—course #27611 project - dtu...and high density of the arrays, hybridization volumes of 2...
TRANSCRIPT
![Page 1: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/1.jpg)
DNA Microarray Bioinformatics—Course #27611 Project
“It’s not just the genes we have—It’s how we use them”
Jeppe Skytte SpickerCarsten Friis
Media
GlnA
glnA
TnrA
GlnR
C2
tnrA
glnR C3 C5 C6
C1 C4 C7
K
![Page 2: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/2.jpg)
Course web page
http://www.cbs.dtu.dk/dtucourse/data.php
Course programLecture Slides
ExercisesProject Data Sets
Link to the GenePublisher tool
![Page 3: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/3.jpg)
Course Program – Eight Tuesdays
Tuesday 15/3 (today)Intro to Microarray
Tuesday 29/3Normalization and Statistical Analysis
Tuesday 5/4Clustering, PCA and classification
Tuesday 12/4 Tuesday 19/4Writing on your own Q&A session + exercise
Tuesday 26/4 Tuesday 3/5Writing on your own* Writing on your own*
Tuesday 10/5Hand in report before 17:00 to Rasmus Wernersson
*Jeppe and Carsten will be available to answer questions from 13:00-17:00
![Page 4: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/4.jpg)
Introduction to Microarrays
![Page 5: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/5.jpg)
Microarrays – Test Questions
1. Microarrays measure the expression levels of genes. But how?
![Page 6: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/6.jpg)
The Central Dogma
![Page 7: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/7.jpg)
Microarrays measure mRNA concentrations
gene specific DNA probeslabeled target
gene
mRNA
![Page 8: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/8.jpg)
Microarrays – Test Questions
2. Fine, probes bind mRNA, But what’s this process called?
![Page 9: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/9.jpg)
Hybridization
A
A
AT
TG
GC
C
T
AT
GA
TGC
C
T
AT
GA
TGC
C
A
A
AT
TG
GC
C
![Page 10: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/10.jpg)
Microarrays – Test Questions
3. Ok, hybridization. But how many genes can then hybridize to one array slide?
![Page 11: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/11.jpg)
Microarrays are a high-throughput method
Measure the level of transcript from a
a complete genome in one go
CELL
RNA
![Page 12: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/12.jpg)
Microarrays – Test Questions
4. Gee, thousands then? Neat, but what is this sample and control stuff?
![Page 13: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/13.jpg)
Experiment setup – Sample preparation
1. Design experimentQuestion?Replicates?Test?
2. Perform experimentwild type
mutant
3. Precipitate RNAEukaryote/prokaryote?Cell wall?
4. Label RNAAmplification?Direct or indirect?Label?
![Page 14: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/14.jpg)
Microarrays – Test Questions
5. Ok, so we search for changes in expression; fine, but which technologies are most popular for this?
![Page 15: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/15.jpg)
Microarrays - The Technologies
Stanford Microarrays
Affymetrix
![Page 16: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/16.jpg)
Microarrays – Test Questions
6. Stan & Affy it is; Now, what characterizes the Stanford technology?
![Page 17: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/17.jpg)
The Stanford cDNA Microarrays
![Page 18: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/18.jpg)
Science. 1995 Oct 20;270(5235):467-70.
Quantitative monitoring of gene expression patterns with a complementary DNA microarray.
Schena M, Shalon D, Davis RW, Brown PO.
Department of Biochemistry, Beckman Center, Stanford University Medical Center, CA 94305, USA.
A high-capacity system was developed to monitor the expression of many genes in parallel. Microarrays prepared by high-speed robotic printing of complementary DNAs on glass were used for quantitative expression measurements of the corresponding genes. Because of the small format and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived from 2 micrograms of total cellular messenger RNA. Differential expression measurements of 45 Arabidopsis genes were made by means of simultaneous, two-color fluorescence hybridization.
PMID: 7569999 [PubMed - indexed for MEDLINE]
![Page 19: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/19.jpg)
Making Microarrays
1. Produce probes• oligos• cDNA library• PCR products
2. Print (spotting) by the use of a robot
![Page 20: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/20.jpg)
Spotting – Mechanical deposition of probes
![Page 21: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/21.jpg)
16-pin microarray spotter
![Page 22: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/22.jpg)
mRNAmRNA
cDNAcDNA
Cy3-cDNACy5-cDNA
SAMPLE CONTROL
Stanford microarrays
DESIGN
and ORDER
PROBES
![Page 23: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/23.jpg)
