerscontribute greatly to identify brain infarction at the earlyperiod and for application of suitable therapies.Our data confirmed previous reports that IL-6 protects

brain tissues (or cells) against infarction (Fujita et al. 2009).This was actually because of the decrease in acrolein toxicityby IL-6 (see Fig. 6). With regard to CRP, it was previouslynoted that there is a link between plasma CRP and the degreeof atherosclerosis (Sun et al. 2005). The results also suggest

that decrease in plasma CRP may represent a therapeuticmodality for the treatment of atherosclerosis (Sun et al.2005). Our results also indicate that CRP increases IL-6production in endothelial and macrophage-like cells espe-cially in the presence of 40 lM acrolein, which is a newaspect of CRP function. Increased levels of IL-6, in turn,decreased the toxicity of acrolein, which is also a new findingin this study.In the thrombosis model mice, the increase in IL-6 was

observed at the early period of brain infarction. Thus, theincrease in IL-6 production by macrophages and veinendothelial cells which occurred at the early period duringcell culture in the presence of acrolein may be more stronglyinvolved in the protection of tissue damage during brain

Neuro-2a(a) HUVEC

406080

100120

* **

None 20 µM Acro

406080

100120

*

None 20 µM Acro

020C

ell s

urvi

val

(% o

f con

trol

)

Neuro-2a

020 **Cel

l sur

viva

l(%

of c

ontr

ol)

HUVEC(b)None 20 µM Acro

* *10

20

3035

None 20 µM Acro

1015202530

***

35

15

25

GSH

(nm

ol/m

g pr

otei

n)

0

Anti-IL-6 (µg/mL)0 3 10 30 0 3 10 30

05

GSH

(nm

ol/m

g pr

otei

n)

Anti-IL-6 (µg/mL)0 1 3 10 0 1 3 10

Anti-IL-6 (µg/mL)0 3 10 30 0 3 10 30

Anti-IL-6 (µg/mL)0 1 3 10 0 1 3 10

5

Fig. 6 Increase in cell viability by IL-6 inNeuro-2a cells and human umbilical vein

endothelial cells (HUVEC) cultured in thepresence of acrolein. Mouse Neuro-2a cellsand HUVEC were cultured in the absence

and presence of 20 lM acrolein andvarious amounts of mouse and humananti-IL-6 antibodies shown in the figure,

and the cell number was counted at 24 hafter the onset of cell culture. (a) Acroleintoxicity was enhanced by anti-IL-6 antibody.(b) Glutathione content was measured

as described in ‘Materials and methods’.Data are shown as mean � SE oftriplicate determinations. *p < 0.05; **p <

0.01 compared with cells cultured in theabsence of anti-IL-6 antibody.

150

HUVECNone 40 µM Acro250

J774.1None 40 µM Acro

60

90

120

*** **

** ****

IL-6

(pg/

mL)

***

100

150

200IL

-6 (p

g/m

L)

***

***

*

***

0

30

0 25 50 100 0 25 50 100

CRP (µg/mL)CRP (µg/mL)

0

50

0 10 20 40 0 10 20 40

Fig. 5 Increase in IL-6 production by C-reactive protein (CRP) inJ774.1 cells and human umbilical vein endothelial cells (HUVEC).J774.1 cells and HUVEC were cultured for 24 h in the absence andpresence of 40 lM acrolein and various concentrations of CRP shown

in the figure, and the level of IL-6 in the medium was measured.

