Plant Molecular Biology 54: 39–54, 2004.© 2004 Kluwer Academic Publishers. Printed in the Netherlands.

39

A small family of LLS1-related non-heme oxygenases in plants with anorigin amongst oxygenic photosynthesizers

John Gray1,∗, Ellen Wardzala1, Manli Yang1, Steffen Reinbothe2, Steve Haller1 and FlorenciaPauli31Department of Biological Sciences, University of Toledo, 2801 West Bancroft Street, Toledo, OH 43606, USA(∗author for correspondence; email jgray5@uoft02.utoledo.edu); 2Laboratoire de Genetique Moleculaire desPlantes, Universite Joseph Fourier et CNRS, CERMO, BP 53, 38041 Grenoble, France; 2Department of Genetics,School of Medicine, Stanford University, Stanford, CA 94305, USA

Received 22 July 2003; accepted in revised form 22 December 2003

Key words: Acd1, Cao (chlorophyll a oxygenase), Cmo (choline monooxygenase), dioxygenase, Lls1, non-hemeoxygenase, Pao (pheophorbide a oxygenase), Ptc52, Tic55

Abstract

Conservation of Lethal-leaf spot 1 (Lls1) lesion mimic gene in land plants including moss is consistent with itsrecently reported function as pheophorbide a oxygenase (Pao) which catalyzes a key step in chlorophyll degrada-tion (Pruzinska et al., 2003). A bioinformatics survey of complete plant genomes reveals that LLS1(PAO) belongsto a small 5-member family of non-heme oxygenases defined by the presence of Rieske and mononuclear iron-binding domains. This gene family includes chlorophyll a oxygenase (Cao), choline monooxygenase (Cmo), thegene for a 55 kDa protein associated with protein transport through the inner chloroplast membrane (Tic55) anda novel 52 kDa protein isolated from chloroplasts (Ptc52). Analysis of gene structure reveals that these genesdiverged prior to monocot/dicot divergence. Homologues of LLS1(PAO), CAO, TIC55 and PTC52 but not CMOare found in the genomes of several cyanobacteria. LLS1(PAO), PTC52, TIC55 and a set of related cyanobacterialhomologues share an extended carboxyl terminus containing a novel F/Y/W-x2-H-x3-C-x2-C motif not presentin CAO. These proteins appear to have evolved during the transition to oxygenic photosynthesis to play variousroles in chlorophyll metabolism. In contrast, CMO homologues are found only in plants and are most closelyrelated to aromatic ring-hydroxylating enzymes from soil-dwelling bacteria, suggesting a more recent evolution ofthis enzyme, possibly by horizontal gene transfer. Our phylogenetic analysis of 95 extant non-heme dioxygenasesprovides a useful framework for the classification of LLS1(PAO)-related non-heme oxygenases.

Introduction

The Lls1 gene was originally cloned from maize andthe absence of this gene function results in a light-dependent cell death phenotype mediated by chloro-plasts (Gray et al., 1997, 2002). We have foundthat this cell protective function is conserved betweenmonocots and dicots (Yang et al., submitted). Basedon the presence of two non-heme iron-binding mo-tifs conserved amongst aromatic ring-hydroxylatingenzymes in bacteria it was predicted that the Lls1gene encodes an oxygenase function (Gray et al.,1997, 2002). This prediction has been confirmed by

the recent finding that the Arabidopsis thaliana Lls1gene encodes pheophorbide a oxygenase (PAO) whichcatalyzes a key step in chlorophyll degradation (Fig-ure 1D) (Pruzinska et al., in press). Since the discoveryof LLS1 (PAO) in plants a few other genes have beenidentified in plants that exhibit the same non-hemeiron-binding motifs (Caliebe et al., 1997; Tanakaet al., 1998). In this study it is established that there area total of five Lls1(Pao)-related genes in plants. Thephylogenetic relationships between these Lls1(Pao)-related genes and homologous bacterial enzymes wereexamined in detail by comparing 95 known and pre-dicted non-heme oxygenases.

40

Figure 1. Examples of known catalytic functions of non-heme oxygenases from bacteria and plants. A. Naphthalene dioxygenase from Pseudo-monas sp. strain G7 catalyzes the conversion of naphthalene to cis-1,2-dihydroxy-1,2-dihydronaphthalene. B. Choline monooxygenase (CMO)catalyzes the first step in the conversion of choline to the osmoprotectant glycine betaine in plant chloroplasts. C. Chlorophyll a oxygenase(CAO) catalyzes the first step in the conversion of the Chl a to Chl b. D. Pheophorbide a oxygenase (PAO) catalyzes the oxygenolytic openingof pheophorbide a at the α-mesoposition between C4 and C5 to produce a red chlorophyll catabolite (RCC).

Non-heme iron oxygenases or hydroxylases thatincorporate one or two atoms of dioxygen into sub-strates are found in many metabolic pathways (Langeand Que, 1998; Moraswki et al., 2000; Prescottand Lloyd, 2000; Ryle and Hausinger, 2002). En-zymes that incorporate only one atom of dioxygeninto substrates are termed monooxygenases (or mixed-function oxygenases). Oxygenases that catalyze the

incorporation of both atoms of molecular oxygen arereferred to as dioxygenases. These dioxygenases com-prise a large and diverse group of multi-component en-zymes that play important roles in pathways as diverseas antibiotic synthesis to the degradation of aromaticcompounds. The comparison of the deduced aminoacid sequences of numerous oxygenases is permittingthe evolutionary relationships between these enzymes

41

to be determined (Lange and Que, 1998; Prescott andLloyd, 2000; Ryle and Hausinger, 2002). Of particularrelevance to this study, because of their homology tothe LLS1(PAO)-like plant oxygenases, are a group ofmicrobial oxygenases that participate in the aerobicdegradation of aromatic hydrocarbons. These oxy-genases known as aromatic ring hydroxylases (ARHs)catalyze the hydroxylation of the aromatic ring as afirst step in the degradation of these compounds bysoil bacteria (Batie et al., 1991; Harayama et al.,1992; Mason and Cammack, 1992; Jiang et al.,1996; Nam et al., 2001). An example is naph-thalene dioxygenase (NDO) from the soil bacteriumPseudomonas which oxidizes naphthalene to cis-1,2-dihydroxy-1,2-dihydronaphthalene (Figure 1A). NDOhas been crystallized permitting the structure and reac-tion mechanism to be studied in detail (Kauppi et al.,1998; Karlsson et al., 2003). NDO consists of twosubunits (α and β) in a hexameric α3β3 composi-tion. The α subunit contains a Rieske[2Fe-2S] centerand mononuclear iron at the active site. The Rieskedomain exhibits a conserved iron-binding domain,C81-x-H83-x17-C101-x2-H104, which contrasts withthe Rieske domain of chloroplast-type ferredoxins, inwhich four cysteine residues co-ordinate a [2Fe-2S]center. In the NDO Rieske [2Fe-2S] center the Fe1is coordinated by Cys-81 and Cys-101, while Fe2 iscoordinated by His-83 and His-104. The mononucleariron at the active site is coordinated by the two his-tidine residues and one carboxylate within the motifE100-x3-D205-x2-H208x4-H213 and by D362. Thismotif is now referred to as a 2-His-1-carboxylate facialtriad (Lange and Que, 1998). Electron transfer fromthe Rieske domain to the active site occurs betweentwo a subunits which are held in close proximity bythe hydrogen bonding of D205 to both H104 in theRieske domain and H208 at the active site (Kauppiet al., 1998). The conservation of these iron-bindingmotifs in LLS1-like proteins (Gray et al., 1997, 2002)suggests a common reaction mechanism, but not ne-cessarily common enzyme substrates. Individual mi-crobial ARH enzymes may operate on several sub-strates, for example, vanillate demethylase (VanA)from Acinetobacter, which can act upon the vanil-late analogues m-anisate, m-toluate and 4-hydroxy-3,5-dimethylbenzoate (Moraswki et al., 2000). Themicrobial ARH enzymes were originally classified byBatie et al. (1991), based on the number of constituentcomponents and the nature of their redox reactions.This system proved difficult with some newly dis-covered enzymes, and Nam et al. (2001) developed a

classification scheme that groups these enzymes basedon the phylogenetic comparison of their terminal oxy-genase components. This system, which is simple andpowerful, is referred to here as the Nam classifica-tion system. The Nam system classifies ARH enzymesinto four groups and representative examples includedin this study are listed in Supplementary Table 1. Inthis study we adapt and extend the Nam scheme forclassifying non-heme oxygenases to include plant andcyanobacterial non-heme oxygenases.

