achieving secrecy for images using in-vivo dna cloning techniques

8/13/2019 Achieving Secrecy for Images Using in-vivo DNA Cloning Techniques

http://slidepdf.com/reader/full/achieving-secrecy-for-images-using-in-vivo-dna-cloning-techniques 1/10

International Journal of Advanced Computer Science, Vol. 1, No. 6, Pp. 240-249, Dec. 2011.

ManuscriptReceived:

25, Sep., 2011

Revised:

21, Nov., 2011

Accepted:

15, Dec., 2011

Published: 15, Jan., 2012

Keywords bacteriophage

lambda,

watermarking,

Information

hiding,

DNA

computing,

E.coli

bacteria,

Data deletion

Cloning,

Mutation

Abstract Genetically engineered

machines take advantage of the

computational power of DNA and seem to be

promising in the future of computers. In this

paper a solution has been proposed and

simulated for securing images in the context

of DNA computing. A total of three

genetically engineered machines have been

proposed for hiding, watermarking and

deletion of images using cloning techniques

in genetic engineering. Our proposed

methods have numerous advantages over the

previously proposed methods. In the

proposed watermarking scheme the size of

the watermark picture, in contrast to the

previously proposed schemes has no limit in

size and takes place naturally and the

proposed in-vivo data deletion procedure

utilizes a one-sided natural process and in

spite of the case for data deletion in silicon

computers it is guaranteed to be leakage

free.

1. Introduction

Biomolecules constitute fundamental basis for

architecture of life on the earth. Their great potential can be

easily versified by observing the complexity of different

organisms on our planet. Of these molecules, DNA

(deoxyribonucleic acid) is assumed as the biochemical basis

of heredity in all organisms and in spite of being

constructed from only four kinds of nucleotides, it isconjectured as the reason for all the existing complexity and

diversity in living beings of nature.

The physical potential of DNA molecules for

computational purposes was first shown by Adleman [1]during his historical experiment of solving the Hamiltonian

path problem which is an NP-complete problem using

synthetic DNA parts and appropriate encoding and

programming these molecules to find the answer of this problem. He discovered some intrinsic properties associated

with DNA molecules such as the ability to hide information

or the massive parallelism inherent in these molecules.

Based on the work of Kari et al., the ability of DNA

This work was done in Iran University of Science and Technology and

was financially supported by the Iran Telecommunication Research Centre

(ITRC).

Arash Karimi and Hadi Shahriar Shahhoseini are with Iran University

of Science and Technology (Emails: [email protected],

[email protected] ())

molecules to do computations dates back to millions ofyears ago when a species of protozoa (ciliated protozoa)

solved a problem like finding a Hamiltonian path in a graph

[2], [3]. The outstanding work of Tom Head [4] in finding

the Turing powerful potential of operation of splicing theDNA strands supports the ideas of Adleman from his

practical experiments that it may be possible to build a

universal Turing machine based on operations and materials

constructed merely from biological parts. Based on thesetheoretical basis as well as practical and experimental

abilities of genetic engineering and biotechnological

discipline, many efforts have been accomplished to

construct finite automata and simple Turing machines from biological units and based on genetic engineering principles.

Some DNA computing models were also proposed which

simulate Turing machines. Some of the most outstanding

works in this direction can be stated as follows. In [5] somechallenges in designing a molecular computer are discussed.

In [6] mutagenesis as the basis for designing and

implementation of molecular computers is considered. The

first leap towards implementation of in-vivo finite automata

was taken in 2004 by Shapiro et al. [7] which candistinguish between strings having odd number versus even

number of input symbols. Since the initial papers and

personalities who initiated this interdisciplinary area were

cryptologists or computation theorists and because of the

similarity of the nature of genetic codes and cryptology,

providing security using biomolecules received much

attention from the first proposed papers in this area. Forinstance, implementation of the only

information-theoretically secure cipher, the Vernam

One-time pad scheme, using DNA molecules was proposed

by Gehani et al. [8]. A molecular computer scheme to breakThe Data Encryption Standard [9] based on in-vitro

synthetic DNA manipulation was proposed by Boneh et al.and afterwards by Adleman in [10] and [11] respectively.

DNA chip-based implementation of a steganographyscheme was proposed in [8]. We previously introduced

in-vivo solutions for multiclient authentication and a

watermarking scheme in [12] and [13].

In this paper, we propose in-vivo security mechanisms

which can be most suitable for securing images. The first

proposed system is an in-vivo solution for hiding

information which is generally applicable for hiding images

as well as steganography. In the second scheme, a

watermarking scheme has been introduced in which we use

the infection procedure of the E. coli bacteria with phage

lambda as our model. The third proposed scheme also deals

with annihilation of the information in-vivo which has

Achieving Secrecy for Images Using in-vivo DNA

Cloning TechniquesArash Karimi & Hadi Shahriar Shahhoseini



Arash Karimi et al .: Achieving Secrecy for Images Using in-vivo DNA Cloning Techniques

International Journal Publishers Group (IJPG) ©

241

motifs from the Lytic cycle of infection of E. coli.

The first proposed scheme gives an in-vivo solution for

hiding messages which can be thought of as an important

secrecy primitive in DNA-based computers.

We utilize the infection procedure of E. coli bacterium as a

motive to introduce two other security mechanisms inDNA-based computers in which the state of reproduction of

viruses in E. coli defines the secrecy mechanism (Lysogeny

and Lytic cycle for watermarking and data deletion

primitives respectively).

A novel coding algorithm for encoding information into

cells of a living-being is also proposed which is based on

the multiform property of amino acids.

The rest of this paper is organized as follows. In Section 2,

the preliminary background is reviewed. Section 3 gives an

overview of the proposed schemes and the information

hiding scheme, the watermarking scheme and dataannihilation procedure are discussed respectively. Section 4

describes simulation results. Section 5 provides a securityanalysis for security of the proposed schemes and in Section

6, conclusions are drawn.

2. Preliminary Background

In this Section for conceiving the relationship betweenthe proposed schemes and their motifs in biological

phenomena we discuss the power of genetic code table for

encoding the data as well as natural processes in which E.

coli bacteria is infected with phage lambda.

A. Genetic Code

In the following, we describe an interesting property ofthe genetic code which can be considered as a fertile ground

to base the proposed scheme for encoding data in DNA

nucleotides. This interesting property which can be utilized

for encoding data in a DNA sequence can be seen in the

genetic code table of Fig. 1. Three consecutive nucleotides

in the DNA sequence of a gene form a codon that defines an

amino acid which is then translated to a functional protein.

All in all, there exist 20 amino acids in different life forms

on the earth but we can make 64 possible forms from

different combinations of four bases in a codon. As a

consequence, each codon can have more than three possible

forms which makes a redundancy. In other words, there areat least three possible codon forms for each amino acid

which is then translated into a single protein. So the

phenotype does not change even if we change the sequence

common to each amino acid. What we can see in Fig. 1 isthat for all codons which produce one amino acid, the first

and the second nucleotides are the same but the third amino

acid changes. The codons highlighted in yellow in the figure

are those which produce one form of amino acids andtherefore are translated to a single functional protein. The

mutation in DNA molecule in which the phenotype does not

change is called silent mutation.

According to what stated above, we can describe our

proposed scheme for encoding data into DNA segmentsusing the multiform property of amino acids in the

algorithm shown below.

Algorithm I. Encoding data into DNA segments

Step 1. Prepare a gene or a sequence of genes in which

data is going to be encoded. Note that all codons involved in

these genes should be selected from the highlighted codons

for which there exist multiple forms.

Step 2. For encoding purpose, synthesize another genesequence which is a modified copy of the first gene

sequence using below considerations: if we want to encode

logical “ zero”, do not change the sequence of codon and

just copy it down and in case we want to encode logical

“one” change the last nucleotide of the codon according to

the yellow-highlighted parts of the genetic table shown in

Fig. 1.

Step 3. For decoding purpose, compare two sequences. Do

it codon by codon. If any codon is unchanged, its

corresponding bit becomes “ zero” but if the codon is

changed to produce an amino acid with the same phenotypic properties according to the genetic table, its corresponding

bit becomes “one”.

Fig. 1 The genetic code table

B. The process of infection of E. coli

Bacteriophages or simply phages are those viruses which

infect cells of bacteria. A well studied test case for

observing the infection of a bacterium with phages is the process of infection of E. coli with phage lambda.

Phages can be seen in two categories of mild and

destructive. In the destructive form when a phage infects a bacterial cell, DNA of phage is reproduced in hundreds of

copies and those genes which encode new cover proteins

are expressed. This action takes place in a synchronized

manner so that no new phage is produced before destructionof the host cell. By destruction of the host cells, new phages

are released and destruct other host cells.

Lambda phage is a virus with circular DNA which infects E.

coli cells. Its length is ≈50kbp and consists of 50 genes.When the phage finds a host E. coli cell, it binds it from a

specific DNA structure on the cell of E. coli then DNA oflambda is ejected from its head and is entered into the





242

interior membrane of the bacterium and then, in order to not

being destructed by exonuclease enzymes it forms a circular

structure and then the DNA molecules are linked in specific

sites existing in two sides of the linear strands. These

specific sites are shown in Fig. 2.

Fig. 2 Specific site on the end of the linear strand

After this operation, the ligase enzyme encoded by host

cell, closes the cut sites in both sides and makes a closedcircular lambda molecule. Injection of DNA of phage in

cells of E. coli is demonstrated in Fig. 3.

Fig. 3 Injection of DNA of phage in the E. coli cell

The lambda phage is a mild phage for which there are

two phases of proliferation which are called Lytic and

Lysogeny. In the Lysogeny cycle the genome of phage,

instead of proliferation, is integrated into genome of bacterium and the genes related to the cover proteins are not

expressed. This integrated and deactivated phage is called

prophage. These prophages are proliferated during cell

division procedure as a part of bacterial chromosome in the

inactive form. Therefore, each on two daughter cells is theresult of this Lysogeny cell division and this Lysogeny state

can be kept for a long duration but there is the possibility of

state change to the Lytic cycle. This state change from

Lysogeny to Lytic is called induction which is possible byejection of the prophage DNA from genome of bacteria,

proliferation and activation of required genes for generation

of cover and regulator proteins in the Lytic cycle.

Lysogeny cycle is quite stable in the normal conditions but in case the cell is exposed to destructing conditions, the

inactive phage integrated into genome of bacterium (the

prophage) can effectively change its state into the Lytic

cycle. This kind of state change from Lysogeny to Lytic is

called Lysogeny induction. Selection of everyone of these

cycles depends on the state of acceptance of Lytic or

Lysogeny gene expression programs. The programresponsible for Lysogeny cycle can be kept in the cell for

many generations of proliferation but during induction

process, this cycle is changed to the Lytic cycle with a high

efficiency. The procedure of infection of E. coli cell and the

cycles of proliferation of bacteriophages are shown in Fig.

4.

Fig. 4 Different cycles of proliferation in infection of E. coli with phages

3. The Proposed Schemes

In this section we introduce our proposed schemes for

providing secrecy in images using genetically engineered

machines.

A. An in-vivo mechanism for hiding information

In this section we show our proposed scheme for an

in-vivo system using the procedures which occur naturallyas an integral part of gene expression in all living organisms.

We define our initial setup for the hiding system as shown

below:

We utilize the silent mutation property of amino acids asdemonstrated in section (2.A) for encoding our messages

into the blocks of DNA sequences in the synthetic plasmids

conveying the information. Furthermore, we define

transmitter and receiver side information of the system as

shown in Equ. (1)-(2). The transmitter side information is a

kind of information which is added to the message at the

transmitter side and the receiver side information is added

in the receiver side to unveil the hided information.

Receiver information≡(A biochemical indirectactivator)

(Equ. 1)





243

)

,)(

,(

sequencemessagetheafter paddi ng for

snucleotideof sequenceknown A

genereporter a phenotype

certainawith geneknown A

inhibitor l biochemica An Informatior Transmitte

(Equ. 2)

Equ. 1 and Equ. 2 show the receiver and the transmitter side

information of our proposed data hiding system,

respectively. The first element of both of which is a

biochemical substance which can be naturally found in the bacteria we work with. As can be seen in Equ. 1, the

receiver information is a biochemical indirect activator

which indirectly activates expression of the genes which lie

downstream of the promoter of the synthetic gene sequencewhich encodes the message.

Furthermore Equ. 2 shows that the first element of the

transmitter information is a biochemical inhibitor which

effectively blocks expression of the downstream gene(s) of

the promoter of the plasmid which encodes the message ofthe proposed system, the second element of Equ. 2 is a

known gene with a specific phenotype and the third element

of it demonstrates a known sequence of nucleotides which

shows that the message data has ended. Any gene to be

expressed needs a promoter which is upstream of it and that

gene which comes after it as shown in Fig. 5.

Fig. 5 A plasmid containing its promoter and a gene

In order to provide an example to demonstrate our hiding

mechanics, we use Equ. (3)-(4) to express the

transmitter-receiver information pairs of the hiding scheme.

)(Re IPTGn Informatioceiver (Equ. 3)

)

,,(

dataafter padding for sequence

DNA A geneGFP LacI n Informatior Transmitte

(Equ. 4)

In Equ. 3, IPTG or Isopropyl β-D-1-thiogalactopyranoside

is a biochemical reagent which induces transcription of the

gene that encodes for beta-galactosidase, a hydrolase

enzyme which cooperates in catalyzing the hydrolysis of β-galactosides to monosaccharide.

Also, in Equ. 4, the transmitter information contains a

biochemical substance ( LacI protein) which inhibits

transcription of the upstream gene(s) of the promoter which belongs to the message-encoding plasmid.

IPTG molecule (with the following chemical formula

C9H18O5S), when connected to LacI , detaches it from the promoter and unblocks expression of the gene(s)

downstream of the promoter this process is shown in Fig. 6.

With this explanation at hand, we are now ready to describe

the algorithm in which Alice encrypts a message and send it

to Bob.

Algorithm II. The proposed scenario for secure

communication of Alice and BobStep 1. Alice encodes her intended message in

accordance with the silent mutation property of the genetic

code in some gene(s) which have been cloned in the

message information-bearing plasmid.

Fig. 6 Detaching LacI from the plasmid by IPTG

Step 2. Alice inserts the third element of Equ. 4 which is a

known sequence of nucleotides to the message she wishes

to send to Bob.

Step 3. Alice, using the transmitter information defined in

Equ. 2, hides the padded message (chosen from the message

space ￥ and encoded in message-encoding plasmid M P

using the silent mutation property of the genetic code). The

transmitter information can be composed by concatenation

of LacI and the DNA sequence of a known gene (such as

green florescent protein gene) as shown in Fig. 7 which

serves as the terminator which reveals that there exists a

hided information after ending the sequence of this reporter

gene.

The hiding procedure can be accomplished easily by

binding the synthetic concatenation of Fig. 7 to the plasmid

which conveys the message information and therefore by

blocking expression of the gene(s) which lie downstream of

promoter of the message-encoding plasmid.

Fig. 7 The first and second elements of the transmitter side informationof the proposed data hiding scheme

In this way, transcription of these genes will be stopped andtherefore, Alice can hide the message.

Step 4. Bob receives the solution which contains the hided

message sent from Alice. Since using transmitter

information Alice has blocked expression of her intendedmessage, only Bob who possesses the receiver information

has the means to unveil the information which is hided in

the solution received by Alice and then he can extract the

message information sent by Alice by unblockingexpression of the downstream genes of the message

LacI GFP gene

Promoter

Gene

Plasmid

LacI

IPTG

Promoter

Gene

Plasmid





244

promoter. In our example, Bob by adding IPTG can remove

LacI and by removing it, the GFP gene is expressed and the

solution which contains hided and coded information turns

to green.

Step 5. By analyzing the resultant plasmid, Bob can unveil

the message sent by Alice which lies between the GFP geneand the known sequence of nucleotides which was

previously defined as a part of transmitter information.

Step 6. By decoding the sequence of nucleotides which

was derived by Bob in step 4, according to the genetic code

table shown in Fig. 1, he can find out the message Alice

sent to him.

B. A new in-vivo watermarking scheme

A remarkable difficulty that is common to all the

watermarking algorithms presented up to now is restrictionof size of the watermark picture. We have overcome this

restriction by using DNA molecules to code image

information into cells of two microbes. Our proposedmethod has the ability to encode images with a very largesize, since the total length of E. coli and phage lambda can

be used to encode the host image and the watermark picture

respectively (approximately 40004000 pixels for the

host image and 127127 pixels for the watermark image

if we use E. coli and lambda phage for encoding the hostimage and the watermark image respectively.) Furthermore

we can use larger phages to encode larger watermark

images. It is noteworthy that for implementation of thisscheme in the laboratory we should control the infection

cycle of E. coli so that it maintains the lysogenic cycle and

as shown in [14] these conditions can be achieved with a

probability of at least 90%. The proposed scheme like allthe other watermark schemes [15]-[17] includes two steps

of embedding the watermark image and extracting the

watermark image:

1) Embedding watermark: In the proposed method

the host image is first converted into a string of sequential

bits and then it is mapped to DNA sequence of the

bacterium E. coli.