The volume of medium used for IL-6 measurement was 50 lL. Dataare shown as mean � SE of triplicate determinations. *p < 0.05;**p < 0.01; ***p < 0.001 compared with cells cultured in the absence ofCRP.



infarction than the increase in IL-6 production by neuronswhich occurred at the relatively late period during cell culturein the presence of acrolein.It is of interest to know how acrolein increases IL-6

production. Although acrolein is toxic to cells, it increasedphosphorylation of c-Jun and NF-jB p65, which areinvolved in the transcription of IL-6 mRNA. Acrolein mayincrease an activity of a protein kinase which catalyzes thephosphorylation of c-Jun and NF-jB p65 through modifica-tion of cysteine or lysine residue. In this respect, we haverecently reported that phosphorylation of JNKs (c-junN-terminal kinases), which catalyze phosphorylation of c-junand NF-jB p65, was increased in acrolein toxicity-decreasingNeuro-2a cells (Tomitori et al. 2012). Experiments are inprogress to determine which kinase is actually activated byacrolein.Decrease in acrolein toxicity by IL-6 was observed in

several types of cells including Neuro-2a cells and HUVEC.Furthermore, the level of IL-6 production in Neuro-2a cellswas much greater than that in macrophage-like J774.1 cellsand HUVEC. These results suggest that IL-6 is stronglyinvolved in detoxication of acrolein in neurons.Measurement of PC-Acro together with IL-6 and CRP

made it possible to identify SBI with high sensitivity andspecificity. In this study, we tried to clarify how acroleininduces the synthesis of IL-6 and CRP. It was found thatacrolein increased IL-6 synthesis and then IL-6 increasedCRP synthesis at the level of transcription. It also becameclear that IL-6 decreases acrolein toxicity in several types ofcells, and CRP enhances IL-6 production in macrophage-likeJ774.1 cells and HUVEC (Fig. 7).Acrolein was thought of as one of the toxic compounds

produced from unsaturated fatty acids by reactive oxygenspecies (ROS) such as superoxide anion radical (O2_

�),hydrogen peroxide (H2O2), and hydroxyl radical (_OH)(Uchida et al. 1998). However, we found that it was more

effectively produced from polyamines (spermine and sper-midine) (Tomitori et al. 2005). The proposed mechanism ofinefficient formation of acrolein from arachidonic acid(Esterbauer et al. 1991) and experimental results on ineffi-cient production of acrolein from arachidonic acid (Bradleyet al. 2010) also support the idea that acrolein is preferen-tially produced from polyamines, rather than from unsatu-rated fatty acids by lipid peroxidation.

Acknowledgements

We thank Drs. A. J. Michael and K. Williams for their help inpreparing the manuscript. This study was supported by a Grant forChiba Serum Institute Memorial Foundation, Chiba, Japan, and aGrant-in-Aid for Scientific Research from the Ministry of Education,Culture, Sports, Science and Technology, Japan. The authors haveno conflict of interest.

References

Arnaud C., Burger F., Steffens S., Veillard N. R., Nguyen T. H., TronoD. and Mach F. (2005) Statins reduce interleukin-6-induced C-reactive protein in human hepatocytes: new evidence for directantiinflammatory effects of statins. Arterioscler. Thromb. Vasc.Biol. 25, 1231–1236.

Asanuma Y., Oeser A., Stanley E., Bailey D. G., Shintani A. and SteinC. M. (2008) Effects of C-reactive protein and homocysteine oncytokine production: modulation by pravastatin. Arch. Drug Inf. 1,14–22.

Bokura H., Kobayashi S., Yamaguchi S., Iijima K., Nagai A., ToyodaG., Oguro H. and Takahashi K. (2006) Silent brain infarction andsubcortical white matter lesions increase the risk of stroke andmortality: a prospective cohort study. J. Stroke Cerebrovasc. Dis.15, 57–63.

Bradley M. A., Markesbery W. R. and Lovell M. A. (2010) Increasedlevels of 4-hydroxynonenal and acrolein in the brain in preclinicalAlzheimer disease. Free Radic. Biol. Med. 48, 1570–1576.

ChengY.C., LiangC.M.,ChenY. P., Tsai I. H.,KuoC.C. andLiangS.M.(2009) F-spondin plays a critical role in murine neuroblastomasurvival by maintaining IL-6 expression. J. Neurochem. 110,947–955.

Esterbauer H., Schaur R. J. and Zollner H. (1991) Chemistry andbiochemistry of 4-hydroxynonenal, malonaldehyde and relatedaldehydes. Free Radic. Biol. Med. 11, 81–128.

Fujita T., Tozaki-Saitoh H. and Inoue K. (2009) P2Y1 receptor signalingenhances neuroprotection by astrocytes against oxidative stress viaIL-6 release in hippocampal cultures. Glia 57, 244–257.

Higashi K., Terui Y., Suganami A., Tamura Y., Nishimura K.,Kashiwagi K. and Igarashi K. (2008) Selective structural changeby spermidine in the bulged-out region of double-stranded RNAand its effect on RNA function. J. Biol. Chem. 283, 32989–32994.

Higashi K., Yoshida M., Igarashi A. et al. (2010) Intense correlationbetween protein-conjugated acrolein and primary Sjogren’ssyndrome. Clin. Chim. Acta 411, 359–363.

Hoshi T., Kitagawa K., Yamagami H., Furukado S., Hougaku H. andHori M. (2005) Relations of serum high-sensitivity C-reactiveprotein and interleukin-6 levels with silent brain infarction. Stroke36, 768–772.

Igarashi K. and Kashiwagi K. (2010) Modulation of cellular function bypolyamines. Int. J. Biochem. Cell Biol. 42, 39–51.

Acrolein(Brain)

Induction Protection

IL-6(Brain, Macrophage, Endothelium)

CRP

Induction Induction

(Liver)

Fig. 7 Schematic flow from acrolein production during brain infarctionto C-reactive protein (CRP) production in hepatocytes. Acrolein

induces IL-6 production in brain, macrophages, and endothelial cells,and IL-6 induces CRP production in hepatocytes. Then, CRP stimu-lates IL-6 production, and IL-6 decreases acrolein toxicity.


658 R. Saiki et al.

Igarashi K. and Kashiwagi K. (2011) Protein-conjugated acrolein as abiochemical marker of brain infarction. Mol. Nutr. Food Res. 55,1332–1341.

Igarashi K., Ueda S., Yoshida K. and Kashiwagi K. (2006) Polyaminesin renal failure. Amino Acids 31, 477–483.

Inoue K., Matsumoto M., Shono T., Toyokawa S. and Moriki A. (2007)Increased intima media thickness and atherosclerotic plaques in thecarotid artery as risk factors for silent brain infarcts. J. StrokeCerebrovasc. Dis. 16, 14–20.

Jones S. A., Novick D., Horiuchi S., Yamamoto N., Szalai A. J. andFuller G. M. (1999) C-reactive protein: a physiological activator ofinterleukin 6 receptor shedding. J. Exp. Med. 189, 599–604.

Kishimoto T. (1989) The biology of interleukin-6. Blood 74, 1–10.Kobayashi S., Okada K., Koide H., Bokura H. and Yamaguchi S. (1997)

Subcortical silent brain infarction as a risk factor for clinical stroke.Stroke 28, 1932–1939.

Kobayashi K., Yoshida A., Ejiri Y., Takagi S., Mimura H., Hosoda M.,Matsuura T. and Chiba K. (2012) Increased expression of drug-metabolizing enzymes in human hepatocarcinoma FLC-4 cellscultured on micro-space cell culture plates. Drug Metab.Pharmacokinet. 27, 478–485.

Lowry O. H., Rosebrough N. J., Farr A. L. and Randall R. J. (1951)Protein measurement with the Folin phenol reagent. J. Biol. Chem.193, 265–275.

Moreau M. F., Guillet C., Massin P., Chevalier S., Gascan H., Basle M.F. and Chappard D. (2007) Comparative effects of fivebisphosphonates on apoptosis of macrophage cells in vitro.Biochem. Pharmacol. 73, 718–723.

Ndlovu M. N., Van Lint C., Van Wesemael K., Callebert P., Chalbos D.,Haegeman G. and Vanden Berghe W. (2009) Hyperactivated NF-jB and AP-1 transcription factors promote highly accessiblechromatin and constitutive transcription across the interleukin-6gene promoter in metastatic breast cancer cells. Mol. Cell. Biol. 29,5488–5504.

Nielsen P. J., Manchester K. L., Towbin H., Gordon J. and Thomas G.(1982) The phosphorylation of ribosomal protein S6 in rat tissuesfollowing cycloheximide injection, in diabetes, and afterdenervation of diaphragm. A simple immunologicaldetermination of the extent of S6 phosphorylation on proteinblots. J. Biol. Chem. 257, 12316–12321.

Saiki R., Nishimura K., Ishii I., Omura T., Okuyama S., Kashiwagi K.and Igarashi K. (2009) Intense correlation between brain infarctionand protein-conjugated acrolein. Stroke 40, 3356–3361.

Saiki R., Park H., Ishii I. et al. (2011) Brain infarction correlates moreclosely with acrolein than with reactive oxygen species. Biochem.Biophys. Res. Commun. 404, 1044–1049.

Sharmin S., Sakata K., Kashiwagi K., Ueda S., Iwasaki S., Shirahata A.and Igarashi K. (2001) Polyamine cytotoxicity in the presence ofbovine serum amine oxidase. Biochem. Biophys. Res. Commun.282, 228–235.

Sun H., Koike T., Ichikawa T. et al. (2005) C-reactive protein inatherosclerotic lesions: its origin and pathophysiologicalsignificance. Am. J. Pathol. 167, 1139–1148.

Tanabe M., Tabuchi S., Iwatsuki M., Kurosaki M., Kamitani H., YokotaM. andWatanabeT. (2004) Incorporation of arachidonic and linoleicacid hydroperoxides into cultured human umbilical vein endothelialcells. Prostaglandins Leukot. Essent. Fatty Acids 70, 485–489.

Tanaka Y., Marumo T., Omura T. and Yoshida S. (2007) Quantitativeassessments of cerebral vascular damage with a silicon rubbercasting method in photochemically-induced thrombotic stroke ratmodels. Life Sci. 81, 1381–1388.

Tomitori H., Usui T., Saeki N., Ueda S., Kase H., Nishimura K.,Kashiwagi K. and Igarashi K. (2005) Polyamine oxidase andacrolein as novel biochemical markers for diagnosis of cerebralstroke. Stroke 36, 2609–2613.

Tomitori H., Nakamura M., Sakamoto A., Terui Y., Yoshida M.,Igarashi K. and Kashiwagi K. (2012) Augmented glutathionesynthesis decreases acrolein toxicity. Biochem. Biophys. Res.Commun. 418, 110–115.

Uchida K., Kanematsu M., Morimitsu Y., Osawa T., Noguchi N. and NikiE. (1998) Acrolein is a product of lipid peroxidation reaction.Formation of free acrolein and its conjugate with lysine residues inoxidized low density lipoproteins. J. Biol. Chem. 273, 16058–16066.

Vermeer S. E., Longstreth W. T. Jr and Koudstaal P. J. (2007) Silentbrain infarcts: a systematic review. Lancet Neurol. 6, 611–619.

Waragai M., Yoshida M., Mizoi M. et al. (2012) Increased protein-conjugated acrolein and amyloid-b40/42 ratio in plasma of patients withmild cognitive impairment andAlzheimer’s disease. J. Alzheimers Dis.32, 33–41.

Yoshida M., Higashi K., Kobayashi E. et al. (2010) Correlation betweenimages of silent brain infarction, carotid atherosclerosis and whitematter hyperintensity, and plasma levels of acrolein, IL-6 and CRP.Atherosclerosis 211, 475–479.

Yoshida M., Mikami T., Higashi K. et al. (2012) Inverse correlationbetween stroke and urinary 3-hydroxypropyl mercapturic acid, anacrolein-glutathione metabolite. Clin. Chim. Acta 413, 753–759.



acrolein stimulates the synthesis of il-6 and c-reactive protein (crp) in thrombosis model mice and...

Documents