The evolutionary relationship of plant LLS1-likeoxygenases and cyanobacterial oxygenases to thesemicrobial ARH enzymes is examined in this paper.Two of the plant oxygenases related to LLS1 havepreviously defined biochemical functions and theseare choline monooxygenase (CMO) and chlorophylla oxygenase (CAO) (Figure 1B and C). Both oxy-genases do not utilize phenolic compounds as sub-strates. CMO is a ferredoxin-dependent enzyme thatcatalyzes the first step in two-step oxidation of cholineto the osmoprotectant glycine betaine (Figure 1B).This enzyme is found as a homodimer in the chloro-plast stroma (Rathinasabapathi et al., 1997). CMO isunique to plants: in bacteria (including halotolerantcyanobacteria) and mammals that synthesize glycinebetaine, this first step is catalyzed by choline dehydro-genase (Incharoensakdi and Wutipraditkul, 1999).

CAO catalyzes the first step in the conversion ofchlorophyll a (Chl a) to Chl b (Figure 1c) (Tanakaet al., 1998). The conservation of this enzyme in theprochlorophytes Prochloron didemni and Prochloro-thrix hollandica suggests that this enzymatic activityarose once in the common ancestor of oxygenic bac-teria and chloroplasts (Tomitani et al., 1999). Theabsence of a close homologue of CAO from the gen-ome of Prochlorococcus which synthesizes divinylChl b has given rise to the proposition that a Chl bsynthase in this organism may have a different phylo-genetic origin involving convergent evolution (Hesset al., 2001). PTC52 from barley (PORA translocationcomplex) is a 52 kDa protein that is associated with thetranslocation of protochlorophyllide oxidoreductase A(PORA). The detection of pchlide b within this com-plex suggests that PTC52 catalyzes the conversion ofpchlide a to pchlide b in a reaction that is analagous tothat of CAO (S. Reinbothe et al., in press).

The recent report that the AtLls1 gene encodesa pheophorbide a oxygenase activity and that pheo-phorbide a accumulates in maize lls1 plants indicatesthat the LLS1 protein catalyzes a key step in thedegradation of chlorophyll (Pruzinska et al., 2003).

42

Thus, three members of the Lls1-related family of non-heme oxygenases have been implicated in either thesynthesis or degradation of chlorophyll intermediates.The fifth member of this gene family is TIC55 frompea (translocon of inner chloroplast membrane) whichencodes a 55 kDa protein that is found associated withthe general translocon for proteins through the innerchloroplast membrane (TIC complex) (Caliebe et al.,1997; Küchler et al., 2002). A redox regulatory func-tion has been proposed for TIC55 but its precise rolein the TIC import complex is yet to be defined.

The fact that LLS1(PAO)-related proteins exhibitiron-binding motifs that are conserved in bacterialARH enzymes but operate on different substratesleaves open the question of the evolutionary rela-tionship between these enzymes. In this study wehypothesized that all LLS1(PAO)-related oxygenasesshare a common origin. We sought support for thishypothesis by examining the phylogenetic relation-ship between a collection of 95 plant and bacterialnon-heme oxygenases that share similar iron-bindingmotifs. Our results suggest a common origin for LLS1,PTC52, TIC55 and CAO in oxygenic cyanobacteriabut a separate and more recent origin for CMO en-zymes.

Materials and methods

Plant material

Plants of Arabidopsis ecotype Columbia were used formRNA isolation. Plants were grown at 22 ◦C under a16 h/8 h light/dark regime at ca. 200 µmol photonsm−2 s−1. Herbaceous specimens were collected fromthe vicinity of the University of Toledo, researchersgardens, and the Stranahan Arboretum, Toledo, OH.

Protein isolation and immunoblot analysis

Total protein extracts were isolated from plant leavesas previously described (Cheng et al., 1996). Cel-lular lysates were clarified, and protein was quanti-fied by Bradford analysis (Bio-Rad, Richmond, CA).Proteins (20 µg) were separated on a 7.5% SDS-polyacrylamide gel and blotted onto nitrocellulose.Nitrocellulose membranes were blocked for 45 min atroom temperature with 5% skim milk in Tris-salinebuffer pH 8.0 containing 0.05% Tween-20 (TBST)and then incubated in primary antibody, mouse anti-LLS1:MBP fusion protein for 1 h. After washing in

TBST, blots were incubated for 1 h at room temperat-ure with peroxidase-conjugated goat anti-mouse IgG(1:5000, Jackson Immunoresearch Lab., West Grove,PA) and the immunoreactive complexes developed forvisualization.

RNA isolation, RT-PCR and sequencing

Total RNA was isolated by grinding 1 g frozen Ar-abidopsis ecotype Columbia leaf tissue to a powderand suspending in 10 ml RNA extraction buffer (REX)(2.0 M guanidine thiocyanate, 0.6 M ammoniumthiocyanate, 0.2 M sodium acetate pH 4.0, 8% gly-cerol, 50% phenol). After vortexing samples for 5 min,2 ml of chloroform was added and samples were vor-texed for a further 3 min. Phases were separated bycentrifugation at 12 000 × g for 15 min, the upperphase recovered, added to 5 ml of isopropanol, mixed,incubated at 25 ◦C for 10 min, and centrifuged at12 000×g for 10 min at 4 ◦C. The RNA precipitate waswashed with 70% ethanol and centrifuged again. TheRNA pellet was allowed to air-dry and re-suspendedin RNAase-free water. mRNA was isolated from totalRNA with the MicroPoly(A)pure isolation kit ac-cording to the manufacturer’s instructions (Ambion,Austin, TX). Reverse transcription was performedwith the Retroscript first-strand synthesis kit accord-ing to the manufacturer’s instructions (Ambion). Thecoding regions of the Arabidopsis Lls1(At3g44880)and Ptc52(At4g25650) genes were amplified by poly-merase chain reaction (PCR) employing the primersets AGSP47/AGSP48 and ALGSP1/ALGSP2 re-spectively (listed below). The annealing temperat-ures used were 50 ◦C and 60 ◦C, respectively,and MgCl2 concentration was 4 mM. The primerswere ALGSP1 (ATGGAAGCTGCTCTTGCTGCAT-GCGCTCTTCC), ALGSP2 (CATTTCAAACAAC-AGCATGGTTGTAGTCATGGTAATGG), AGSP47(ATGTCAGTAGTTTTACTCTCTTCTACTTCTGC),and AGSP48 (CTACTCGATTTCAGAATGTACAT-AATCTCTAAAC).

Amplified PCR products were cloned into thepTOPO cloning vector according to the manufac-turer’s protocol (Invitrogen, Grand Island, NY). Theplasmids clones containing Arabidopsis Lls1(Pao) andPtc52 coding regions were named pYM18-1 andpYM20-1 respectively (GenBank accession numberAY344061 and AY344062 respectively). The DNA se-quence of cloned PCR products was determined withBigDye Terminator Cycle Sequencing and an AppliedBiosystems 3700 DNA Analyzer at the Plant-Microbe

43

Genomics Facility (Ohio State University, Columbus,OH).

Retrieval of sequences from databases anddetermination of gene structure

The neighborhood search algorithm BLAST (Ba-sic Local Alignment Search Tool; Altschul et al.,1997) was employed for database searches throughthe National Center for Biotechnology Informa-tion (NCBI), The Arabidopsis Information Resource(TAIR), Cyanobase, and DOE Joint Genome Insti-tute BLAST WWW servers. In addition, rice gen-omic sequences were retrieved from the Rice GenomeDatabase (http://210.83.138.53/rice/). The amino acidsequences of 95 non-heme oxygenases were down-loaded or conceptually translated from genomic DNAand cDNA sequences available from GenBank fileswhich are listed in Supplementary Tables 1 and 2.

The exon/intron structure for Arabidopsis, rice andChlamydomonas oxygenase genes was determined bypairwise comparison of genomic and EST sequenceinformation. The gene structure predicted in Genbankfiles did not always match that determined by our ana-lysis. The actual coding regions used in Figure 3 andthe accession numbers of ESTs used in this analysisare: A thaliana Cao gene At1g4446 (AF17720050);join bases 1–587, 715–951, 1222–1326, 1405–1680, 1763–1910, 1986–2170, 2259–2371, 2448–2742, 2826–2990, and supported by EST AB021316.O. sativa Cao1 gene (scaffold AAAA01000620);join complement bases 27477–27403, 26860–26618,26443–26339, 26257–25979, 25883–25736, 25595–25411, 25298–25186, 25065–24771, 24618–24436,and supported by ESTs AF284781, AB021310,D46313, D48707, AU095684, C24864, AU225916,and BU672866 (Unigene Os.22029). O. sativa Cao2gene (scaffold AAAA01000620); join complementbases 18299–18206, 17823–17578, 17214–17110,17034–16756, 16672–16525, 16111–159227, 15812–15700, 15612–15318, 15167–14985, and suppor-ted partially by EST BI805076. C. reinhardtii Caogene (scaffold 8); join complement bases 3804–33745, 33529–33200, 33003–32506, 32343–31840,and supported by cDNA AB015139 and ESTsAB015139, AV629131, BG 846842. A thalianaTic55 gene At2g24280 (AC006585); join comple-ment bases 90163–91284, 91366–91468, 91560–91954, and supported by ESTs NM 128041,AY089083, BE529873, AV442063, BE038210,AV439633, AI995341, BE528579, AV531633. O.

sativa Tic55 gene; Scaffold AAAA01023723, trans-lation of 718–2337 and supported by ESTs D47027,BU667200, BM422257, BM422260, J010H03,BI808977, BI808984. A. thaliana Lls1(Pao) (Acd1)gene Atg344880 (NC−003074); join bases 16392818–16393231, 16393535–16393770, 16393865–16393991, 16394080–16394216, 16394300–16394459, 16394532–16394816, 16394910–16395164, and supported by full-length cDNA cloneRAFL07-16-F05 and pYM18-1 (AY344061), andESTs 175M23T7, BE526342, 84E8T7, BE844958,pAZNII0788R, APZ16c10R, RAFL09-43-F19,APZ74b02F. O. sativa Lls1(Pao) gene (scaffoldAAAA01000724); join complement bases 16095–15707, 15609–15372, 15284–15158, 14631–14495,14354–14195, 13993–13717, 13065–12811, andsupported by ESTs AA753785 and BI801593.Z. mays Lls1(Pao) gene (U77346); join bases3115–3764, 3854–4089, 4178–4304, 5480–5616,5729–5888, 6119–6397, 6923–>7129, and suppor-ted by cDNA AAC49676, and ESTs AI979621,AW065214, AW289039, BG265514. A. thalianaPtc52 gene At4g25650 (AL050400); join comple-ment bases 13885–13370, 13246–13059, 12977–12892, 12822–12638, 12555–12367, 12273–12083,12008–11753, and supported by RT-PCR productpYM20-1(AY344062). O. sativa Ptc52 gene (scaf-fold AAAA01007078); join complement bases 5663–5151, 5072–4885, 4668–4566, 4449–4295, 4191–3391, 3870–3683, 3514–3256, and supported byESTs AU181024, AU057990, BM421452. A. thali-ana Cmo gene At4g29890 (BAC clone F27B13)join bases 33446–33743, 33822–33867, 33945–34080, 34174–34248, 34327–34542, 34627–34722,34834–34955, 35036–35129, 35125–35265, 35349–35483, and supported by ESTs BE526553, AI996605,AV815748, AY090377. O. sativa Cmo gene (scaffoldAAAA01000729); join complement bases 36454–36329, 35650–35605, 35390–35255, 34793–34719,34633–34426, 34317–34222, 33942–33824, 33726–33633, 33171–33122, 32673–32529.

Multiple sequence alignment and phylogenetic treeanalysis

Protein sequences were aligned with Clustal V withinthe Megalign program (DNAStar, Madison, WI) andwith PAM250 residue weights. The PAUP 4.0b10program (Swofford, 2002) was employed for the gen-eration of phylogenetic trees and consensus clado-grams with distance and parsimony optimality cri-

44

Figure 2. Detection of an LLS1(PAO)-like protein in vascular andnon-vascular plants. Western blot of protein samples isolated fromleaf tissue of the indicated species. A 20 µg portion of protein wasloaded per lane. Blots were probed with an anti-LLS1:MBP fusionprotein. Arrow indicates the location of the 52 kDa LLS1(PAO) pro-tein from maize and similarly sized cross-reactive proteins in otherspecies.

teria respectively. Node support for these trees wasevaluated with the bootstrap method and was per-formed for 500 replicates. For parsimony trees allcharacters were weighted equally. Starting trees wereobtained by random stepwise addition, and the tree-bisection-reconnection algorithm was used for branchswapping. For distance trees the distance measurewas mean character difference; starting trees wereobtained by neighbor joining and the tree-bisection-reconnection algorithm. Bootstrap analysis with thePAUP 4.0b10 program was performed on a MacintoshG3 workstation or at the Ohio Supercomputer Cluster(www.osc.edu).

Results and discussion

Lls1(Pao) belongs to a small family of non-hemeoxygenases in plants.

The relationship between the maize Lls1(Pao) genes indifferent species was examined. An anti-LLS1(PAO)monoclonal antibody was used to detect a uniquerelated protein not only in a selection of dicotyle-donous woody and herbaceous plants but also in themore primitive vascular plant Equisetum and the non-vascular moss Polytrichum (Figure 2). These resultsindicate that an LLS1(PAO)-like protein is probablypresent universally in land plants which is consistentwith its reported role in the opening of the tetrapyrrolering during chlorophyll detoxification (Hortensteiner,1999; Hortensteiner et al., 2000).

The phylogenetic relationship of the Lls1(Pao)gene to other plant genes was then examined by per-forming homology searches with plant EST databases

and the Arabidopsis and rice genomes. A survey ofthese databases revealed that no more than five genesin both Arabidopsis and rice contain the signatureRieske (Motif A) and mononuclear (Motif B) iron-binding motifs exhibited by LLS1(PAO) (Gray et al.,2002). The Arabidopsis Acd1 (At3g44880) gene is anorthologue of the maize Lls1(Pao) gene (Yang et al.,2004) which, in turn, is 30% identical to the productof the Arabidopsis At4g25650 gene. The At4g25650gene is highly homologous to the 52 kDa PTC52 genefrom barley which is proposed to encode a pchlide bsynthase activity in the chloroplast membrane (Rein-bothe et al., in press). Two other genes are Cao andCmo, which have known functions in catalyzing Chlb production and choline biosynthesis, respectively,within the chloroplast compartment (Figure 1) (Bur-net et al., 1995; Rathinasabapathi et al., 1997; Tanakaet al., 1998; Espineda et al., 1999). There is a directduplication of the Cao gene in rice (Cao2) but it isnot clear if this is a functional gene or a pseudogene(predicted coding region in Materials and methods).The fifth gene is Tic55, which encodes an unknownfunction in the inner chloroplast membrane but hasbeen found to be loosely associated with protein trans-port complex proteins (Caliebe et al., 1997). Pairwisecomparison of the coding regions of these genes showsthat each of the family members is conserved betweenmonocots and dicots, and that the five members aredistinct from one another (Figure 3A).

The completed Arabidopsis and rice plant genomicsequences were used to compare the intron/exon struc-ture of these genes so as to discern if any of these genesare the result of a recent duplication event. The ex-act positions of introns were determined by alignmentof genomic DNA sequences with extant ESTs fromvarious databases (Figure 3B). In the case of A. thali-ana Lls1(Pao) and Ptc52 genes, a full-length cDNAwas isolated and sequenced by RT-PCR. For three ofthe five pairs of homologous genes (Lls1(Pao), Caoand Cmo) the gene structure was conserved betweenrice and Arabidopsis. In the case of the Chlamydo-monas Cao gene on scaffold 8 (predicted gene 8.14),for which a cDNA clone is known, the intron/exonpositions are also not shared with land plants (Fig-ure 3B) as anticipated given the ancient origin of thisenzyme function (Tomitani et al., 1999). In the caseof Tic55, the Arabidopsis gene exhibits just two in-trons and there are none in rice. The Arabidopsis andrice Ptc52 genes differ slightly in the size of exonsthree and four but the positions of the introns areconserved. However pairwise alignments of the exon

45

Figure 3. A. Pairwise sequence identity values of Arabidopsis and rice non-heme oxygenases. The coding regions of the plant genes depictedin A (minus predicted transit peptides) were aligned with Clustal W (default parameters) and pairwise distance values tabulated as shown. B.Gene structure of plant and algal non-heme oxygenases. Gene structure is shown as exons (blocks) joined by introns (lines). The conservedRieske and mononuclear iron-binding motifs are shown as hatched and shaded boxes. A third conserved motif of unknown function is shownas a dotted box. Scale as shown. For intron/exon boundary and sequence information, see Materials and methods.

sequences did not reveal any conservation of intronposition between the five pairs of genes. This observa-tion is particularly obvious in the vicinity of conservedmotifs (Figure 3B). The conservation of intron posi-tions between the same gene family members but notbetween different gene family members indicates thatall of these five genes had existed prior to monocot anddicot divergence about 200 million years ago and thusare not the result of a recent duplication event in landplants. It is known that (LLS1)PAO and CAO activ-ities are present in the algae Chlorella protothecoidesindicating a more ancient origin for these gene func-tions (Hortensteiner, 1999; Hortensteiner et al., 2000).

A preliminary examination of the Chlamydomonas re-inhardtii draft genome reveals at least six non-hemeoxygenases other than Cao (predicted genes 37.24,37.26, 41.13, 327.2, 2597.4, 282.0) with signific-ant homology to Lls1(Pao), Tic55 and Ptc52 (but notCmo). Two of these genes appear to be the resultof a recent duplication event (predicted genes 37.24and 37.26 on Scaffold 37) like the Cao1 and Cao2genes in rice (data not shown). The absence of cD-NAs to confirm gene structure precluded the analysisof these genes in this study. The detection of thesegenes in a eukaryotic alga, however, suggests that the

46

roles of these genes evolved prior to the transition to aterrestrial habitat.

Conservation of iron-binding centers inLLS1(PAO)-related non-heme oxygenases

Homologues of LLS1(PAO)-like plant non-heme oxy-genases are also found in cyanobacteria indicating thatthese gene functions may have existed prior to theevolution of algae (Gray et al., 1997, 2002). Thisis clearly true for the Cao gene, which has beendemonstrated to be present in the Chl b-containingcyanobacteria Prochloron didemniii and Prochloronhollandica (Moreira et al., 2000). However, the hy-pothesis that the Cao gene has a monophyletic originfor all chlorophyll b-producing organisms (Tomitaniet al., 1999) has been questioned by the absence ofa convincing Cao homologue in the genomes of twoProchlorococcus strains (Hess et al., 2001). A singlenon-heme oxygenase with Rieske and mononuclearmotifs is encoded by these genomes but its relation-ship to Cao or other non-heme oxygenases has notbeen defined (Hess et al., 2001).

To define the evolutionary and possible functionalrelationships of plant LLS1(PAO)-like oxygenases toother non-heme oxygenases, a phylogenetic analysisof 95 related proteins from a wide spectrum of spe-cies was performed. Reiterative BLAST searches re-vealed that the LLS1(PAO)-like oxygenases share theiron-binding motifs exhibited by the oxygenase com-ponents of multicomponent bacterial aromatic ring-hydroxylating (ARH) enzymes (Pfam00484) (Neidleet al., 1991). The Nam classification system categor-ized 54 different ARH enzymes into 4 groups basedon pairwise alignment scores and the separation ofkey amino acid residues in the consensus Rieske typeand mononuclear-type iron-binding sites (Nam et al.,2001). Plant and cyanobacterial LLS1(PAO)-like oxy-genases were not included in the development of thatNam classification system, but this sequence-basedclassification system easily facilitates the phylogeneticcomparison with novel related proteins (where inform-ation on subunit composition is not yet known). Atleast four members from each of the ARH groups wereselected for inclusion in our phylogenetic analysis anddesignated NG1 (Nam Group 1) to NG4 followingtheir names in Figures 4–7.

In order to meaningfully align a larger set of 95oxygenases from a broader variety of species than hasbeen previously considered, an operational taxonomicunit that was less than the entire protein was chosen.

In addition, the plant proteins exhibited transit peptidesequences that were not present in bacterial proteins.In a region of each protein comprising the two highlyconserved iron binding motifs and the variable inter-vening region, it was feasible to align all 95 proteinswith the ClustalW algorithm program (Figure 4A–Band Supplementary Figure 1). An examination of thepairwise distance values indicated that it was possibleto place the bacterial dioxygenases into the same fourgroupings as Nam although different percent similar-ities were used as cutoff points (data not shown). Inagreement with the Nam classification system all pro-teins exhibited a Rieske-type [2Fe-2S] cluster bindingsite that could be expressed as Cys-X1-His-X16−18-Cys-X2-His (Figure 4A). In addition, an arginineimmediately adjacent to the first histidine, and twoaromatic residues in the vicinity of the second his-tidine, were nearly universally conserved within thismotif (Figure 4A). The mononuclear Fe2+-bindingsite in ARH enzymes can be expressed as Glu-X3−4-Asp-X2-His-X3−5-His (Jiang et al., 1996; Nam et al.,2001). According to the Nam classification system, theplant oxygenases CAO and TIC55 exhibit a spacing ofresidues in both motifs that matches that of vanillatedemethylases such as VanA(19151) in Nam group 1(Figure 4B and Supplementary Figure 1). The spacingof residues within the mononuclear Fe2+-binding mo-tif for LLS1(PAO) and PTC52 is also similar to Namgroup 1 proteins, except that there is a 17 residuespacing at the center of the Rieske motif which isseen in Nam groups 2, 3 and 4 and gene 7970 fromBurkholderia fungorum.

In contrast, the residue spacings and alignmentswithin these motifs for CMO oxygenases do not matchany of the Nam groupings precisely. In particular theCMO group is unique amongst all the oxygenases ex-amined in having three residues between the aspartateand the first histidine residue of the mononuclear iron-binding motif (Figure 4B). In addition, plant CMOproteins are distinguished from other plant oxygenasesin that they each exhibit the NWK triplet that is al-ways conserved 7 residues prior to motif B in Namgroups 2, 3 and 4 (Figure 4B and SupplementaryFigure 1). An examination of the crystal structureof NDO indicates that the NWK triplet is betweenthe I191 and P198 residues that line the pocket be-low the active site (Kauppi et al., 1998). A numberof other predicted oxygenases from bacteria also donot fit easily into four groupings of the Nam classi-fication system including gene 1092 from Ralstoniametalidurans, gene 2224 from Ralstonia solancearum

47

Figure 4. Multiple sequence alignment of conserved iron-binding sites of selected representative plant and bacterial non-heme oxygenases (analignment of all 95 oxygenases used in this study is provided in Supplementary Figure 1). The alignment was performed with a region of eachprotein spanning both Rieske [2Fe-2S] and mononuclear Fe2+iron-binding motifs as the operational taxonomic unit (start and end residues areshown and the distance between motifs is shown in the central column). Sequences were aligned with the CLUSTAL W program and a PAM250weight matrix, a gap penalty of 8, and a gap length penalty of 10. Other settings were default. Strictly conserved residues are shaded gray andother highly conserved residues are shown in reverse type. Proteins are listed according to their gene name or gene number (SupplementaryTables 1 and 2), followed by the abbreviated species and strain number in parenthesis. Plant oxygenases are shaded black and cyanobacterialoxygenases are shaded gray.

48

Figure 5. Evolutionary relationships among plant, cyanobacterial and bacterial proteins containing Rieske and mononuclear iron-bindingmotifs. Partial phylogenetic tree of 95 non-heme oxygenases estimated with the weighted neighbor joining distance method. The excluded treebranches are shown in Figure 6 and are connected to this figure by a dotted line. Phylogenetic tree was estimated from the alignment representedin Supplementary Figure 1. Branch lengths are proportional to the expected number of amino acid substitutions per site (values shown abovecenter of each branch; for parameters, see Materials and methods). The reliability of each bifurcation was estimated using bootstrap analysis(percentage values over 50% are shown encircled next to nodes, values less than 50% are not shown), and the support for each of the branchesis indicated by line thickness. The tree is unrooted with OXOO and CARAa as a monophyletic outgroup. Plant oxygenases are shaded blackand cyanobacterial oxygenases are shaded gray.

GMI1000, gene 4529 from Burkholderia fungorumand gene 1360 from Novosphingobium europea.

Lls1(Pao)-like genes are related to non-hemeoxygenases in aerobic photosynthesizers

In order to characterize the evolutionary relationshipsbetween the aforementioned proteins, phylogenetic

trees were estimated using both distance and parsi-mony criteria (Figures 5 and 6 and SupplementaryFigure 1). A comparison between trees obtained usingboth of these methods is useful in discerning reliablephylogenetic relationships (Hall, 2001). A compar-ison of the two trees obtained in this study showscorrelative branching, and most unreliable bifurca-

49

Figure 6. Evolutionary relationships among cyanobacterial and bacterial proteins containing Rieske and mononuclear iron-binding motifs.Partial phylogenetic tree of 96 non-heme oxygenases estimated with the weighted neighbor joining distance method. Tree branches shown areconnected to those in figure 5 by a dotted line. Phylogenetic trees were estimated from the alignment represented in Supplementary Figure 1.Plant oxygenases are shaded black and cyanobacterial oxygenases are shaded gray.

tions (bootstrap values <50%) seen in the distancetree (Figures 5 and 6) are reduced to polytomies inthe parsimony tree (Supplementary Figure 1). Us-ing a distance-based method for tree construction re-capitulated the groupings determined by Nam et al.(2001) for bacterial ARH enzymes (Figures 5 and6). Nam groups 2, 3 and 4 form distinct clades sup-ported by reliable forks with subclades that includecarbazole (CarAa), dioxin (DxnA1), and aniline di-oxygenase (Tdn1) (Figure 6). The inclusion of more,recently discovered ARH-type enzymes reveals thatmost cluster within a major division of all the en-zymes that includes Nam group I ARHs as evidencedby a basal polytomy for this major clade (Supplement-ary Figure 2). This group includes a diverse set ofenzymes to which the majority of plant and cyanobac-terial oxygenases are more closely related. Withinthis larger group, LLS1(PAO) and PTC52 form adistinct grouping that includes 11 cyanobacterial pro-

teins. Likewise, TIC55 and CAO homologues eachform clades that include two cyanobacterial proteins.The failure of the single dioxygenase from Prochloro-coccus species strains CCMP1378 and MIT9313 tocluster near CAO is in agreement with the obser-vations of Hess et al. (2001), who propose thatthese enzymes may have arisen by convergent evol-ution. Enzymes related to vanillate demethylase forma clade that does not include any plant or cyanobac-terial enzymes. The remainder of this major groupinclude four cyanobacterial genes that may encode achlorobenzoate dioxygenase-like function and a fifthcyanobacterial enzyme related to a dioxygenase in-volved in the synthesis of the aromatic ring-containingantibiotic pyrrolnitrin encoded by Pseudomonas andMyxococcus species.

50

Figure 7. Evolutionary relationships among LLS1(PAO)-like plant and cyanobacterial non-heme oxygenases. A. Unrooted phylogram ofconcensus tree of 25 LLS1(PAO)-related oxygenases estimated using neighbor joining distance method and bootstrap analysis. A total of25 non-heme oxygenases containing the motif in described in B were aligned with the latter 75% of each protein length as the operationaltaxonomic unit (the Rieske motif to the carboxyl terminus). Branch lengths are proportional to the expected number of amino acid substitutionsper site (values shown next to each branch). The reliability of each bifurcation was estimated using bootstrap analysis (percentage values over50% are shown encircled next to nodes, values less than 50% are not shown). B. A novel conserved motif defines a set of closely relatedLLS1(PAO)-like proteins in cyanobacteria and plants. Examination of phylogenetic trees (Figure 3) revealed a clade of proteins related toLLS1(PAO) that share a concensus motif that can be defined as D/E/N-x-F/Y/W-x2-H-x3-C-x2-C. This motif is found at a common distanceof 82–84 amino acids from the carboxyl terminus of these proteins. The last sequence is from a 110 amino acid ORF from Nostoc (all0986),in which the motif is found near the center of the predicted protein. Plant oxygenases are shown in white text against a black background andcyanobacterial oxygenases are shown in black text against a gray background.

A separate origin for CMO amongst non-hemeoxygenases of soil-dwelling bacteria

The distance tree structure indicates that plant CAO,LLS1(PAO), TIC55 and PTC52 proteins are more

closely related to Nam group1 oxygenases whereasCMO is more closely related to oxygenases from NamGroups 2 to 4. Within the second large clade CMOforms a small clade that does not include any strongbacterial homologues which reflects the fact that the

51

use of a dioxygenase in the first step of glycine betainesynthesis is provided by alternative enzymes in bac-teria (Rathinasabapathi et al., 1997; Incharoensakdiand Wutipraditkul, 1999). None of the six Lls1(Pao)-related genes from C. reinhardtii genes show signi-ficant homology to Cmo (data not shown) which wasanticipated because this algae synthesizes glyceroland not glycine betaine in response to hyperosmoticshock (Rosa and Galvan, 1995). Strong homologuesof CMO were not identified in any cyanobacterial spe-cies, and gene 1261 from Synechococcus sp WH8102is the only cyanobacterial protein that falls within thissecond major clade. Gene 1261 is the only cyanobac-terial oxygenase that exhibits the NWK tripeptideimmediately prior to motif B (Figure 4), but other-wise it does not show strong homology to CMO. Itappears that CMO, whose substrate is not aromatic,has an evolutionary origin distinct from all other plantoxygenases and its closer relatedness to bacterial ARHenzymes is suggestive of the recruitment of an oxy-genase upon horizontal transfer from a soil-dwellingbacterium to a plant. The existence of the unique Syn-echococcus sp. WH8102 gene 1261 and the fact thatmost plants are not known to accumulate significantamounts of glycine betaine despite the presence of aCmo homologue is enigmatic. The reported inabilityof the Arabidopsis Cmo homologue to exhibit CMOactivity in Escherichia coli (Hibino et al., 2002) ismost likely the result of a mutated PCR product usedin that study because the mutated residue I371V isconserved across species and is not observed in extantArabidopsis ESTs. It is possible that glycine betaineaccumulates at very low levels in many plants, or thatit accumulates only under unusual osmotic stress con-ditions. Alternatively, it is possible that these plantshave alternative mechanisms to resist osmotic stressor that these genes encode a related function that hasnot yet been discovered.

Lls1(Pao), Tic55 and Ptc52 are closely related togenes in oxygenic cyanobacteria

Phylogenetic analysis revealed a tight clustering of theplant LLS1(PAO), TIC55 and PTC52 proteins with aset of predicted proteins from marine and freshwa-ter cyanobacteria (Figure 5). A closer examination ofthese proteins revealed that they share an extendedcarboxyl terminus that is ca. 120 amino acids longerthan that in CAO and CMO proteins. The strongersequence homology between these proteins permittedthe alignment of all 25 sequences in a region from the

Rieske motif to the end of each protein as the opera-tional taxonomic unit (amino terminus sequences thatcontain choroplast signal peptides were not present inthe cyanobacterial homologues). An unrooted phylo-genetic tree estimated with a distance method revealsa largely equidistant relationship between these cy-anobacterial and plant proteins (Figure 7A). PlantLLS1(PAO) and PTC52 proteins are slightly more re-lated to gene 1779 from the marine cyanobacteriumTrichodesmium erythraeum and gene 4354 from thefreshwater cyanobacterium Nostoc sp. PCC7120 thanthey are to the clade that includes gene 1747 from Syn-echocystis sp. PCC6803. The plant TIC55 proteins aremore related to gene 5007 from Nostoc sp. PCC7120and gene 2180 from Nostoc punctiforme. The remain-ing five proteins from cyanobacteria form two cladeseach containing a member from Trichodesmium eryth-raeum and Nostoc sp. PCC7120. The short basalbranches at the center of this tree indicate that these25 proteins are closely related and likely to be derivedfrom a common ancestor. In support of this interpret-ation is the existence within the extended terminus ofthese proteins of a third motif that is strictly conserved(Figure 7B). This motif of unknown function containstwo aromatic amino acids and two cysteine residuesand can be summarized by the consensus sequenceF/Y/W-x2-H-x3-C-x2-C (Figure 7B). A search for thismotif within all non-redundant proteins in Genbankwas negative. A survey of the Nostoc genome, how-ever, revealed a small ORF (all0956) that is predictedto contain a 110 amino acid protein that also containsthis motif (Figure 7b). Closer examination reveals thatthis gene may be slightly longer and have further ho-mology to LLS1(PAO) but does not contain the twomotifs shared by this group of proteins. Further ana-lysis is required to determine if all0956 is expressedor if it is a relic gene fragment.

Neither homologues to the Lls1(Pao) gene or pro-teins containing this third motif were identified in asurvey of the complete genome of the photosyntheticbacterium Chlorobium tepidum TLS. C. tepidum is athermophilic green sulfur bacterium and is strictly an-aerobic and obligatorily autotrophic. This bacteriumsynthesizes bacteriochlorophyll c and carotenoids forlight harvesting but utilizes hydrogen and various sul-fur compounds as terminal electron acceptors andnot dioxygen. An anaerobic environment negatesthe possibility of using dioxygen-requiring enzymesin metabolism but not necessarily the requirementfor redox-sensing proteins. Homologues of Lls1(Pao)were found in the genomes of all oxygenic cyanobac-

52

teria examined with the exception of both strains ofProchlorococcus marinus. Thus, although the pres-ence of LLS1(PAO)-like proteins correlates stronglywith the emergence of oxygenic photosynthesis theyare not requisite for photosynthesis itself. These pro-teins may have evolved to allow aerobic photosynthes-izers organisms to adapt and become fine-tuned to thewide variety of oxygen and light levels that exist in thewater and on land (Ting et al., 2002). All chlorophyllb-containing organisms are aerobic and the utilizationof dioxygen for the synthesis of Chl b and pchlide b byCAO and PTC52 were significant adaptations for lightharvesting by aerobic photosynthesizers (Tanaka et al.,2001). Since most of the cyanobacteria examined inthis study do not synthesize Chl b, the function ofLls1(Pao)-related genes in these species may indicatea role in the removal of Chl which is a potent photo-toxin in aerobic environments. It is known that algaeexhibit an LLS1/PAO activity but this has not yet beenreported in cyanobacteria which may use excretion asthe mechanism of chlorophyll detoxification (Millerand Holt, 1977; Richaud et al., 2001). Finally, thefact that 3 out of 4 Lls1(Pao)-related genes appearto have a Chl related function is suggestive that theTIC55 protein also plays a hitherto unsuspected rolein Chl metabolism which is not mutually exclusivefrom a proposed redox regulatory role in the chloro-plast (Küchler et al., 2002). One possibility is thatTIC55 catalyzes Chl b to Chl a conversion – an en-zyme activity that has been reported in plants but forwhich the corresponding gene has not been isolated(Rudoi and Shcherbakov, 1998; Beale, 1999). Chldegradation products may also serve as intracellularsignals during development and stress responses andthus indirectly influence the import of proteins intothe chloroplast (Küchler et al., 2002). The finding inthis study that TIC55, LLS1(PAO) and PTC52 sharea common C-terminus motif with conserved cysteineresidues may lend further support to the hypothesis ofKüchler et al. (2002). Redox-regulated proteins ex-hibit conserved cysteine residues (Kobayashi and Ito,1999; Kuge et al., 2001), and a recent proteomicsstudy identified many previously unsuspected targetsof thioredoxin regulation in the chloroplast stroma(Yano et al., 2002; Balmer et al., 2003). Althoughthe C-terminus motifs of LLS1(PAO), TIC55 andPTC52 exhibit a CxxC motif conserved in the cata-lytic site of thiol:disulfide oxidoreductases (Chiverset al., 1997), the surrounding amino acids do notsuggest a thioredoxin-like fold. Further insights intothe functions of LLS1(PAO)-related proteins in plants

and their shared motifs are currently being soughtby studying knockouts of the homologous proteins incyanobacteria that were identified in this study.

Classification of LLS1(PAO)-related non-hemeoxygenases based on conserved iron-bonding motifs

The phylogenetic analysis by distance and parsi-mony methods that we performed supports the re-classification of dioxygenases by Nam et al. (2001)and the use of a smaller, more widely conservedoperational taxonomic unit was successful in recapit-ulating the major groupings that they reported. Theanalysis of a much larger group of genes indicateshowever that further sub-classification may be re-quired in future categorization of these enzymes. Inparticular, it is clear that Nam group I dioxygenasesinclude diverse enzymes with non-phenolic substratesas exemplified by LLS1(PAO), CAO and PTC52. Thephylogenetic tree that was estimated using parsimony(Supplementary Figure 1) shows 15 clades branchingfrom a common polytomy that includes all group Ienzymes (including CarAa and OxoO). Newly dis-covered members of this large group may be assigneda category based on clustering nearest to a group ofproteins with a known substrate type. Thus, classIA would include enzymes clustering near genes en-coding vanillate demethylase (VanA), chlorobenzoatedioxygenase(CbaA) or phthalate dioxygenase (Pht3),which act on phenolic compounds. This class wouldinclude enzymes such as aminopyrrolnitrin D oxi-dase (PrnD), which catalyzes oxidation of the aminoside group of the aromatic ring of aminopyrrolnitrinto a nitro group in the biosynthesis of the antibi-otic pyrrolnitrin. Indeed, many of the dioxygenases inthis group have been shown to have broad specificity,but are unified in that they act on phenolic com-pounds. Subclass IA would include carbazole 1,9a-dioxygenase (from Pseudomonas strain CA10) and2-oxo-1,2-dihydroquinoline 8-monooxygenase (fromPseudomonas strain 86). It was found that these twoenzymes grouped separately from other group I en-zymes when using the shorter amino acid sequenceas operational taxonomic subunit, but they were moreclearly classified when the full-length protein was usedin the analysis. Subclass 1B would include CAO en-zymes from various sources which use chlorophyll a(a cyclic tetrapyrrole) as a substrate. The unique oxy-genases from Prochlorococcus strains CCMP1378 andMIT9313, are tentatively assigned in this subclass ifthey can be shown to act on divinyl Chl a as a sub-

53

strate. Prochlorococcus, like other prochlorophytes, isdefined by its production of Chl b, and it has beenproposed that there is a single origin of CAO (Tom-itani et al., 1999). Our alignments suggest that theseoxygenases may have originated from a Nam group I-type enzyme, but convergent evolution from a Rieskedomain protein is a plausible alternative explanation.Prochlorococcus may have evolved in iron-limitedoceans and diversified from other cyanobacteria froma common phycobilisome-containing ancestor (Tinget al., 2002). The fact that these species produce un-usual divinyl Chl derivatives in order to occupy a dif-ferent ecological niche could account for the observedsequence differences in a CAO-like enzyme.

Subclass IC could include all LLS1(PAO) relatedenzymes (including PTC52 and TIC55) that exhibitthe third motif identified in Figure 7B until definitivesubstrates are defined for all these enzymes. If theseenzymes all share a chlorophyll intermediate as sub-strate then it may be appropriate to combine them withCAO in subclass 1B. It is clear that CMO-like proteinsform a distinct clade separate from Nam Groups I toIV and we propose a new group V (Figure 6), whosemembers are closely related to the monooxygenasefrom spinach, which uses choline as substrate. Finally,a clade of 9 oxygenases with unknown substrates thatalso group separately from Nam groups I to IV maybe designated as class VI (Figure 6). These sugges-ted classifications build on the groupings defined byNam et al. (2001) using phylogenetic analysis, whichcontinues to be a useful classification system in theabsence of subunit or substrate information.

Conclusions

In conclusion, our analysis indicates that LLS1(PAO)belongs to a small but diverse group of non-hemeoxygenases in plants. Of these, CMO homologueshave evolved recently in higher plants although theirconservation in plants such as Arabidopsis, whichis not known to accumulate glycine betaine, sug-gests another alternative function in most plants. Incontrast, LLS1(PAO)-related non-heme oxygenasesincluding PTC52, TIC55 and CAO appear to haveevolved amongst oxygenic cyanobacteria that synthes-ize chlorophyll but are not required in all such speciessuch as Prochlorococcus marinus. The presence ofa novel C-terminus motif with conserved cysteineresidues suggests that LLS1(PAO), TIC55 and PTC52may share similar redox-regulation connected withchlorophyll metabolism in the chloroplast. Finally, our

extensive phylogenetic analysis of LLS1(PAO) relatednon-heme oxygenases provides a useful reference forfuture classification of these enzymes.

Acknowledgements

We thank Scott Leisner for helpful discussion and ad-vice on this manuscript. Funding for this research wasprovided by the U.S. Department of Agriculture (grant2000–01465 to J.G.) and by the University of Toledo(laboratory startup funds to J.G.). We thank StefanHörtensteiner (University of Bern, Switzerland) forsharing results prior to publication.

References

Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J.H., Zhang,Z., Miller, W. and Lipman, D.J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.Nucl. Acids Res. 25: 3389–3402.

Balmer, Y., Koller, A., del Val, G., Manieri, W., Schurmann, P. andBuchanan, B.B. 2003. Proteomics gives insight into the regulat-ory function of chloroplast thioredoxins. Proc. Natl. Acad. Sci.USA 100: 370–375.

Batie, C.J., Ballou, D.P. and Correll, C.C. 1991. Phthalate di-oxygenase reductase and related flavin-iron sulfur containingelectron transferases. Chem. Biochem. Flavoenzymes 3: 543–556.

Beale, S.I. 1999. Enzymes of chlorophyll biosynthesis. Photosyn.Res. 60: 43–73.

Burnet, M., Lafontaine, P.J. and Hanson, A.D. 1995. Assay, puri-fication and partial characterization of choline mononxygenasefrom spinach. Plant Physiol. 108: 581–588.

Caliebe, A., Grimm, R., Kaiser, G., Lubeck, J., Soll, J. and Heins,L. 1997. The chloroplastic protein import machinery contains aRieske-type iron-sulfur cluster and a mononuclear iron-bindingprotein. EMBO J. 16: 7342–7350.

Cheng, W.-H., Im, K.H. and Chourey, P.S. 1996. Sucrose phos-phate synthase expression at the cell and tissue level is co-ordinated with sucrose sink-to-source transitions in maize leaf.Plant Physiol. 111: 1021–1029.

Chivers, P.T., Prehoda, K.E. and Raines, R.T. 1997. The CXXCmotif: a rheostat in the active site. Biochemistry 36: 4061–4066.

Espineda, C.E., Linford, A.S., Devine, D. and Brusslan, J.A. 1999.The AtCAO gene, encoding chlorophyll a oxygenase, is requiredfor chlorophyllb synthesis in Arabidopsis thaliana. Proc. Natl.Acad. Sci. USA 96: 10507–10511.

Gray, J., Close, P.S., Briggs, S.P. and Johal, G.S. 1997. A novelsuppressor of cell death in plants encoded by the Lls1 gene ofmaize. Cell 89: 25–31.

Gray, J., Janick-Buckner, D., Buckner, B., Close, P.S. and Johal,G.S. 2002. Light-dependent death of maize lls1 cells is mediatedby mature chloroplasts. Plant Physiol. 130: 1–14.

Hall, B.G., 2001. Phylogenetic Trees Made Easy: A How-ToManual for Molecular Biologists. Sinauer, Sunderland, MA.

Harayama, S., Kok, M. and Neidle, E.L. 1992. Functional and evol-utionary relationships among diverse oxygenases. Annu. Rev.Microbiol. 46: 565–601.

54

Hess, W.R., Rocap, G., Ting, C.S., Larimer, F., Stilwagen, S., Leam-erdin, J. and Chisholm, S.W. 2001. The photosynthetic apparatusof Prochlorococcus: insights through comparative genomics.Photosyn. Res. 70: 53–71.

Hibino, T., Waditee, R., Araki, E., Ishiwaka, H., Kenji, A., Tanaka,Y. and Takebe, T., 2002. Functional characterization of cholinemonooxygenase, an enzyme for betaine synthesis in plants. J.Biol. Chem. 277: 41352–41360.

Hortensteiner, S., 1999. Chlorophyll breakdown in higher plants andalgae. Cell. Mol. Life Sci. 56: 330–347.

Hortensteiner, S., Chinner, J., Matile, P., Thomas, H. and Donnison,I.S. 2000. Chlorophyll breakdown in Chlorella protothecoides:characterization of degreening and cloning of degreening-relatedgenes. Plant Mol. Biol. 42: 439–450.

Incharoensakdi, A. and Wutipraditkul, N. 1999. Accumulation ofglycinebetaine and its synthesis from radioactive precursors un-der salt-stress in the cyanobacterium Aphanothece halophytica.J. Appl. Phycol. 11: 515–523.

Jiang, H., Parales, R.E., Lynch, N.A. and Gibson, D.T., 1996. Site-directed mutagenesis of conserved amino acids in the alpha sub-unit of toluene dioxygenase: potential mononuclear non-hemeiron coordination sites. J. Bact. 178: 3133–3139.

Karlsson, A., Parales, J.V., Parales, R.E., Gibbon, D.T., Eklund,H. and Ramaswamy, S. 2003. Crystal structure of naphthalenedioxygenase: side-on binding of dioxygen to iron. Science 299:1039–1042.

Kauppi, B., Lee, K., Carredano, E., Parales, R., Gibson, D.T.,Eklund, H. and Ramaswamy, S. 1998. Structure of an aromatic-ring-hydroxylating dioxygenase – naphthalene 1,2 dioxygenase.Structure 6: 571–586.

Kobayashi, T. and Ito, K., 1999. Respiratory chain strongly oxidizesthe CXXC motif of DsbB in the Escherichia coli disulfide bondformation pathway. EMBO J. 18: 1192–1198.

Küchler, M., Decker, S., Hörmann, F., Soll, J. and Heins, L.2002. Portein import into chloroplasts involves redox-regulatedproteins. EMBO J. 21: 6136–6145.

Kuge, S., Arita, M., Murayama, A., Maeta, K., Izawa, S., Inoue,Y. and Nomoto, A. 2001. Regulation of the yeast Yap1p nuc-lear export signal is mediated by redox signal-induced reversibledisulfide bond formation. Mol. Cell. Biol. 21: 6139–6150.

Lange, S. J. and Que, L. Jr. 1998. Oxygen activating nonheme ironenzymes. Curr. Opin. Chem. Biol. 2: 159–172.

Mason, J.R. and Cammack, R. 1992. The electron-transport proteinsof hydroxylating bacterial dioxygenases. Annu. Rev. Microbiol.46: 277–305.

Miller, L.S. and Holt, S.C. 1977. Effect of carbon dioxide on pig-ment and membrane content in Synechococcus lividus. Arch.Microbiol. 115: 185–198.

Moraswki, B., Segura, A. and Ornston, L.N. 2000. Substrate rangeand genetic analysis of Acinetobacter vanillate demethylase. J.Bact. 182: 1383–1389.

Moreira, D., Guyader, H.L. and Phillipe, H. 2000. The origin of redalgae and the evolution of chloroplasts. Nature 405: 69–72.

Nam, J.-W., Nojiri, H., Yoshida, T., Habe, H., Yamane, H. andOmori, T. 2001. New classification system for oxygenase com-ponents involved in ring-hydroxylating oxygenations. Biosci.Biotechnol. Biochem. 65: 254–263.

Neidle, E.L., Hartnett, C., Ornston, L.N., Bairoch, A., Rekik, M.and Harayama, S. 1991. Nucleotide sequences of the Acinetobac-ter calcoaceticus benABC genes for benzoate 1,2-dioxygenasereveal evolutionary relationships among multicomponent oxy-genases. J. Bact. 173: 5385–5395.

Prescott, A.G. and Lloyd, M.D. 2000. The iron(II) and 2-oxoacid-dependent dioxygenases and their role in metabolism. Nat. Prod.Rep. 17: 367–383.

Rathinasabapathi, B., Burnet, M., Russell, B.L., Gage, D.A., Liao,P.-C., Nye, G.J., Scott, P., Golbeck, J.H. and Hanson, A.D. 1997.Choline monooxygenase, an unusual iron-sulfur enzyme catalyz-ing the first step of glycine betaine synthesis in plants: prostheticgroup characterization and cDNA cloning. Proc. Natl. Acad. Sci.USA 94: 3454–3458.

Richaud, C., Zabulon, G., Joder, A. and Thomas, J.-C., 2001. Ni-trogen or sulfur starvation differentially affects phycobilisomedegradation and expression of the nblA gene in Synechocystisstrain PCC 6803. J. Bact. 183: 2989–2994.

Rosa, L. and Galvan, F. 1995. Metabolic pathway for glycerolsynthesis under osmotic stress in the freshwater green algaChlamydomonas reinhardtii. Plant Physiol. Biochem. 33: 213–218.

Rudoi, A.B. and Shcherbakov, R.A., 1998. Analysis of the chloro-phyll biosynthetic system in a chlorophyll b-less barley mutant.Photosyn. Res. 58: 71–80.

Ryle, M.J. and Hausinger, R.P. 2002. Non-heme iron oxygenases.Curr. Opin. Chem. Biol. 6: 193–201.

Tanaka, A., Ito, H., Tanaka, R., Tanaka, N., Yoshida, K. and Okada,K. 1998. Chlorophyll a oxygenase is involved in chlorophyll bformation from chlorophyll a. Proc. Natl. Acad. Sci. USA 95:12719–12723.

Tanaka, R., Koshino, Y., Sawa, S., Ishiguro, S., Okada, K.and Tanaka, A. 2001. Overexpression of chlorophyllide a oxy-genase (CAO) enlarges the antenna size of photosystem II inArabidopsis thaliana. Plant J. 26: 365–373.

Ting, C.S., Rocap, G., King, J. and Chisholm, S.W. 2002.Cyanobacterial photosynthesis in the oceans: the origins andsignificance of divergent light-harvesting strategies. Trends Mi-crobiol. 10: 134–142.

Tomitani, A., Okada, K., Miyashita, H., Matthijs, H.C. and Ohno,T. 1999. Chlorophyll b and phycobilins in the common ancestorof cyanobacteria and chloroplasts. Nature 400: 159–162.

Yang, M., Wardzala, E., Johal, G.S. and Gray, J. 2004. Thewound-inducible Lls1 gene from maize is an ortholog of theArabidopsis Acd1 gene, and the LLS1 protein is present innon-photosynthetic tissues. Plant Mol Biol. 54: 175–191.

Yano, H., Kuroda, S. and Buchanan, B.B. 2002. Disulfide proteomein the analysis of protein function and structure. Proteomics 2:1090–1096.