The mapping of image bits and codons is based on the

concept of a Silent mutation which is a kind of mutation

that does not alter the amino acid and so does not outbreak

in the phenotype as explained in section (2.A). In the sequel,

some Algorithms are brought to explain the detailed

procedure of the proposed watermarking method.

Algorithm III. Coding of information of the host image inthe genome of E. coli:

Step 1. Selection of the host image.Step 2. Displaying the host image as a sequence of binary

bits using the halftone technology [17].Step 3. Selection of a gene from the E. coli genome to

possess the size of at least three times as big as the size of bits of the image.

Step 4. Coding of the sequence of Step 2 in the genome ofE. coli such that if its corresponding bit is zero, there will be

no change in the structure of the codon of the gene,otherwise, the codon of the corresponding gene incurs a

silent mutation.

In the next step, we should select a specific site in thegenes of E. coli and phage lambda that are regarded as the

sticky ends of them. It is substantial to note that the sticky

ends are unique. Otherwise, by doing it in the laboratory,

the circular DNA of E. coli will be patchy and will not yieldan appropriate result.

Algorithm IV. Coding of information of the watermarkimage in the genome of lambda phage:

Step 1. Selection of the watermark image.Step 2. Displaying the watermark image as a sequence of

binary bits using the halftone technique.

Step 3. Selection of a gene from the lambda phage genome

to possess the size of at least three times as big as the size of bits of the image.

Step 4. Coding of the sequence of Step 2 in the genome of

phage lambda such that if its corresponding bit is zero, there

will be no change in the structure of the codon of the gene,otherwise, the codon of the corresponding gene incurs a

silent mutation.Algorithms III and IV result in two test tubes that containthe coded DNA strands of the host image and the watermarkimage respectively. In the next algorithm, an appropriatesite must be selected for computer simulation of insertion ofthe phage DNA into the DNA of E. coli.

Algorithm V. Selection of the sticky ends of E. coli and phage lambda:

Step 1. Reception of the genes of E. coli and phage lambda produced in Algorithms III and IV.

Step 2. Finding a cos site in the phage lambda and the

corresponding site in E. coli bacterium.We have used the cos site achieved in [18] to be used in

Step 2 of Algorithm V as a secondary attachment site. In the

next algorithm, insertion of the phage lambda DNA into the

DNA of E. coli is computer simulated.

Algorithm VI. Insertion of the DNA of the phage lambda inthat of E. coli:

Step 1. Cutting the double-stranded DNA of E. coli andlambda phage from their sticky ends.

Step 2. Insertion of a piece of the lambda phage into thecutting edge of E. coli bacteria.

2) The watermark image extraction: In this stage, toextract the watermark image by the owner he should evict

lambda phage from the solution containing the infected E.coli and then he should extract the phage gene and decode it.

In Algorithm VII, stages of watermark extraction are

depicted.

Algorithm VII. Evicting phage lambda from the infected E.coli

Step 1. The owner, using the knowledge of sticky ends ofthe phage that he himself has inserted, finds two identicalsticky ends and cuts them stepwisely.

Step 2. Extraction of a shorter length sequence (phagelambda).

Step 3. Adjoining free nucleotides of the remaining

sequence (E. coli).





245

In laboratory Algorithm VII is implemented using

centrifuge of the resulted solution. In this regard, because

lambda phage sequence is shorter than that of E. coli, it

moves faster in the test tube and so it can be easily

extracted.

Algorithm VIII. DecodingStep 1. Comparing sequences of the extracted phage from

step 3 of the algorithm VII with the original gene of the phage to extraction of the watermark image.

Step 2. Comparing DNA sequence of the resulting E .coli

in step 4 of the algorithm VII with the original sequence

of E. coli to extract the host image.

C. An information annihilation scheme

The last scheme we introduce in this paper is a dataannihilation scheme which can be used to delete a message

in in-vivo computers. This scheme uses the concept ofinfection of E. coli with bacteriophage lambda in the Lytic

cycle. The scenario in which our wetware data annihilationscheme is useful can be stated as follows.

Assume that Alice has encoded her message into the

genome of E. coli. For a variety of reasons she may wish to

delete this message so that no one else can see or recover it.

The mechanics of this scheme can be explained in the

algorithm below.

Algorithm IX. A wetware data annihilation scheme

Step 1. Alice infects the E. coli bacterium which conveys

her encoded information (the data encoding scheme uses the

silent mutation property just as explained in section (2.A)).

Step 2. The infection procedure will be guided using a bacteriophage (we assume it to be the bacteriophagelambda). Alice controls this infection so that it goes to the

Lytic cycle.

Step 3. The E. coli bacterium containing the encoded

message is completely destroyed and therefore, her data iscompletely deleted.

As can be seen in the above algorithm, Alice is able to

delete her message so that it cannot be recyclable anymore.

The proposed scheme is similar to the deletion of a file fromrecycle bin of a usual silicon computer. The user intends to

delete any file he wishes so that it cannot be retrieved by

any means.

Our wetware scheme has advantages over the usual deletionmethod in silicon based computers since it is natural and has

no loss, and also the procedure which utilizes this scheme is

one-sided and it cannot be reversed, therefore it guarantees

deletion of the message, but in silicon computers, the

deleted data can be retrieved from the memory and it goes

to a specific address in memory even if deleted and so there

are some bits in the memory from which this deleted

information can be leaked. One example for suchinformation leakage in usual silicon-based computers can be

seen in the case for cold boot attacks introduced in [19].

4. Simulation Results

To show the performance of our proposed scheme we

have run a simulation in which we want to embed the

picture containing arm of our university of size 4040

pixels into a 200200 pixels Lenna image (Fig. 8(a)).And next, we will depict the results of our computer

simulation in two parts of embedding the watermark andextraction of it.

(b) (a)

Fig. 8 (a) Host image (b) watermark image

1) Embedding the watermark: Our proposed method ofembedding watermark is divided into three parts:

1. Coding the host image in a specific gene of E. coli

The host image will be first considered in a halftone mode.i.e. in the dark parts of the image the density of the black

pixels will be more and in bright parts of it the density of

the black pixels will be less.

00000010

00100000

00001001

00000101

01001011

00001001

01010110

11101001

Fig. 9 Host image





246

Based on the size of the host image, we have chosen gene

leuL of E. coli to encode the host image. The part of the

abovementioned original gene which corresponds to the

selected area demonstrated in Fig. 9 is presented in matrix

of Equ. 5.

(Equ. 5)

By coding the host image in leuL , the coded matrix of the

selected area of the image is shown in Equ. 6.

(Equ. 6)

As we can see, if each pixel of the image is one, its

corresponding codon will incur a silent mutation (its amino

acid does not change) and if the pixel is zero, its

corresponding codon will not change.

2. Coding the watermark image in genome of bacteriophagelambda

We use lambda phage as the carrier of our watermark and

encode our watermark image in it. To do so, we should

mention that the specific part of the genome of lambda

phage should not contain a cos site because the image will be caught from the sticky ends.

11110001

11111001

11100001

00000011

00000011

10100001

11110001

11110001

Fig. 10 The watermark image

In the matrix of Equ. 7 part of phage lambda genome whichcorresponds to the selected area of the watermark image isshown.

AAAGGA AAC GGC TTT TCGCGATCT

AAGGAT AAGCCA AGAGAT CCGCAG

CTACAT GGT ATT GTT GTC GGT GTT

ATGGGATAGTGT CAGGCT ATACCG

ACGGGAGGGTGGCTT CGA AAG AAA

TTC CTG ATC TGG ATC AAGCTAGAT

GAC AGC AAATGC CAATTT CGC CCC

CGG ACT ATC TAT CTC CTT GAATAG

M Lam bd aSC Code _ _

(Equ. 7)

By coding the watermark image in lambda phage genome,

the coded matrix of the selected area of the image is

demonstrated in the matrix of Equ. 8.

AAGGGG AAT GGGTTT TCGCGA AGC

AAAGAC AAACCG AGGGAT CCGCAA

CTGCAC GGG ATT GTT GTC GGT GTG

ATGGGATAGTGT CAGGCT ATT CCT

ACGGGAGGGTGGCTT CGA AAA AAG

TTT CTG ATATGG ATC AAGCTAGAC GAT AGG AAGTGT CAATTT CGC CCG

AGG ACG ATATAC CTC CTT GAATAA

M Lam bd aSC Code _ _

(Equ. 8)

3. Infection of Escherichia coli with phage lambda

Bacteriophage lambda, in order to infect E. coli integrates

its genome into the TrpC gene of E. coli from its cos site

and the recombination DNA sequence of that is shown in

Fig. 11.

ATGCAAACCGTTTTAGCGAAAATCGTCGCAGACAAGGCGATTTGGGTAGAAGCCCGCAAA CAGCAGCAACCGCTGGCCAGTTTTCAGAATGAGGTTCAGCCGAGCACGCGACATTTTTAT GATGCGCTACAGGGTGCGCGCACGGCGTTTATTCTGGAGTGCAAGAAAGCGTCGCCGTCA AAAGGCGTGATCCGTGATGATTTCGATCCAGCACGCATTGCCGCCATTTATAAACATTAC GCTTCGGCAATTTCGGTGCTGACTGATGAGAAATATTTTCAGGGGAGCTTTAATTTCCTC

CCCATCGTCAGCCAAATCGCCCCGCAGCCGATTTTATGTAAAGACTTCATTATCGACCCT TACCAGATCTATCTGGCGCGCTATTACCAGGCCGATGCCTGCTTATTAATGCTTTCAGTA CTGGATGACGACCAATATCGCCAGCTTGCCGCCGTCGCTCACAGTCTGGAGATGGGGGTG CTGACCGAAGTCAGTAATGAAGAGGAACAGGAGCGCGCCATTGCATTGGGAGCAAAGGTC GTTGGCATCAACAACCGCGATCTGCGTGATTTGTCGATTGATCTCAACCGTACCCGCGAG

CTTGCGCCGAAACTGGGGCACAACGTGACGGTAATCAGCGAATCCGGCATCAATACTTAC GCTCAGGTGCGCGAGTTAAGCCACTTCGCTAACGGTTTTCTGATTGGTTCGGCGTTGATG GCCCATGACGATTTGCACGCCGCCGTGCGCCGGGTGTTGCTGGGTGAGAATAAAGTATGT GGCCTGACGCGTGGGCAAGATGCTAAAGCAGCTTATGACGCGGGCGCGATTTACGGTGGG TTGATTTTTGTTGCGACATCACCGCGTTGCGTCAACGTTGAACAGGCGCAGGAAGTGATG

GCTGCGGCACCGTTGCAGTATGTTGGCGTGTTCCGCAATCACGATATTGCCGATGTGGTG GACAAAGCTAAGGTGTTATCGCTGGCGGCAGTGCAACTGCATGGTAATGAAGAACAGCTG TATATCGATACGCTGCGTGAAGCTCTGCCAGCACATGTTGCCATCTGGAAAGCATTAAGC GTCGGTGAAACCCTGCCCGCCCGCGAGTTTCAGCACGTTGATAAATATGTTTTAGACAAC GGCCAGGGTGGAAGCGGGCAACGTTTTGACTGGTCACTATTAAATGGTCAATCGCTTGGC

AACGTTCTGCTGGCGGGGGGCTTAGGCGCAGATAACTGCGTGGAAGCGGCACAAACCGGC TGCGCCGGACTTGATTTTAATTCTGCTGTAGAGTCGCAACCGGGCATCAAAGACGCACGT CTTTTGGCCTCGGTTTTCCAGACGCTGCGCGCATATTAA

Fig. 11 The specific part of the infected E.coli genome

The specific part of the phage genome that carries the cos

site is depicted in Fig. 12.

TATTTAGCTTTCTGCTTCCTTTTGGATAACCCACTGTTATTCATGTTGCATGGTGCACTG

TTTATACCAACGATATAGTCTATTAATGCATATATAGTATCGCCGAACGATTAGCTCTTC

AGGCTTCTGAAGAAGCGTTTCAAGTACTAATAAGCCGATAGATAGCCACGGACTTCGTAG

CCATTTTTCATAAGTGTTAACTTCCGCTCCTCGCTCATAACAGACATTCACTACAGTTAT

GGCGGAAAGGTATGCATGCTGGGTGTGGGGAAGTCGTGAAAGAAAAGAAGTCAGCTGCGT

CGTTTGACATCACTGCTATCTTCTTACTGGTTATGCAGGTCGTAGTGGGTGGCACACAAA

GCTTTGCACTGGATTGCGAGGCTTTGTGCTTCTCTGGAGTGCGACAGGTTTGATGACAAA

AAATTAGCGCAAGAAGACAAAAATCACCTTGCGCTAATGCTCTGTTACAGGTCACTAATA

CCATCTAAGTAGTTGATTCATAGTGACTGCATATGTTGTGTTTTACAGTATTATGTAGTCTGTTTTTTATGCAAAATCTAATTTAATATATTGATATTTATATCATTTTACGTTTCTCGT

TCAGCTTTTTTATACTAAGTTGGCATTATAAAAAAGCATTGCTTATCAATTTGTTGCAAC

GAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGATTTCAATTTTGTCCCACTCCC

TGCCTCTGTCATCACGATACTGTGATGCCATGGTGTCCGACTTATGCCCGAGAAGATGTT

GAGCAAACTTATCGCTTATCTGCTTCTCATAGAGTCTTGCAGACAAACTGCGCAACTCGT

GAAAGGTAGGCGGATCCCCTTCGAAGGAAAGACCTGATGCTTTTCGTGCGCGCATAAAAT

ACCTTGATACTGTGCCGGATGAAAGCGGTTCGCGACGAGTAGATGCAATTATGGTTTCTC

CGCCAAGAATCTCTTTGCATTTATCAAGTGTTTCCTTCATTGATATTCCGAGAGCATCAA

TATGCAATGCTGTTGGGATGGCAATTTTTACGCCTGTTTTGCTTTGCTCGACATAAAGAT

ATCCATCTACGATATCAGACCACTTCATTTCGCATAAATCACCAACTCGTTGCCCGGTAA

CAACAGCCAGTTCCATTGCAAGTCTGAGCCAACATGGTGATGATTCTGCTGCTTGATAAA

TTTTCAGGTATTCGTCAGCCGTAAGTCTTGATCTCCTTACCTCTGATTTTGCTGCGCGAG

TGGCAGCGACATGGTTTGTTGTTATATGGCCTTCAGCTATTGCCTCTCGGAATGCATCGC

Fig. 12 The specific part of the lambda bacteriophage genome

The infection procedure of bacteria E. coli with phage

lambda and the way its genome enters into the circular

DNA of E. coli is demonstrated in Fig. 13.





247

2) Watermark extraction: In an appropriate watermarking

scheme only the owner of the image can extract his

watermark and our proposed scheme can meet this need.

That is because only the person who embeds the watermark

has the knowledge of the genes that the watermark and the

host image are hiding into and also, he is the only one toknow the sticky ends for selection of the appropriate

enzymes to extract the phage. The extraction process of

infected E. coli is reverse of embedding the watermark

image into the host image process.

Fig. 13 The specific part of the infected E.coli genome

5. Security Analysis of the

Proposed Schemes

In this section we provide analysis on our proposed schemes

and prove the security of these schemes.

In the first scheme, a wetware hiding mechanism was proposed which utilizes a pair of chemical substances in the

transmitter and receiver sides to hide a message, often a

picture, in the E. coli cells. In this scheme there exist some

security parameters which help in provision of secrecy in it.

the first thing to note is that the proposed pairs are chosenaccording to the elegant property of binding a biochemical

substance to a plasmid and detaching another biochemical

from it. This pair plays an important role in security of this

scheme. The other factor which is equally important in provision of security is the power of our encoding scheme

which is by itself a hiding mechanism. The known sequence

which is added to the end of the message is another security

parameter of our proposed scheme which defines the end ofthe message. The importance and roles of these security

parameters can be understood better in security analysis of

the proposed watermark scheme which is defined in the

next paragraph.

In order to analyze security of the proposed wetware

watermark scheme, we should first notice that there are

many characteristics that are involved in security of the

proposed scheme which let the owner of watermark provehis possession. Every one of these characteristics are called

security characteristic of the system. These security

characteristics can be defined as follows:

1. The bacteriophage within the watermark information is

encoded.2. The specific gene which is utilized by the owner of

watermark for encoding the watermark picture.

3. The specific location within the mentioned gene in which

the watermark picture is encoded.

4. Length of the sticky end.

5. The DNA sequence of the sticky end which is in

possession of the owner just as a secret key.6. The specific bacterium which is used for encoding

information of the host image.

7. The specific gene which is used for encoding the host

image.

8. The specific location in the gene in which the host image

is encoded.

Every one of the abovementioned characteristics play a role

in achieving secrecy in the proposed watermark scheme.

For a better understanding of these roles we analyze the

attack conditions to this system.

Assume that the attacker to our watermarking scheme possesses a test tube containing the infected E. coli bacteria

which is infected by the lambda phage. He may wish toextract the hided information in E. coli and lambda phage.

To do this, he should analyze the DNA sequence related tothe E. coli genome which contains genome of the lambda

phage. Since he does not know the location of the hided

information, he should analyze all 5000 Kb nucleotides of

genome of E. coli to find the hided information related to

the host image. While the owner of the watermark knows

the specific gene within the host image is hided as well as

location of the encoded information in that specific gene

and therefore, he can find it very easily, the attacker, for the

sake of finding the specific location in which the watermark

information is hided, should look for all 48502 bp

nucleotides of the lambda phage. Furthermore, an attackerto the proposed scheme should also look for all bacteria thatare infected with different phages and then analyze their

genome which is a demanding task because of the variety of

bacteria and phages. The owner of watermark only knows

which phage has been used for hiding the watermarkinformation and achieving to this information is indeed

necessary and sophisticated as well. This problem gets more

complex when a bacterium is infected by a variety of

bacteriophages. Therefore, the attacker is faced with more

difficulty in finding the virus in which the watermark

information in hided.

The specific cross sequence which is a subsequence of the

15-nucleotides cos site, is also known only by the ownerand this information lets him know the exact location from

genome of E. coli in which the lambda phage is located.

Therefore, an adversary ought to look for a specific site in

the structure of E. coli genome which is complementary to aspecific sequence of genome of phage and then he should

make a piecewise cut to that specific point.

Since there is a number of possibilities for the cross

sequence with different lengths, each one of them can beused as a cut point in the genome of E. coli. So, if the length

of the cross sequence is assumed to be l , since for each

one of these l points one can assume 4 different bases, an

adversary must analyze

l l 2

24

possibilities in order tofind the cut point in genome of E. coli. Therefore, the

complexity of finding the cut point in E. coli genome

Lambda phage

GCTTTTTTATACTAACGAAAAAATATGATT

E.coliGCTTTTTTATACTAACGAAAAAATATGATT







248

becomes of order )2( 2l O which is exponential.

There can be used a variety of different secondary cos sites

as entrance point of the phage to the E. coli genome and we

used the sequence driven in [18] as this secondary cross

sequence.

As can be seen in the abovementioned security analysis,

because of the variety of existing security parameters, the

proposed watermark model has a high level of securityagainst those attacks in which the attacker possesses the test

tube containing the infected bacteria.

The security of the proposed data deletion procedure can

also be justified using the fact that the procedure of Lyticreproduction and cell destruction takes place quite naturally

and does not need an extra control when the infection

procedure starts and therefore, it is so trustworthy and

guarantees deletion of the encoded message.

D. Considerations of implementing the proposed methods

in cloning laboratories

The proposed schemes for security assurance in images

can be easily implemented in genetic engineering

laboratories. In the first scheme, the data encoding in

plasmids can be easily implemented using UV to change thenucleotides of a codon and the usual laboratory techniques

can be utilized in adding LacI as well as IPTG to the

synthesized plasmid. In the second and third proposed

schemes, the most important task is mixing two solution

containing bacterial species and bacteriophage species and

then to control this procedure so that the E. coli bacteria is

properly infected and this solution does not go to the Lytic

cycle in the watermark scheme or goes to the Lytic cycle in

the data annihilation scheme.

The laboratory establishment for the engineered infection

process is explained in [14]. The results of this laboratory

experiment demonstrate that considering the explainedconditions, we can make sure that 99% of bacteria are

infected and also 90% of bacterial population go with the

Lysogeny cycle.

In order to make sure that the process of infection goeswith the Lysogeny cycle, there must be a control over the

experiment but if there is no control on the infection

experiment, the procedure tends to the Lytic cycle and

therefore, in practice implementing the second proposedscheme is a more demanding task.

E. The problems associated with the proposed methods

The proposed approach for providing security in images

has some constraints and drawbacks associated with it

which can be classified into two groups. The first one

contain some general drawbacks associated with allcomputational systems based on DNA molecules and the

second belongs to the proposed scheme which utilizes

cloning techniques as a model for computing with DNA.

The drawbacks of the first type belong to lack of access

to the biotechnology facilities which fades away in the light

of growing technology of genetic engineering. The other

problem of the first type also belong with the high error

rates which is tagged to all operations with DNA sequences.

These errors necessitate the need for repeating the

biotechnological experiments for achieving trusty results.

The problems of the second kind associated with the

watermarking scheme relates to the control of the infection

procedure of the phage such that it is prevented from

entering the Lytic cycle. If so, the cell containing theinformation will be lost. But as shown in the laboratory

considerations mentioned above, we are able to control this

cycle such that more that 90% of the infected cells enter the

Lysogeny cycle. The precision in experiments is the key for

achieving this goal.

6. Conclusion

In this paper three genetically engineered machines

were proposed to ensure secrecy in transmitting images in

DNA-based computers. Our proposed schemes are the first

security initiatives for images in the DNA computingcontext. They provide some improvements over the existingmethods implementable in silicon computers. The usual

data hiding mechanisms in silicon computers have practical

drawbacks in that data can be leaked but the dense medium

of DNA molecule helps us use our proposed scheme alongwith the novel data encoding and retrieval mechanisms. Our

in-vivo watermarking scheme also takes advantage of a

natural process which takes place during infection of E. coli

bacterium by bacteriophage lambda and solves the problemof size limitation of the existing watermarking schemes.

Our analysis predicts that the proposed scheme can be

implemented in laboratory with 90% probability of success.

In the proposed watermarking scheme the infection of E.coli in the Lysogeny cycle is considered and we used the

Lytic cycle of infection of E. coli for achievement of

another security assurance scheme which we called data

annihilation scheme. The process considered in this security primitive is a naturally one-sided procedure in which

bacteriophages annihilate the cells of an E. coli bacterium.

The last secrecy primitive can be used similar to the

deletion of a file from a silicon-based computer but theone-sided property of our proposed scheme guarantees

deletion of the data (such as an image file) so that it cannot

be retrieved and since it gets its motifs from a one-sided

phenomenon which occur in nature, it has no leakage in

contrast to the silicon-based computers as stated in [18] forwhich, the deleted information is recoverable and leaks

information in different locations of memory.

AcknowledgementThe authors would like to thank R. Dastanian for her

useful comments and supports in computer simulations of

this paper and Iran Telecommunications Research Centre

(ITRC) for supporting this paper financially.

References

[1] L.M. Adleman, “Molecular computation of solutions tocombinatorial problems,” (1994) Science, vol. 266, pp.1021-1024.





249

[2] L. Landweber & L. Kari, “The evolution of cellularcomputing: nature’s solution to a computational problem,” (1998) LNCS , vol. 2950, pp. 207-216.

[3] L. Kari, “DNA Computing: Arrival of BilogicalMathematics,” (1997) The Mathematical Intellignecer , vol.

19, No.2, pp. 9-22.[4] T. Head, “Formal Language Theory and DNA: an analysis of

the generative capacity of specific r ecombinant behaviors,”(1987) Bull. Math. Biology, vol. 49, pp. 737-759.

[5] L.M. Adleman, “On constructing a molecular computer,”

(1996) In R.J. Lipton, E.M. Baum (Eds), DNA basedComputers I, Proceedings of a DIMACS Workshop,American Mathematical Society, Providence, RI, USA,

pp.1-22.

[6] J. Khodor & D. Gifford, “Design and implementation of

computational systems based on programmed mutagenesis,”(1998) In Preliminary Proceedings of 4 th DIMACS Workshopon DNA Based Computers, pp. 101-108.

[7] Y. Benenson, B. Gil, U. Ben-Dor, R. Adar & E. Shapiro, “An

autonomous molecular computer for logical control of geneexpression,” (2004) Nature 414, pp. 430-434.

[8] A. Gehani, T. LaBean & J. Reif, “DNA-based Cryptography,

Aspects of Molecular Computing,” (2004) Springer-Verlag Lecture Notes In Computer Science, vol. 2950.

[9] National Bureau of Standards: “Data Encryption Standard,”(1977) U.S. Department of Commerce, FIPS, pub.46.

[10] D. Boneh, C. Dunworth & R. Lipton, “Breaking DEES Usinga Molecular Computer,” (1995) Princeton CS Tech-ReportCS-TR, pp.489-495.

[11] L.M. Adleman, P.W. K. Rothemund, S.Roweis & E. Winfree,

“On applying molecular computation to the Data EncryptionStandard,” (1999) 2nd annual workshop on DNA Computing,

Princeton University, Eds. L. Landweber and E. Baum, DIMACS: series in Discrete Mathematics and Theoretical

Computer Science, American Mathematical Society. pp.31-44.

[12] R. Dastanian, A. Karimi & H.Sh. Shahhoseini, “A Novel

Multi-Client Authentication Method Using Infection ofBacteria,” (2011 ) Proceedings of International Conference on

Communication and Electronics Information (ICCEI), China,1, pp. 310-314.

[13] A. Karimi, R. Dastanian & H. Sh. Shahhoseini, “A NewWatermarking Scheme for An in-vivo Computer Based onInfection of E. coli,” (2010) Proceedings of International

Conference on Computer and Electrical Engineering(ICCEE), China, 8, pp. 484-488.

[14] B.A. Fry, “Conditions for the Infection of Escherichia coliwith Lambda Phage and for the Establishment of Lysogeny,”(1959) Journal of gen. Microbiol , vol. 21, pp. 676-684.

[15] Ch.H. Huang, Sh.Ch. Chuang, Y.L. Huang & J.L. Wu,“Unseen Visible Watermarking: A Novel Methodology for

Auxiliary Information Delivery Via Visual Contents,” (2009) IEEE Trans. On Informtion Forensics and Security, vol. 4, No. 2.

[16] Y.C. Hou, “Visual cryptography for color images,” (2003) Elsevier Journal of Pattern Recognition, vol. 36, pp.1619-1629.

[17] X. Wang, Z. Xu & P. Niu, “A feature-based digital

watermarking scheme for halftone image,” (2010) AEU - International Journal of Electronics and Communications,vol. 64, no. 10, pp. 924-933.

[18] G.E. Christie & T.Platt, “A secondary attachment site for

bacteriophage lambda in trpC of E.coli,” (1979) Cell , vol.16,no. 2, pp. 407-413. [19] A. Halderman, S. Schoen, N. Heninger, W. Clarkson, W.

Paul, J. Calandrino, A. Feldman, J. Appelbaum & E. Felten.“Lest we remember: Cold boot attacks on encryption keys”

(2008) In Usenix Security Symposium. Arash Karimi Received the B.S. andM.S. degrees in the Dep. Of ElectricalEngineering from Amirkabir University

of Science and Technology(Polytechnic of Tehran) and IranUniversity of Science and Technology(IUST), Tehran, Iran, in 2008 and 2011,

respectively. His research interestsinclude cryptography, unconventional

methods in computation with a focuson cryptanalysis, Biochemicalcomputing, and formal languages and

automata.

Hadi Shahriar Shahhoseini received

B.S. degree in electrical engineeringfrom University of Tehran, in 1990,M.S. degree in electrical engineeringfrom Azad University of Tehran in

1994, and Ph.D. degree in electrical

engineering from Iran University ofScience and Technology, in 1999. Heis an assistant professor of theelectrical engineering department inIran University of Science and

Technology. His areas of research include networking,

supercomputing and reconfigurable computing. More than 130 papers have been published from his research works in scientific journals and conference proceedings. He is an executivecommittee member of IEEE TCSC and serves IEEE TCSC asregional coordinator in middle-East Countries. .

achieving secrecy for images using in-vivo dna cloning techniques

Documents