Proc. Natd. Acad. Sci. USAVol. 88, pp. 8606-8610, October 1991Genetics

A single base deletion in the Tfm androgen receptor gene createsa short-lived messenger RNA that directs internaltranslation initiation

(anroge inenstivity/mNA stabft/bldtr mRNA/quatltatlve PCR/nudear mRNA precursors)

MARIA-LUISA GASPAR*t, TOMMASO MEo*, PIERRE BOURGAREL*, JEAN-LOUIS GUENETt, AND MARIO TosI*§*Unit6 d'Immunogenetique et Institut National de la Sante et de la Recherche Medicale U.276, Institut Pasteur, 75724 Paris C6dex 15, France; and *Unit6 deG6n6tique des Mammiferes, Institut Pasteur, 75724 Paris C6dex 15, France

Communicated by Mary F. Lyon, May 16, 1991 (received for review January 2, 1991)

ABSTRACT Testosterone-resistant male mice hemizygousfor the X-chromosome-linked mutant gene Tfm express detect-able but severely reduced levels of androgen receptor mRNA,amounting to about 10% of the level found in normal malelittermates. No structural abnormality could be identied inthe coding region of the messenger by a series of RNase-protection assays. However, cell-free translation of RNAstranscribed in vitro from enzymatically ampfied overlappingsegments of exon 1 revealed a truncated receptor protein andhelped to localize the site of premature termination. Sequenceanalysis of the relevant DNA segment disclosed that deletion ofa single nucleotide in the hexacytidine stretch at position1107-1112 alters the reading frame of the messenger andintroduces 41 misense amino acids before a premature termi-nation codon at position 1235-1237. Separately initiated car-boxyl-terminal polypeptides are synthesized in vitro, sprobably at the in-frame AUG codon 1507-1509, which lies ina favorable context for tation initiation, and at the non-AUG codon 1144-1146. Transcriptional impaments of theTfm gene were ruled out by a quantitative analysis of enzy-maticaly amplified nuclear RNA precursors. No other changecould be identified by sequencing the complete coding region ofTfmn cDNA. The finding of the unsuspected termination codonand the evidence of internally initiated carboxyl-terminal poly-peptides reconcile previous conclusions and account for allknown phenotypic properties of the mutation.

The testicular feminization (Tfm) mutation of the mouse (1)is the genetic disorder of androgen responsiveness (2, 3) thathas contributed most to the current ideas on the mechanismsof sex differentiation in mammals (see, e.g., ref. 4). Theinsensitivity of Tfm/Y mice to androgens was shown sincethe very early studies to correlate with a deficiency ofandrogen receptor (AR) (5-8).Tfm/Y males have been found to have consistently about

10%o of normal testosterone-binding activity in various or-gans, but due to the low amounts and biochemical lability ofthe receptor its characterization has remained incomplete.The use ofhuman anti-receptor autoimmune antibodies com-bined with improved stabilization of cytosol extracts hasrecently shown that the Tfm receptor has a size of about 66kDa and therefore resembles a truncated version of the110-kDa wild-type receptor (9). Nevertheless, it appears thatthe residual receptor of Tfm/Y mice is indistinguishable byisoelectrofocusing from a minor component of the androgen-binding activity in normal animals (10, 11). The observationthat not all responses to androgens are lacking in testicularfeminized mice (12, 13) clouds the picture even further.

No less incongruous are the current views on the Tfmphenotype at the mRNA level. The use of poly(A)+ RNAfrom various organs of Tfm/Y mice as negative controls inthe selection of putative molecular clones encoding ARproved rewarding (14). However, the normal AR mRNAappeared heterogeneous in size, and the organs of Tfm/Yanimals seemed to lack all but certain short mRNA tran-scripts of undefined origin (14). Furthermore, it has beenspeculated that the genetic alteration of the Tfm locus couldreside in a transcriptional impairment of the AR gene (15).Our search for the genetic defect underlying the Tfm mutationstemmed from the cDNA cloning of the complete codingregion of the mouse AR and the ensuing study of the mRNAstructure in normal mice and Tfm/Y mutants, using homol-ogous noncrosshybridizing probes (16).

EXPERIMENTAL PROCEDURESRNA Exrction and Quantitative RNase-fPotecton Assays.

Animals were sacrificed at 2 months of age. In addition to thecrosses described previously (16), we have studied litter-mates obtained from a backcross of a +Ta/Y male to aC57BL/6 Tfm +/+ Ta female. The latter mating schemeallows identification of the Tfm +/Y males by the coatstructure (see, e.g., ref. 17). RNA extraction from tissues andRNase mapping techniques have been described (16).In Vitro Transription and T tion. Synthetic RNA

with a 5'-cap structure was transcribed with T3 RNA poly-merase according to the protocol supplied by Stratagene. Invitro translations were performed with the nuclease-treatedrabbit reticulocyte lysate system (18), prepared according toa modified protocol (T.M., unpublished data). Nuclease-treated lysate contributed 50%o by volume of the final assaymix, and the final concentrations of the added componentswere 30 mM KCI, 50 mM KOAc, 0.8 mM Mg(OAc)2, 10 mMcreatine phosphate, creatine kinase at 160 pg/ml, each un-labeled amino acid (except methionine) at 50 AuM, calf livertRNA at 200 jug/ml, RNA transcript at 4 ,ug/ml, and [35Slme-thionine at 2 mCi/ml (1 Ci = 37 GBq). Translations werecarried out at 300C, usually for 2 hr.