Microarrays – Test Questions
7. So, I guess that was Stan. What then characterizes the Affy technology?
![Page 24: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/24.jpg)
AffymetrixTM GeneChipsTM
![Page 25: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/25.jpg)
Affymetrix GeneChip® oligonucleotide array
11 to 20 oligonucleotide probes for each gene
On-chip synthesis of 25’mers
~20.000 genes per chip
good quality data – low variance
![Page 26: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/26.jpg)
Catalog Arrays
HumanMouseRat ArabidopsisC. elegansCanineDrosophila
E. coliP. aeruginosaPlasmodium/AnophelesVitis vinifera (Grape) Xenopus laevisYeastZebrafish
NimbleExpress™ Array Program
![Page 27: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/27.jpg)
Fluidic Station and ScannerFluid station and scanner
![Page 28: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/28.jpg)
TTT
T
T
TT
T
T
T
A
A
AA
A
A
A
AAAMask #1Mask #2
Photolithographyin situ synthesis
Spacers bound to surface with photolabile protection groups
![Page 29: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/29.jpg)
Photolithography - Micromirrors
NimbleExpress™ Array Program
![Page 30: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/30.jpg)
The Technologies - Cost
Facility setup:Stanford Microarrays < 100,000 USDAffymetrix < 250,000 USD
Cost pr. array Stanford Microarrays 30-50 USDAffymetrix 300-400 USD
NimbleExpress™ Array Program - a bit more expensive
![Page 31: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/31.jpg)
The Technologies - Data Quality
Reproducibility of data:(Pearson’s correlation coefficient)
– Stanford microarrays: 0.80 - 0.95
– Affymetrix: ≈ 0.95
![Page 32: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/32.jpg)
Microarrays – Test Questions
8. And that’s Affy folks; Well, except, what was that about several probes pr. gene? How does that work?
![Page 33: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/33.jpg)
How probe sets bind
5’ 3’Probes bind to different positions on the same gene
Regions not suitable for probeseg. BLAST hits >75% & longer than 15bp25 bp
![Page 34: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/34.jpg)
Microarrays – Test Questions
9. Ok, then that must be the end for Affy, right? Or, what was that again about PM & MM probes?
![Page 35: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/35.jpg)
Affymetrix uses PM & MM probes
- Perfect Match (PM)- MisMatch (MM)
PM: CGATCAATTGCACTATGTCATTTCT MM: CGATCAATTGCAGTATGTCATTTCT
![Page 36: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/36.jpg)
Microarrays – Test Questions
Great, and the MM’s don’t work, so Affy have wasted half of the chip. Cool going, dudes.
• And so we come to the final question, what to do about all that noise (or, why are microarrays such a bother to analyze)?
![Page 37: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/37.jpg)
The DNA Array Analysis Pipeline
QuestionExperimental Design
Array designProbe design
Sample PreparationHybridization
Buy Chip/Array
ComparableGene Expression Data
Normalization
Image analysis
Expression IndexCalculation
Statistical AnalysisFit to Model (time series)
Advanced Data AnalysisClustering PCA Classification Promoter Analysis Regulatory Network
![Page 38: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/38.jpg)
Facts on your project
We have three data sets for you to choose between– Bladder Cancer, HIV, Leukemia
Your report should as a minimum demonstrate that you have understood the basic principles of the microarray technology and data analysis– That is, after all, the core of the course
You should preferably also demonstrate some understanding of the biological problems behind the data set you choose– Because data are more than just numbers
To get the very highest grades you must demonstrate ability to formulate your data analysis in biological terms– i.e. don’t just talk statistics – what does the numbers mean to the cell?
![Page 39: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/39.jpg)
Study of Bladder Cancer
Identify differences between different stages/types of bladder cancer based on DNA chips run on a biopsy.
From the biopsy RNA is extracted and run on a GeneChip. The biopsy is also given to histopathologist, who use a microscope to evaluate and stage the suspicious growth into: – Superficial Ta– Intermediate T1– Invasive T2-T4
The purpose here is to identify differences in gene expression between these stages.– To learn more about the disease and its progression– To classify tumors based on a biopsy
(This data has been gathered by Skejby Sygehus and it cannot be used without their permission)
![Page 40: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/40.jpg)
Study of HIV
The purpose of this study is to measure the effect of HIV-1 on the transcription of genes in the infected host cell.
The human cell line MT4 was infected in vitro with HIV-1 and compared to control cultures grown without HIV-1 infection. – Thus, we have two classes, sick and healthy
After 7 days of growth of both cultures, cells were harvested and RNA was extracted and run on Affymetrix chips.– The purpose being to identify genes relevant to the HIV disease
Replicates were performed to assure reproducibility and allow measurement of experimental variation.
![Page 41: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/41.jpg)
Study of Childhood Leukemia
Diagnostic bone marrow samples from leukemia patientsPlatform: Affymetrix Focus Array
– 8793 human genes Immunophenotype
– 18 patients with precursor B immunophenotype– 17 patients with T immunophenotype
Outcome 5 years from diagnosis– 11 patients with relapse– 18 patients in complete remission
Paper out in Leukemia:“Prediction of immunophenotype, treatment response, and
relapse in childhood acute lymphoblastic leukemia using DNA microarrays”
![Page 42: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/42.jpg)
How do we do the final four days?
There is the Q&A session– Where we run through a GenePublisher exercise– And you can ask us to elaborate on topics you just
didn’t get the first time
And there is the advisory task– As best we are able Jeppe and Carsten will be
available for questioning– But there’s four of you and two of us
![Page 43: —Course #27611 Project - DTU...and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived](https://reader035.vdocuments.us/reader035/viewer/2022071608/614623f98f9ff81254201292/html5/thumbnails/43.jpg)
Student Accounts
AccountMaja, Cathrine, Søren msc01Sarah, Henrik, Anne, Ingeborg msc02Thomas, Nikolaj, David msc03Simi, Bakhtiar, Henrikas msc04
Password: