Method Article

Accumulation of single-stranded DNA in Escherichia colicarrying the colicin plasmid pColE3-CA38Magali Morales a,1, Hedieh Attai a,1, Kimberly Troy b, David Bermudes a,c,*a Biology Department, California State University Northridge, Northridge, CA 91330-8303, United Statesb Ellington High School, Ellington, CT 06029, United Statesc Interdisciplinary Research Institute for the Sciences (IRIS), California State University Northridge, Northridge, CA 91330-8303, United States

A R T I C L E I N F O

Article history:Received 26 August 2014Accepted 1 November 2014Available online 5 November 2014Communicated by Saleem Khan

Keywords:ColicinSingle-stranded DNARolling-circle replicationAcridine orange metachromatic stainingPhred quality scoresPicogreen

A B S T R A C T

We sequenced the complete 7118 bp circular plasmid pColE3-CA38 (pColE3) from Escheri-chia coli, located the previously identied colicin components together with two new ORFsthat have homology to mobilization and transfer proteins, and found that pColE3 is highlysimilar to a plasmid present in enterohemorrhagic E. coli O111. We also found that unusualaspects of the plasmid include the inability to be completely digested with restriction en-donucleases and asymmetric Phred DNA sequencing quality scores, with signicantly lowerscores in the forward direction relative to the colicin and immunity proteins consistent withplus (+) strand DNA. Comparing the A260 with picogreen double-stranded DNA (dsDNA) u-orescence and oligreen single-stranded DNA (ssDNA) uorescence as well as metachromaticstaining by acridine orange, we found that the undigested pColE3 DNA stains preferen-tially as ssDNA and that it coexists with dsDNA. We also identied ssDNA in pColE5 andpColE9 but not in pColE1. Colicin plasmids producing ssDNA may represent a new sub-class of rolling-circle replication plasmids and add to the known similarities between colicinsand lamentous phage.

2014 Elsevier Inc. All rights reserved.

1. Introduction

Colicins are a class of bacterially produced bacterio-cidal proteins generally known as bacteriocins. Colicins areproduced by Escherichia coli strains and primarily inhibitother strains of E. coli while the strains that produce themare themselves protected by an immunity protein that keepsthe colicin inactive during translation and export or reentry(Cascales et al., 2007). Colicin E3 (ColE3) cleaves the 16SrRNA of susceptible E. coli (Bowman et al., 1971; Senior andHolland, 1971) at a specic site 49 nucleotides from the 3-OH terminus (Lasater et al., 1989). Colicin plasmids share

a common genetic organization consisting of the colicin genethat is expressed under control of the SOS regulon, an im-munity protein as well as a lysis protein that facilitates therelease of the colicin from the periplasm (Riley and Wertz,2002).

Although colicins are generally narrow spectrum anti-biotics, the ColE3 RNA cleavage recognition sequence is alsopresent in eukaryotic 18S subunit, andColE3has been shownto be cytotoxic to some cancer cells (Fuska et al., 1979;Lancaster et al., 2007; Cornut et al., 2008). Several bacterialstrains with tumor-targeting capability including Salmo-nella sp. are currently being investigated for their potentialuse in cancer therapeutics (Forbes, 2010;Hoffman and Zhao,2014; Low et al., 1999; Pawelek et al., 1997). Colicins in-cluding ColE3 may have utility in augmenting antitumorbacterial strains such of Salmonella (Clairmont et al., 2000;Lancaster et al., 2007; Leschner and Weiss, 2010) by engi-neering them todirectly express the colicinwithin the tumorin order to achieve a localized antitumor effect.

* Corresponding author. Biology Department, California State UniversityNorthridge, Northridge, CA 91330-8303, United States. Fax: +1 (818) 6772034.

E-mail address: david.bermudes@csun.edu (D. Bermudes).1 Equal contributors.

http://dx.doi.org/10.1016/j.plasmid.2014.11.0010147-619X/ 2014 Elsevier Inc. All rights reserved.

Plasmid 77 (2015) 716

Contents lists available at ScienceDirect

Plasmid

journal homepage: www.elsevier.com/ locate /yplas

E. coli are usually found as members of highly complexcommunities of bacteria within the guts of humans, cattleand other vertebrates, and can also be recovered from en-vironmental samples of water and soil from locationsinhabited by the species that carry them as part of their gutmicrobiota. Because colicins result in a phenotype that killsother E. coli, there has been interest in the ability of colicinsto inuence the biological distribution of E. coli strains(Cascales et al., 2007; Dobson et al., 2012; Riley and Wertz,2002). Colicins could be involved in competitive exclusionof a preexisting E. coli strain against colonization by otherstrains of E. coli, or it may be that colicins facilitate colo-nization of an E. coli strain into the gut or an environmentalready inhabited by another E. coli strain, or a combina-tion of these effects. Petkovek et al. (2012) correlated colicininsensitivity with pathogenicity, where resistance ap-peared to contribute to overcoming competitive exclusionat extraintestinal locations such as the skin. Based upon theelevated incidence of their occurrence in pathogenic strains,Rijavec et al. (2007) and majs et al. (2010) correlated bac-teriocins with the virulence potential in uropathogenic E. coli.In these two cases, colicins apparently act as colonizationfactors by helping to eliminate preexisting microbes thatmight otherwise prevent colonization. Colicins are also prev-alent among diarrheagenic clones, including those associatedwith Shiga toxin production (O111, O15, O26, and O157:H7;Murinda et al., 1998). Colicins have been shown to inu-ence the production of Shiga toxin and can either increaseor suppress its production (Toshima et al., 2007). Converse-ly, it is also known that preexisting bacterial population cansuppress Shiga toxin producing E. coli (STEC) O157:H7(Gamage et al., 2006) and that some STECs are sensitive tocolicins (Jordi et al., 2001; Murinda et al., 1996; Schambergerand Diez-Gonzalez, 2004).

The colicin E1 origin of replication from the ColE1-encoding plasmid is widely used in conventional plasmidcloning vectors, such as pUC series of plasmids (Vieira andMessing, 1982). The ColE1 type replicon does not encodea replication (Rep) protein, and therefore replication of plas-mids with this type of origin continues in the presence ofchloramphenicol (Clewell, 1972; Clewell and Helinski, 1972),which allows for plasmid amplication. A 580 base pairregion containing the colicin E1 ori and an RNA transcrip-tion site is essential for replication (Ohmori and Tomizawa,1979; Oka et al., 1979; Tomizawa et al., 1981). pColE2-P9and pColE3-CA38 plasmids have previously been shown tobe sensitive to the presence of chloramphenicol (Horii andItoh, 1989; Kido et al., 1991; Watson and Visentin, 1982;Yasueda et al., 1989), which is due to the requirement ofthe Rep protein encoded by these plasmids (Aoki et al., 2007;Han et al., 2007; Yagura et al., 2006). Their Rep protein originof replication consists of 3237 base pairs with three sub-regions for (1) stable binding the Rep protein, (2) Rep proteinbinding and initiation of DNA replication and (3) initia-tion of DNA replication without binding the Rep protein.

The genes encoding the colicin E3 toxin, immunity andlysis proteins, the origin of replication and its cognate rep-lication protein have been previously mapped by restrictionendonuclease analysis as well as having been partially clonedand sequenced (Horii and Itoh, 1989;Masaki and Ohta, 1985;Watson and Visentin, 1980, 1982; Yasueda et al., 1989, 1994),

but the complete DNA sequence of the plasmid has not beenreported. Plasmids existing as single stranded DNAwere rstisolated from the Gram positive bacteria Bacillus subtilus andStaphylococcus aureus (te Riele and Ehrlich, 1986) and sub-sequently found in gram negative bacteria (del Solar et al.,1993), although none have been found in E. coli. These plas-mids replicate by the rolling circle mechanism of DNAsynthesis (Espinosa et al., 1995; Khan, 2005), which is alsoused by some bacteriophage such as M13. In this report wepresent the entire sequence of the pColE3-CA38 plasmid andshow that it exists as both ssDNA and dsDNA in E. coli, andthat differences in the methods of DNA preparation accountfor earlier studies that did not reveal the presence of ssDNA.

2. Materials and methods

2.1. Bacterial strains and plasmids

The colicin-containing bacteria used in this study,BZB2106 containing the plasmid pColE3-CA38 (pColE3),BZB2108 containing pColE5-099 (pColE5), and PAP1407 con-taining the plasmid pColE9-J (pColE9; Pugsley and Oudega,1987), were obtained from Margret Riley, University ofMassachusetts, Amherst, MA, and the strain W3110 ColE1containing the ColE1 plasmid was obtained from the ColiGenetic Stock Center (New Haven, CT). pUC19, and DH5were obtained from Invitrogen (Carlsbad, CA) and EC100wasobtained from Epicentre (Madison, WI). The bacteria weremaintained on Luria Bertani (LB) media containing 10 gtryptone, 5 g yeast extract, 10 g NaCl per liter for broth, andwith 1.5% agar for Petri plates, and incubated at 37 C. pUC19was transformed into chemically competent DH5 or EC100,selected for and maintained on LB agar with 100 g/ml am-picillin (LB-amp). M13mp18 (M13) double-stranded (ds) andsingle stranded (ss) DNA were obtained from Bayou Biolabs(Metairie, LA). Colicin-containing supernatants were gen-erated by inducing a freshly initiated culture of BZB2106using ultraviolet light, allowing it to grow to stationary phase,pelleting the bacteria and passing the supernatant througha 0.22 m low-binding polyethersulfone (PES) lter (Millex,Cork, Ireland). The colicin-containing supernatant was testedfor E. coli killing capacity by placing 3 l drops of a serialdilution onto a plate containing an E. coli B (CGSC # 5713)soft agar overlay. A strain of DH5 containing pColE3 wasgenerated by transforming chemically competent DH5withthe pColE3 plasmid and plating the transformation to colicin-selective plates containing LB agar to which a 1.0 ml overlayof an undiluted colicin-containing supernatant had beenadded and allowed to be absorbed.

2.2. DNA preparation and ssDNA and dsDNA staining

Alkaline lysis mini-plasmid preps were performed usingthe Fermentas Gene Jet plasmid purication kit (Vilnius, Lith-uania), which includes RNase A treatment to remove RNA.In order to concentrate the DNA, two, 1.5 ml lysates werepassed through the same binding column. DNA producedby the Fermentas alkaline lysis miniprep kit was also com-pared with the alkaline protease miniprep kit (Wizard PlusSV, Promega, Madison, WI) and the ZR Plasmid Miniprepkit (Zymo Research, Irvine, CA). DNA was separated by

8 M. Morales et al./Plasmid 77 (2015) 716

agarose gel electrophoresis and isolated from the gel using0.65 m polyvinyl dioride (PVDF) centrifugal lter unit(Millipore, Billerica, MA). Cesium chloride (CsCl) densitygradients were performed according to Sambrook et al.(1989), with CsCl density adjusted to a nal concentrationof 1.05 g per ml, sealed in a Sorvall ultracrip centrifuge tube,loaded into a Sorvall T865.1 xed angle rotor and sub-jected to 45,000 rpm for 20 hours. DNA quantication basedupon A260 was performed using a NanoDrop 2000s(ThermoFisher Scientic, NanoDrop Products, Wilming-ton, DE), assuming dsDNA and an extinction coecient ofOD260 = 50 g/ml or OD260 = 33 g/ml for ssDNA. Quantita-tive assays were also performed using picogreen (doublestranded DNA stain) and oligreen (single-stranded DNA stain)uorescent dye assays according to the manufacturers in-structions (Invitrogen). The presence of ss- and dsDNA aloneand in mixed solutions was inferred by the relative uo-rescence of A260-normalized DNA concentrations using eitherpicogreen or oligreen compared with M13 ssDNA anddsDNA, alone and mixed, as standards. A one-way ANOVAwas performed to test for signicance among the groupsusing Prism (Graphpad; San Diego, CA) followed by posthoctwo-tailed unpaired t-tests.

2.3. DNA restriction endonuclease analysis andgel electrophoresis

pUC19, M13 single- and double-stranded DNA, PCR prod-ucts and pColE3 preparations were subjected to restrictionendonuclease digestion according to the manufacturersinstructions using AlwNI, BamHI, EcoRI, HindIII, and PvuIIendonucleases (Fermentas). DNA was separated by agarosegel electrophoresis using 0.9% agarose in TAE buffer con-taining 40mMTris, 20mMacetic acid, and 1mMEDTA using60 mA constant current. Linearized DNA fragment molec-ular weight markers were used for size analysis (GeneRuler1 kb Plus, Fermentas). For gels containing ethidium bromide(Thermo Fisher Scientic, Waltham, MA), 1 g/ml was in-corporated into the gel. Duplicate gels lacking dye weresubjected to submersion in DNA staining baths consistingof either (1) ethidium bromide (1 g/ml in TAE), (2) acri-dine orange (Sigma Aldrich, St. Louis, MO; 7.5 g/ml for30 min in 10 mM sodium phosphate buffer, pH 7.0 with216 h destaining using three washes dH20 (McMaster andCarmichael, 1977), (3) SYBR gold (1:10,000 dilution of ma-nufacturers stock solution in TAE used without destaining;Invitrogen), (4) picogreen (1:10,000 dilution of manufactu-rers stock solution in TAE and destained with three washesin TAE; Invitrogen) or (5) oligreen (1:1000 dilution of ma-nufacturers stock solution in TAE and destained with threewashes in TAE; Invitrogen) and then visualized by 302 nmand/or 365 nm ultraviolet light using either an ethidiumbromide (UVP, Upland, CA) or SYBR Gold/acridine orangeWratten No. 15 (Kodak, Rochester, NY) optical lters.

2.4. DNA sequencing

Oligonucleotides used in this study shown in Table 1werepurchased from Integrated DNA Technologies (San Diego,CA). DNA was sequenced by Sanger thermocycle dye ter-mination (Sequetech,Mountain View, CA and Genewiz, South

Plaineld, NJ) using 0.040.5 g DNA and 6.0 pmols primerper reaction. DNA sequencing of the entire plasmid was ini-tiated based on the published colicin and immunity genesand subsequently completely sequenced by overlappingprimer extension sequencing reactions. Raw DNA se-quence ends were cropped using the automaticcropping tool in 4PEAKS (Nucleobytes, Aalsmeer, The Neth-erlands). DNA sequence analysis also utilized Geneious(Biomatters LTD, Auckland, New Zealand) and BLAST (NCBI,Bethesda, MD). Plasmidmapswere generatedwith Geneiousand PowerPoint (Microsoft, Redmond, WA). DNA sequenc-ing quality scores (Phred) were analyzed in association withknown and putative single- and double-stranded DNA. Phredquality scores were analyzed for bases 100500 where se-quence quality was normally the highest and averaged. Bargraphs were generated using Prism. Statistical analyses wereperformed using Prism two-tailed unpaired t-tests.

2.5. Generation of pUC19 ori:ColE3 Rep ori fusions

Due to the presence of multiple origins of replication inthe pColE3 plasmid, we sought to assess their effect on

Table 1Oligonucleotide primers used in this study.

Primer Sequence (53)

Primers initially used based on the published ColE3 andimmunity region

E3-5F1 AGACCTGGCATGAGTGGAAGE3-5R1 GTTGCCTGTGCTGTTCGTCE3-3F1 ATTCCATGTGGGAGATGGGE3-3R1 CGCTTTGTTTTTGTCAAAGAGGColE3-CA38 DNA sequencing primersE3SeqF1 GGGGGTGGCTTTATATGGTGE3SeqF2 TTGCTGATGCAATAGCTGAAAE3SeqF3 TGTTAATAACGGTTGCTTTGATGE3SeqF4(same as E3-3F1)

ATTCCATGTGGGAGATGGG

E3SeqF5 TTCATCCAGCAGAACCAGCE3SeqF6 GCGGCACAGTAGCTACATCAE3SeqF7 TCTCCACTTCGTTTCGATTGE3SeqF8 GAAAAACGGGGAATGGAAACE3SeqF9 TGATAACCACCGTCTGAGCCE3SeqR1 ATCATCTGCGGGTAATGACGE3SeqR2 GCCATTTGCCACATTCTGTE3SeqR3 GAAACAAAATACTCATTATCGGAAAE3SeqR4 AGCCTGACACGCTTTGTTTTE3SeqR5 GTCGCTCCAGTCGATTGATE3SeqR6 GCAACAAACCAAGCTGCTCE3SeqR7 TTTCTGCCGTAATGCCTTTTTGCE3SeqR8 GTTTCCATTCCCCGTTTTTCE3SeqR9 GTAGGTGCGGCGAAGAGATE3SeqR10 CAAATCCGACAAGCACTTCCRep protein, Rep ori, and ssi ori PCR cloning and sequencing primersE3RepF1(HindIII, SI and AlwNI)

GATCAAGCTTGGCCGTGGAGGCCCAGTGGCTGTGAAGTGACCGGATTAGCAAC

E3RepR1 (BamHI) GATCGGATCCGCAACAAACCAAGCTGCTCE3ssiR1 (BamHI) GATCGGATCCGCACCACCGGACGCCTpUC19 F1 CTCTTCGCTATTACGCCAGCpUC19 R1 CTTCCGGCTCGTATGTTGTGpUC19R2 TGGTTTGTTTGCCGGATCAAGAGAlso see E3SeqF5, E3SeqF6, E3SeqR5 and E3SeqR6 listed above forDNA sequencing.

M13mp18 primersM13F1 TGCCTCGTAATTCCTTTTGGM13R1 TCATTGTGAATTACCTTATGCGA

9M. Morales et al./Plasmid 77 (2015) 716

plasmid DNA preparations alone and in combination, withor without the pUC19 origin. Based on the complete DNAsequence and annotation that was produced, PCR was usedto amplify the Rep protein from a site upstream beginningat bp 2787 using the E3RepF1 primer which contains an SIsite compatible with AlwNI as well as AlwNl and a HindIIIsite, and downstream to either the replication ori (E3RepR1primer) or the ssi ori (E3ssiR1 primer), each of which containBamHI sites, and cloned into pUC19 into either the BamHIand AlwNI sites, which resulted in deletion of most of thepUC19 ori, or cloned into the BamHI and HindIII sites, whichpreserved the pUC19 ori. PCR was performed using an MJResearch PCT200 thermocycler (Waltham, MA). The poly-merases usedwere Phusion (Fermentas), and Taq polymerase(PCR Master Mix 2X; Fermentas). The Taq-containing PCRconsisted of one cycle of 95 C for 5 min followed by 30cycles of 95 C for 30 sec, 58 C for 30 sec and 72 C for 2min,with a nal extension of 72 C for 5 min. The Phusion-containing PCR consisted of one cycle of 98 C for 3 minfollowed by 33 cycles of 98 C for 10 sec, 58 C for 30 secand 72 C for 1min, with a nal extension of 72 C for 5min.Genes were ligated into the pUC19 vectors using T4 rapidDNA ligation kit (Fermentas). Clones were transformed intochemically competent DH5 or EC100 and grown on LB-Amp plates. The DNA sequence of the Phusion PCR productswas determined by DNA sequencing (Sequetech) with DNArepresenting all four constructs conrmed to be completeand accurate. Relative amounts of plasmid produced by thedifferent clones was determined by (1) using A260 and (2)by resolving equivalent volumes (10 l of standard 50 lplasmid minipreps derived from 1.5 ml of fresh overnightcultures) on agarose gels.

3. Results

3.1. Complete sequence of pColE3-CA38

Single primer extension DNA sequencing revealed thatthe plasmid is a 7118 pb circular molecule. The completenucleotide sequence was deposited in GenBank as acces-sion number KM287568. The plasmid consists of seven openreading frames (ORFs) and two sites for DNA replication,the E3 replication origin (Rep ori) and a single stranded ini-tiation (ssi) origin (Fig. 1A), with the DNA sequenceGGTAGCGCTCGCCGCAGTCTCATGACCGAGCGTAGCGAGCGAATGAGCGAGGAAGCGCAAAGGCGTCCGGTGGTGC. The ORFsinclude the colicin E3 toxin (ColE3), ColE3 immunity, ColE8immunity, ColE3 lysis, the replication protein (Rep), a mo-bilization protein (Mob) and a conjugal transfer protein. TheMob and conjugal transfer gene were not previously knownto be associated with the pColE3 plasmid. A BLAST searchrevealed that this plasmid is most highly similar to the8140 bp plasmid pO111_4 of the enterohemorrhagic Es-cherichia coli O111:H- str. 11128 (Genbank AccessionAP010964; Nakayama et al., 2009), with a BLAST coverageof 95% and having 98% identity (Fig. 1B). Present on thepO111_4 plasmid with similar organization is a colicingene with sequence similarity to ColE3 (dark green shading)and to DNase colicins ColE2, ColE8 and ColE9 (lightergreen shading), the ColE8 immunity gene (which is alsopresent on the pColE3 plasmid; also highly similar to ColE2

immunity), a lysis protein, and an additional hypotheticalprotein with sequence similarity to the pColE3 plasmid butlacking a start codon in pColE3. Also present with a highdegree of similarity in both organization and DNA se-quence are the loci for the Rep protein, the pColE3 Rep origin(Rep ori), the ssi, Mob and conjugal transfer proteins. In ad-dition, pO111_4 encodes for ColE6 immunity (also highlysimilar to cloacin immunity and to ColE8 immunity) andColE2 immunity (also highly similar to other colicin im-munity proteins), and an additional hypothetical protein.

3.2. Restriction endonuclease analysis

We compared the DNA isolated from E. coli carryingpColE3-CA38 and our DH5 strain containing the pColE3plasmid (not shown) with the published restriction endo-nuclease digestions of pColE3 byWatson and Visentin, (1980;Fig. 2). Our restriction digests resulted in DNA bands con-sistent with the predicted sizes of 597, 3143 and 3378 forEcoRI and 2392 and 4723 for PvuII, and were indistinguish-able from those of Watson and Visentin (1980) except thata faster-migrating, diffuse band was present and appar-ently resistant to restriction endonuclease digestion (Fig. 2A;arrows). We found that purication of the plasmid by CsCldensity gradients resulted in DNA that lacked the faster-migrating band and resulted in complete digestion with

Fig. 1. Genetic organization of the pColE3-CA38 plasmid; color coding ofthe plasmid is used to help accentuate relatedness of the plasmid com-ponents. (A) A circular map of the pColE3-CA38 plasmid and its featuresis shown. Colicin E3, gene encoding the colicin E3 toxin; Imm E3, the colicinE3 immunity gene; Imm E8, the colicin E8 immunity gene; Lysis, gene en-coding the ColE3 lysis protein; Rep, the replication protein gene; Rep ori,the replication origin; ssi, the single strand initiation origin; Mob, the geneencoding the mobilization element; Conjugal transfer, the gene encod-ing the conjugal transfer protein. (B) pColE3-CA38 plasmid comparisonwithpO111_4 (Genbank Accession# AP010964) from a Shiga-like toxin pro-ducing strain. The lighter-shaded portion of the colicin gene correspondsto the region with strong similarity to DNase colicins E2, E8 and E9. I8,immunity to ColE8; L, lysis gene; H, hypothetical proteins; I6, immunityto ColE6; I2, Immunity to ColE2. (For interpretation of the references tocolor in this gure legend, the reader is referred to the web version of thisarticle.)

10 M. Morales et al./Plasmid 77 (2015) 716

EcoRI and PvuII (Fig. 2B). We subsequently made a similarcomparison with M13 single- and double-stranded DNA,which gave the expected restriction patterns in agarose gelsfor one EcoRI and three PvuII sites in the M13 dsDNA, (note:a small band predicted to be a 93 bp fragment in lane C3is not visible), but no restriction digestion of the single-stranded M13 DNA (Fig. 2C and D).

3.3. Relationship of DNA sequencing quality tosingle-stranded DNA

Primer extension sequencing resulted in Phred qualityscores that were considerably lower in the forward direc-tion relative to the colicin and immunity genes as comparedwith the reverse direction, and the electropherograms con-tained a notable amount of noise for all of the forwardprimer-generated sequences despite using the same DNAtemplate derived from alkaline lysis minipreps (Fig. 3). Thiswas especially true when we reduced the amount of DNAtemplate in the sequencing reactions. We found that whenDNA prepared by CsCl density gradients was used, DNA se-quencing was improved. Because of these asymmetricsequencing results we questioned whether it could be dueto the presence of a single stranded template. We com-pared Phred quality scores in the forward and reversedirection for M13 single- and double-stranded templatesusing forward and reverse primers (M13seqF1 andM13seqR1; Table 1) with pColE3 using forward and reverseprimers (SeqF2 and E35R1; Table 1) and found a similardegree of low quality and high quality for M13 forward orreverse primers, respectively, used on a single-stranded (plusstrand DNA) template as comparedwith the double-stranded

template. These data were consistent with the presence ofssDNA in the pColE3 minipreps, but not in the CsCl prepa-rations.Whenwe isolated the ColE3-resistant putative ssDNAband from an agarose gel, it too resulted in forward se-quencing reactions with low Phred scores (Fig. 3). Becausethe isolated restriction endonuclease-resistant diffuse bandresulted in sequence in the reverse direction identical topColE3, the possibility that this band was due to the pres-ence of another plasmid was ruled out.

3.4. DNA dye binding patterns

We normalized our DNA samples using absorbance at260 nm and determined the picogreen uorescence andoligreen uorescence of M13 double- and single-strandedDNA alone and mixed. We found that picogreen showed ahighly signicant difference in uorescence between the ds-and ssDNA, consistent with its preference for dsDNA, withan intermediate level of uorescence for the mixture of thetwo forms (Fig. 4). Analysis of the ColE3 miniprep alsoshowed a value that was intermediate between ss- anddsDNA, and was signicantly different from either ss- ordsDNA standards alone. Results performed using oligreenfor this test were also consistent with the colicin contain-ing a mixture of ss- and dsDNA. However, we found thatoligreen only has a slight increase in binding for ssDNA andthe assaywas only performed a single time (data not shown).We also separately stained agarose gels of pColE3miniprepswith either picogreen or oligreen and compared themwith SYBR gold-stained gels and found that the restrictionendonuclease resistant band preferentially bound to theoligreen relative to the picogreen (data not shown).

10

5 4

3

2

1.5

1

0.7

0.5

0.2

MW(kb)

1 2 3 1 2 3 1 2 3 1 2 3

A B C D

Fig. 2. Restriction digest analysis of pColE3 compared with M13 ss- and dsDNA. The DNA is either uncut or cut with the restriction endonucleases indi-cated; molecular weights are shown on the left. (A) pColE3 DNA isolated using a standard alkaline lysis plasmid minipreps. Lane 1, uncut; lane 2, EcoRI;lane 3, PvuII. In each of the three lanes, an arrow indicates the diffuse band that is unaffected by the restriction endonucleases. (B) pColE3 DNA isolatedusing a CsCl density gradient. Lane 1, uncut; lane 2, EcoRI; lane 3, PvuII. C) M13 dsDNA. Lane 1, uncut; lane 2, EcoRI; lane 3, PvuII. D) M13 ssDNA. Lane 1,uncut; lane 2, EcoRI; lane 3, PvuII.

11M. Morales et al./Plasmid 77 (2015) 716

3.5. Metachromatic staining with acridine orange andeffects of ColE3 Rep ori and pUC19 ori combinations onplasmid copy number

We analyzed the pColE3minipreps using acridine orangemetachromatic staining (McMaster and Carmichael, 1977;Fig. 5A). We found that the restriction endonuclease-resistant band observed in agarose gels of pColE3 stainedas a distinct red band (single-stranded staining), whereasthe other DNA in the gel strained green (double-strandedstaining). In the gels shown, both the M13 and ColE3single stranded DNA (arrows) migrate more slowly in thegel without incorporated ethidium bromide (arcidine orangestaining was performed after running the gel; right panel)compared with the gel with ethidium bromide pre-incorporated into the gel (left panel). Thus, the presence ofethidium bromide in the gel signicantly altered the mo-bility of ssDNA relative to dsDNA. Uncut DNA preparedusing the Fermentas, Promega and Zymo Research kits allproduced diffuse bands that stained redwith acridine orange

(data not shown). The presence of ssDNA was also appar-ent in our ColE3 DH5 strain (data not shown). In addition,acridine orange-stained agarose gels also showed that mini-preps of pColE5 and pColE9, but not pColE1, contain sig-nicant amounts of single-stranded DNA (data not shown).

We subsequently tested four constructs with differentcombinations of replication origins (Fig. 5B), (1) the ColE3Rep ori alone (truncated pUC ori), (2) the ColE3 Rep ori withthe ssi ori (truncated pUC ori), (3) the pUC19 ori with theColE3 Rep ori, and (4) the pUC19 ori with the ColE3 Rep oriand the ssi ori, by running them on agarose gels either withethidium bromide pre-incorporated into the gel or stain-ing with acridine orange after electrophoresis (Fig. 5C).Observation of these gels did not reveal any distinctly red-staining bands, or bands with signicant shift in mobilitydue to the presence of ethidium bromide; only a minor shiftin one band was noted (arrows). However, we did note dis-tinct differences in the relative amounts of plasmid obtainedinminipreps of these different constructs. As compared withpUC19 in DH5 and the wild type pColE3 that produced rel-atively little plasmid, the cloned ColE3 Rep ori in the pUC19with a truncated origin produced the least amount ofplasmid, whereas the combination of the pUC19 ori togeth-er with either the Rep ori or the Rep ori plus the ssi oriproduced very large amounts of plasmid. A quantitative com-parison of the minipreps is shown in Fig. 5D, with a highlysignicant (p < 0.0001) increase in DNA production whenthe pUC ori and the Rep ori were combined.

4. Discussion

Our study has resulted in a complete DNA sequence andmap of pColE3-CA38 from strain BZB2106. Several compo-nents of the pColE3 have long been known, but the completesequence has not been previously reported. pColE3 is very

A

B

C

Fig. 3. DNA sequence quality of pColE3. (A and B) Comparison of pColE3forward (A) and reverse (B) sequence reaction electropherograms usinglow concentrations of DNA (40 ng per reaction). (C) Comparison of the Phredquality scores using forward and reverse primers for M13 dsDNA (M13ds), M13 ssDNA, pColE3miniprep (ColE3), pColE3 CsCl-puried DNA (ColE3CsCl), and gel-puried putative ssDNA from a pColE3 miniprep (ColE3ssDNA). Statistically signicant differences are shown using brackets withthe p values indicated above.

Fig. 4. Relative uorescence produced by A260-normalized DNA samplesusing picogreen. Comparison of M13 double-stranded (dsM13) and single-stranded (ssM13) picogreen uorescence with a mixture of M13 ssDNAand dsDNA and pColE3. Statistically signicant differences are shown usingbrackets; with highly signicant p values indicated above.

12 M. Morales et al./Plasmid 77 (2015) 716

similar to the 8140 bp pO111_4 plasmid found in theenterohemorrhagic Escherichia coli O111:H-. The colicinprotein that plasmid encodes for is highly homologous toboth ColE3 in the N-terminus, and to the DNase colicinsColE2, ColE8 and ColE9 in the C-terminus, and is likely tobe a functional DNase colicin based on the high amino acidsequence conservation. Since pO111_4 and pColE3 containmultiple colicin resistance genes including those for ColE2,ColE6 and ColE8 in pO111_4, the data underscore the po-tential role for colicin resistance as a key feature in the abilityto colonize an environment already occupied by strains

producing colicins, as well as the potential for the colicinsthemselves to aid in the process.

Our methods included two new approaches to detect-ing ssDNA; A260:picogreen uorescence ratios and the useof Phred DNA sequencing quality scores. The A260:picogreenuorescence ratios were deliberately assessed because oftheir specicity for dsDNA whereas the nding that thePhred scores were indicative of ssDNA was serendipitous.Other methods such as preferential degradation of ssDNAby S1 and mung bean nucleases could also have beenemployed.

A B

DC

Fig. 5. Single- and double-stranded DNA staining by acridine orange (ssDNA = red; dsDNA = green) and the effect of replication origins on plasmid DNA.(A) Left panel: ethidium bromide-stained DNA by pre-incorporation of the dye into the gel. Lane 1, double-stranded M13; lane 2, single-stranded M13DNA; lane 3, pColE3 miniprep; and lane 4, CsCl-puried pColE3. In lanes 2 and 3, arrows indicate the diffuse ssDNA bands running as a lower molecularweight with ethidium bromide pre-incorporated into the gel. Right panel: acridine orange-stained DNA. Lane 1, dsM13; lane 2, ssM13; lane 3, pColE3;and lane 4, CsCl-puried pColE3. Arrows indicate the diffuse bands associated with M13 ssDNA and pColE3 that are shifted to a higher apparent molec-ular weight in the absence of ethidium bromide and stain red with acridine orange. (B) pUC19 constructs containing pColE3 components. (C) Left panel:ethidium bromide-stained DNA by pre-incorporation of the dye into the gel. Lane 1, pUC19; lane 2, construct 1; lane 3, construct 2; lane 4, construct 3;lane 5, construct 4. In lanes 4, an arrow indicates one band running as a slightly lower molecular weight with ethidium bromide incorporated into the gelduring electrophoresis. Right panel: acridine orange-stained DNA. Lane 1, pUC19; Lane 2, construct 1; lane 3, construct 2; lane 4, construct 3; lane 5, con-struct 4. In lane 4, an arrow indicates one band running as a slightly higher apparent molecular weight in the absence of ethidium bromide incorporatedinto the gel during electrophoresis. (D) Relative concentrations of DNA produced by pUC19, pColE3, construct 1 and construct 3. (For interpretation of thereferences to color in this gure legend, the reader is referred to the web version of this article.)

13M. Morales et al./Plasmid 77 (2015) 716

Our investigation has led to the conclusion that pColE3produces ssDNA in E. coli, in addition to dsDNA, based uponincomplete restriction endonuclease digestion, asymmet-ric DNA sequencingwhich included direct sequencing of therestriction endonuclease-resistant band, the relative uo-rescence of picogreen compared with A260, the preferentialbinding of the single-stranded DNA dye oligreen andmeta-chromatic staining with acridine orange. When we usedrestriction endonucleases on alkaline lysis minipreps weencountered incomplete digestion of theDNA,with a prom-inent diffuse band that was endonuclease resistant whichwehypothesizedmight be ssDNA, and showed that a similarresult is obtainedusing restrictionendonucleaseswith single-stranded M13 DNA. The lack of complete digestion did notcoincidewith the original report onmapping of pColE3 thatshowed complete restriction by endonucleases (Watson andVisentin, 1980). However, when DNAwas prepared by CsCldensity gradient purication as itwas in that report, theDNAwas completely digested and lacked the diffused fasterrunning single-strandedDNA band. These results clearly in-dicate that different methods of DNA preparation areresponsible for the absence or presence of the diffuse single-stranded DNA band, and explain why it was not observedearlier, although we did not examine exactly at which stepthe ssDNA is lost. We found that several different commer-cially availableminiprep kits resulted in the isolation of bothss- and dsDNA from ColE3, and since ssDNA was producedby the ColE3DH5 strain, production of ssDNA is not limitedto the original ColE3 strain.Whenwe sequenced the plasmidDNA outward from the previously described colicin and im-munity proteins in both directions, DNA sequence qualitywas lower in the forward direction relative to the colicinand its immunity proteins (Fig. 3), consistent with (+) DNA(relative to the colicin and immunity genes) and we alsoshowed that the same result is obtained using forward andreverse primers to sequence single-stranded (+) M13, butnot double-strandedM13. Better sequencing of pColE3wasobtained in both directionswith the CsCl puried DNA thatlacked the diffuse, restriction endonuclease-resistant band.When the diffuse band was isolated by gel electrophoresisand sequenced, the DNA also only sequenced eciently inthe reverse direction. Since the gel-puried restrictionendonuclease-resistant band of DNA resulted in a DNA

sequence that was identical to that of the pColE3 plasmid,this result ruled out the possibility that this band was dueto the presence of another plasmid.We now interpret theseresults as having been due to the miniprep sample con-taining a large amount of single stranded (+) DNA whichgenerated high-quality sequence in the reverse direction,but contained a relatively smaller portion of double strandedDNA that resulted in a limiting quantity of template thathad the consequence of a lower DNA sequence quality inthe forward direction. Metachromatic staining of miniprepDNA with acridine orange revealed the presence of both ared-stained band indicative of single-stranded DNA as wellas green-stained double-strandedDNA that is present in thesame preparations. Our results also show thatminipreps ofpColE5 and pColE9, but not those of pColE1, contain su-cient amounts of single-strandedDNA to stain positive (red)with acridine orange.

When different origins of replication were combined inpUC19, large quantities of DNA were produced due to thecoexistence of two origins, the pUC19 ori and the Rep ori.One possibility is that the two origins are not only com-patible, but that they are synergistic since the resultingamount of DNA produced is greater than the sum of the twoindividual plasmids. It is possible that the replicative in-termediates produced by one of the origins act as a bettertemplate for the replication initiated from the other origin.It is also possible that compared with the pColE3, the dualreplication constructs lack cop negative regulatory ele-ments (yet to be identied) which would therefore increasethe relative amount of plasmid produced, although this isnot true in the absence of the pUC19 ori.

The rolling-circlemechanism of DNA replication used insome phage and plasmids involves continuous synthesis ofthe leading strand of DNA, and due to asymmetry, resultsin accumulationof ssDNA (del Solar et al., 1993). In ourhands,theColE3 single strandedDNA intermediatewashighly stable,and our results showing the accumulation of ssDNA bycolicins suggest that theymay be closed circular moleculesproduced by a replicationmechanismwith a link to rolling-circle plasmids. Indeed, in addition to the production ofsingle-stranded DNA we describe here, several of the fea-tures that are associatedwith rolling-circle plasmids are alsoknown to occur in colicin plasmids (Table 2). For example,

Table 2Comparison of rolling-circle plasmids with colicin plasmids.

Feature Examples from rolling-circle plasmids(del Solar et al., 1993; Khan, 2005)

Colicin plasmids

Accumulation of single stranded DNA A large number of examples includepMV158 and pJV1.

pColE3, pColE5, pColE9 (this report;Fig. 5).

Antibiotic resistance Tetracycline resistance in pMV158. Colicin immunity proteins.Mobilization element (MOB) or plasmidrecombination element (PRE)

MOB/PRE in pMV158. Mob and conjugal transfer proteins(this report; Fig. 1).

Replication protein RepC in pT181. Rep (Yagura et al., 2006; Yasuedaet al., 1989).

Double stranded origin of replicationinitiated by Rep protein

LIC (leading initiation control) in pT181plasmid. Rep protein has a Tyr191 that isinvolved in DNA nicking.

Replication ori has binding site forthe Rep protein (Aoki et al., 2007).

Presence of one or more single-strandedorigins sso for lagging strand synthesis

sso from pT181. Single strand initiation (ssi; Nomuraet al., 1991); the functional equivalentfor lagging strand synthesis.

Copy number (Cop) repressor peptides Cop peptides from pKMK1. IncA in pColE2 (Tajima et al., 1988)

14 M. Morales et al./Plasmid 77 (2015) 716

antibiotic resistance is a feature associated with many (butnot all) rolling circle plasmids. In colicin plasmids, their im-munity proteins are essentially antibiotic resistance proteins,although they are not usually discussed in that context. Themobilization and transfer genes thatwe identied onpColE3are also common components of many rolling-circle plas-mids. Based on these and other similarities shown in Table 2,we suggest that these colicins likely represent a categoryof rolling-circle plasmids. Additional investigation of the rep-licative intermediateswill be required todetermine theactualmechanism of replication.

Several authors have also suggested a possible relation-ship between colicins and phage (e.g., Jabrane et al., 2002;Cascales et al., 2007) pointing out overlap in the import/translocation machinery between colicins and lament-ous phages that includes TolAQR of the bacterial cellenvelope. Mutations in these genes confer resistance toboth phage and colicins by interfering with their internal-ization. As single-stranded (+) DNA production representsthe virion conformation for the genome of lamentousphage such as M13, the present study extends the overlapof these two systems to include the production of singlestranded (+) DNA by colicins, and may occur by a rolling-circle mechanism of replication also used by lamentousphage.

Our agarose gels showed variation in the apparentmolecular weight of the ssDNA band, with the ssDNArunning either faster or slower relative to the dsDNA mo-lecular weight markers. M13 ssDNA has previously beenshown to adopt two different conformations with differ-ent sedimentation coecients in sucrose density gradientcentrifugation (Forsheit and Ray, 1970), with a faster-sedimenting form occurring under low ionic conditions.We found that the incorporation of ethidium bromideinto the gel resulted in a faster-migrating form of the ssDNA.Ethidium bromide has been shown to enhance the conden-sation of DNA loops (Belyaev et al., 1999) and thus mayresult in shifting the ssDNA to a more tightly packedfaster-migrating form with a lower apparent molecularweight. We also noted shifts in the migration of the ssDNArelative to the dsDNA molecular weight marker underdifferent electrophoresis current conditions, and subse-quently used the same constant current throughout ourexperiments.

Acknowledgments

This work was supported by NIH Grant SC3GM098207to DB. The sponsor did not have any inuence on the pro-ject design or interpretation. DB has nancial interest inAviex Technologies and Magna Therapeutics, and receivesroyalties from Yale University. We thank David Quinterofor assistance with the statistics and PCR and Drs. MargretRiley for providing colicin-producing strains and KerryCooper for assistance with generating graphic representa-tions using Geneious. We also thank our friend and colle-ague, the late Dr. Paul Tomasek, for assistance with theCsCl density ultracentrifugation, and dedicate this workin remembrance of him and his teaching and scienticcontributions.

References

Aoki, K., Shinohara, M., Itoh, T., 2007. Distinct functions of the two specicitydeterminants in replication initiation of plasmids ColE-P9 and ColE3-CA38. J. Bacteriol. 189, 23922400.

Belyaev, I.Y., Eriksson, S., Nygren, J., Torudd, J., Harms-Ringdahl, M., 1999.Effect of ethidium bromide on DNA loop organization in humanlymphocytes measured by anomalous viscosity time dependence andsingle cell gel electrophoresis. Biochim. Biophys. Acta 1428, 348356.

Bowman, C.M., Dahlberg, J.E., Ikemura, T., Konisky, J., Nomura, M., 1971.Specic inactivation of the 16S riboromal RNA induced by colicin E3in vivo. Proc. Natl. Acad. Sci. U.S.A. 68, 964968.

Cascales, E., Buchanan, S.K., Duch, D., Kleanthous, C., Lloubs, R., Postle,K., et al., 2007. Colicin biology. Microbiol. Mol. Biol. Rev. 71, 158229.

Clairmont, C., Troy, L., Luo, X., Li, Z., Zheng, L.-M., King, I., et al., 2000.Expression of colicin E3 by tumor-targeted Salmonella enhancesanti-tumor ecacy. Proc. Am. Assoc. Cancer Res. Annu. Meet. 41, 466.

Clewell, D.B., 1972. Nature of Col E1 plasmid replication in Escherichia coliin the presence of the chloramphenicol. J. Bacteriol. 110, 667676.

Clewell, D.B., Helinski, D.R., 1972. Effect of growth conditions on theformation of the relaxation complex of supercoiled ColE1deoxyribonucleic acid and protein in Escherichia coli. J. Bacteriol. 110,11351146.

Cornut, G., Fortin, C., Soulires, D., 2008. Antineoplastic properties ofbacteriocins: revisiting potential active agents. Am. J. Clin. Oncol. 31,399404.

del Solar, G., Moscoso, M., Espinosa, M., 1993. Rolling circle-replicatingplasmids from gram-positive and gram-negative bacteria: a wall falls.Mol. Microbiol. 8, 789796.

Dobson, A., Cotter, P.D., Ross, R.P., Hill, C., 2012. Bacteriocin production: aprobiotic trait? Appl. Environ. Microbiol. 78, 16. doi:10.1128/AEM.05576-11.

Espinosa, M., del Solar, G., Rojo, F., Alonso, J.C., 1995. Plasmid rolling circlereplication and its control. FEMS Microbiol. Lett. 130, 111120.

Forbes, N., 2010. Engineering the perfect (bacterial) cancer therapy. Nat.Rev. Cancer 10, 785794.

Forsheit, A.B., Ray, D.S., 1970. Conformations of the single-stranded DNAof bacteriophage M13. Proc. Natl. Acad. Sci. U.S.A. 67, 15341541.

Fuska, J., Fuskov, A., Smarda, J., Mach, J., 1979. Effect of colicin E3 onleukemia cells P388 in vitro. Experientia 35, 406407.

Gamage, S.D., Patton, A.K., Strasser, J.E., Chalk, C.L., Weiss, A.A., 2006.Commensal bacteria inuence Escherichia coli O157:H7 persistence andShiga toxin production in the mouse intestine. Infect. Immun. 74,19771983.

Han, M., Gagura, M., Itoh, T., 2007. Specic interaction between the initiatorprotein (Rep) and origin of plasmid ColE2-P9. J. Bacteriol. 189, 10611071.

Hoffman, R.M., Zhao, M., 2014. Methods for the development of tumor-targeting bacteria. Expert Opin. Drug Discov. 9, 741750.

Horii, T., Itoh, T., 1989. Replication of ColE2 and ColE3 plasmids: the regionssucient for autonomous replication. Mol. Gen. Genet. 212, 225231.

Jabrane, A., Sabri, A., Compere, P., Jacques, P., Vandenberghe, I.,Van Beeumen, J., et al., 2002. Characterization of serracin P, a phage-tail-like bacteriocin, and its activity against Erwinia amylovora, the reblight pathogen. Appl. Environ. Microbiol. 68, 57045710.

Jordi, B.J., Boutaga, K., van Heeswijk, C.M., van Knapen, F., Lipman, L.J., 2001.Sensitivity of Shiga toxin-producing Escherichia coli (STEC) strains forcolicins under different experimental conditions. FEMSMicrobiol. Lett.204, 329334.

Khan, S.A., 2005. Plasmid rolling-circle replication: highlights of twodecades of research. Plasmid 53, 126136.

Kido, M., Yasueda, H., Itoh, T., 1991. Identication of a plasmid-encodedprotein required for initiation of ColE2 DNA synthesis replication.Nucleic Acids Res. 19, 28752880.

Lancaster, L.E., Wintermeyer, W., Rodnina, M.V., 2007. Colicins and theirpotential in cancer treatment. Blood Cells Mol. Dis. 38, 1518.

Lasater, L.S., Cann, P.A., Glitz, D.G., 1989. Localization of the site of cleavageof ribosomal RNA by Colicin E3. J. Biol. Chem. 264, 2179821805.

Leschner, S., Weiss, S., 2010. Salmonella-allies in the ght against cancer.J. Mol. Med. 88, 763773.

Low, K.B., Ittensohn, M., Le, T., Platt, J., Sodi, S., Amoss, M., et al., 1999. LipidA mutant Salmonella with suppressed virulence and TNF inductionretain tumor-targeting in vivo. Nat. Biotechnol. 17, 3741.

Masaki, H., Ohta, T., 1985. Colicin E3 and its immunity genes. J. Mol. Biol.182, 217227.

McMaster, G.K., Carmichael, G.G., 1977. Analysis of single- and double-stranded nucleic acids on polyacrylamide and agarose gels by usingglyoxal and acridine orange. Proc. Natl. Acad. Sci. U.S.A. 74, 48354838.

15M. Morales et al./Plasmid 77 (2015) 716

Murinda, S.E., Roberts, R.F., Wilson, R.A., 1996. Evaluation of colicins forinhibitory activity against diarrheagenic Escherichia coli strains,including serotype O157:H7. Appl. Environ. Microbiol. 62, 31963202.

Murinda, S.E., Liu, S.-M., Roberts, R.F., Wilson, R.A., 1998. Colicinogenyamong Escherichia coli serotypes, including O157:H7, representing fourclosely related diarrheagenic clones. J. Food Prot. 61, 14311438.

Nakayama, K., Kurokawa, K., Tobe, T., Hattori, M., Hayashi, T., 2009.Comparative genomics reveal the mechanism of the parallel evolutionof O157 and non-O157 enterohemorrhagic Escherichia coli. Proc. Natl.Acad. Sci. U.S.A. 106, 1793917944.

Nomura, N., Masi, H., Inuzuka, M., Miyazaki, C., Ohtsubo, E., Itoh, T., et al.,1991. Identication of eleven single-strand initiation sequences (ssi)for priming of DNA replication in the F, R6K, R100 and ColE2 plasmids.Gene 108, 1522.

Ohmori, H., Tomizawa, J., 1979. Nucelotide sequence of the region requiredfor maintenance of colicin E1 plasmid. Mol. Gen. Genet. 176, 161170.

Oka, A., Nomura, N., Morita, M., Sugisaki, H., Sugimoto, K., Takanami, M.,1979. Mol. Gen. Genet. 172, 151159.

Pawelek, J.M., Low, K.B., Bermudes, D., 1997. Tumor-targeted Salmonellaas a novel anticancer agent. Cancer Res. 57, 45374544.

Petkovek, Z., gur-Bertok, D., Erjavec, M.S., 2012. Colicin insensitivitycorrelates with a higher prevalence of extraintestinal virulence factorsamong Escherichia coli isolates from skin and soft-tissue infections. J.Med. Microbiol. 61, 762765.

Pugsley, A.P., Oudega, B., 1987. Methods for studying colicins and theirplasmids. In: Hardy, K.G. (Ed.), Plasmids: A Practical Approach. IRL Press,Oxford, pp. 105161 (Chapter 5).

Rijavec, M., Budic, M., Mrak, P., Mller-Premru, M., Podlesek, Z., gur-Bertok,D., 2007. Prevalence of colE1-like plasmids and colicin K productionamong uropathogenic Escherichia coli strains and quantication ofinhibitory activity of colicin K. Appl. Environ. Microbiol. 73, 10291032.

Riley, M.A., Wertz, J.E., 2002. Bacteriocins: evolution, ecology andapplications. Annu. Rev. Microbiol. 56, 117137.

Sambrook, J.F., Fritch, E.F., Maniatis, T., 1989. Molecular Cloning: ALaboratory Manual, second ed. Cold Spring Harbor LaboratoryPress.

Schamberger, G.P., Diez-Gonzalez, F., 2004. Characterization of colicinogenicEscherichia coli strains inhibitory to enterohemorrhagic Escherichia coli.J. Food Prot. 67, 486492.

Senior, B.W., Holland, I.B., 1971. Effect of colicin E3 upon the 30S ribosomalsubunit of Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 68, 959963.

majs, D., Micenkov, L., marda, J., Vrba, M., evcikov, A., Valiov, Z.,et al., 2010. Bacteriocin synthesis in uropathogenic and commensalEscherichia coli: Colicin E1 is a potential virulence factor. BMCMicrobiol.10, 288.

te Riele, M.B., Ehrlich, S.D., 1986. Single-stranded plasmid DNA in Bacillussubtilis and Staphylococcus aureus. Proc. Natl. Acad. Sci. U.S.A. 83,25412545.

Tajima, Y., Horii, T., Itoh, T., 1988. Replication of ColE2 and ColE3 plasmids:two colE2 incompatibility functions. Mol. Gen. Genet. 214, 451455.

Tomizawa, J., Itoh, T., Selzer, G., Som, T., 1981. Inhibition of ColE1 RNAprimer formation by a plasmid-specied small RNA. Proc. Natl. Acad.Sci. U.S.A. 78, 14211425.

Toshima, H., Yohimura, A., Arikawa, K., Hidaka, A., Ogasawara, J., Hase, A.,et al., 2007. Enhancement of shiga toxin production inenterohemorrhagic Escherichia coli Serotype O157:H7 by DNase Colicins.Appl. Environ. Microbiol. 73, 75827588.

Vieira, J., Messing, J., 1982. The pUC plasmids, an M13mp7-derived systemfor insertion mutagenesis and sequencing with synthetic universalprimers. Gene 19, 259268.

Watson, R.J., Visentin, L.P., 1980. Restriction endonuclease mapping ofColE2-P9 and ColE3-CA38 plasmids. Gene 10, 307318.

Watson, R.J., Visentin, L.P., 1982. Cloning of the ColE3-CA38 colicin andimmunity genes and identication of a plasmid region which enhancescolicin production. Gene 19, 191200.

Yagura, M., Nishio, S., Kuzozumi, H., Wang, C., Itoh, T., 2006. Anatomy ofthe replication origin of plasmid ColE2-P9. J. Bacteriol. 188, 9991010.

Yasueda, H., Horii, T., Itoh, T., 1989. Structural and functional organizationof ColE2 and ColE3 replicons. Mol. Gen. Genet. 215, 209216.

Yasueda, H., Takechi, S., Sugiyama, T., Itoh, T., 1994. Control of Co1E2plasmid replication: negative regulation of the expression of theplasmid-specied initiator protein, Rep, at a posttranscriptional step.Mol. Gen. Genet. 244, 4148.

16 M. Morales et al./Plasmid 77 (2015) 716

Accumulation of single-stranded DNA in Escherichia coli carrying the colicin plasmid pColE3-CA38 Introduction Materials and methods Bacterial strains and plasmids DNA preparation and ssDNA and dsDNA staining DNA restriction endonuclease analysis and gel electrophoresis DNA sequencing Generation of pUC19 ori:ColE3 Rep ori fusions Results Complete sequence of pColE3-CA38 Restriction endonuclease analysis Relationship of DNA sequencing quality to single-stranded DNA DNA dye binding patterns Metachromatic staining with acridine orange and effects of ColE3 Rep ori and pUC19 ori combinations on plasmid copy number Discussion Acknowledgments References