Sequencing Techniques. Genomic DNA was prepared asdescribed (19). The entire exon 1 sequence of Tfm mice wasdetermined on eight independent clones in the pBluescriptvector (Stratagene). The sequence of the AR from Tfm/Ymice was completed on four cDNA clones from the 3' codingregion obtained as previously described (16).

Quantitative Analysis of mRNA Precurso. The generalprocedures for enzymatic amplification of nuclearRNA have

Abbreviation: AR, androgen receptor.tOn leave of absence from Centro Nacional de Microbiologia,Instituto Carlos III, 28220 Madrid, Spain.§To whom reprint requests should be addressed.

8606

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Proc. Natl. Acad. Sci. USA 88 (1991) 8607

been described (20). Chromosomal DNA was removed withtwo cycles of extraction with acid phenol/chloroform (21)followed by treatment with RNase-ftee DNase (Promega).Mock cDNA samples were prepared in which reverse tran-scriptase was omitted. Dilutions from the same reversetranscription reaction were made prior to a 20-cycle enzy-matic amplification. The probes used to reveal the productsof RNA PCR were obtained by enzymatic amplification ofgenomic DNA.

RESULTS AN) DISCUSSIONReduced Levels of an Apparently Normal AR mRNA in

Tfim/Y Mice. We already showed that Tfm results in de-pressed levels of authentic AR mRNA (16). To search forminor alterations, the coding region of the AR mRNA ofTfm/Y mice was examined by using mouse-specific RNAprobes in RNase A protection experiments according to thestrategy outlined in Fig. 1A. Full protection ofthe probes wasobtained with Tfm/Y RNA from kidney not only by usingthe3' probe shown in Fig. 1B but also with a series of RNAprobes covering the entire coding region. These data rule outmajor changes in coding sequences, including splicing de-fects. Fig. 1B also shows that the MRNA levels detected inthe kidney of Tfm/Y animals are approximately 20%/ ofthosefound in heterozygous female littermates, or 10% of normalmaie littermates. Similar estimates were obtained on brainand liver RNA (not shown).

Detection of a Frameshift Mutation in Exon 1. Bearing inmind the consistent finding of low levels of receptor-likeactivity in Tfm/Y mice, we next searched for a translationaldefect in the mutant AR mRNA. The A/B domain of theandrogen receptor (see Fig. 1A) is encoded by a single largeexon (22). Thus, we transcribed and translated in vitro thefirst exon of the AR gene, using as template for transcriptionuncloned DNA fragments obtained by enzymatic amplifica-tion from genomic DNA of normal mice or Tfm/Y mutants(Fig. 2). The in vitro synthesized exon 1 polypeptide from twodistinct Tfm/Y mice was in fact about 10 kDa smaller thanthat obtained from normal animals (Fig. 28). Such grossalteration implies a premature termination of translation,rather than a large deletion, because of the failure of RNaseprotection experiments to detect structural anomalies in theTfm mRNA. Comparison in wild-type and mutant animals ofthe translation products obtained from the complete exon 1sequence with those from a 3'-truncated fragment thereof(see Fig. 2A) was expected to provide an indication as to thelocation of the presumed stop codon. Indeed, the 3' deletionyields the expected truncated product from wild-type exon 1RNA (cf. the first two lanes in Fig. 2B), but it is of noconsequence for the length of the already shortened exon 1polypeptide of Tfmk. These findings localize roughly a stopcodon in the 3' half of exon 1 of Tfm animals, upstream ofcodon 486. It should be noted that the apparent molecularmass of the intact (approximately 65 kDa) and the truncated(approximately 60 kDa) versions of the wild-type exon 1proteins (first two lanes in Fig. 2B) are both much larger thancalculated from their amino acid compositions (54 kfla and50.5 kDa, respectively). This anomaly might be due to therather uncommon amino acid composition ofthe A/B domainof ARs (16), perhaps its high proline content, since abnor-mally slow electrophoretic mobilities have been noted forother proline-rich proteins (25).

Nucleotide sequence analyses of several clones of exon 1derived from Tfm/Y animals revealed the lack of a C residueat position 1112 relative to the wild-type sequence (Fig. 2C).The rest of the first exon of the mutant AR gene wassequenced entirely and proved to be identical to that of thewild-type AR from C57BL/6 mice (16). As shown in Fig. 3A,the deletion of one nucleotide at position 1112 shifts the

A A/B CD E

RI T-N

N

N

N

-ap t'N6~

B

C

1.1 AR56Eco RI/1.1 AR56Not 1/1.1AR56

0.3AR1Not 1/0.3AR1

1.6AR2Pvu Il/1.6AR2Not l/1.6AR2

A4-

4- 4 06

An .- 0

H.e'>Y l'+

X X A

X

FIG. 1. 'Quantitative analysis of kidney AR mRNA in micehemizygous for the Tfm mutation. Two hemizygous mutant animals,designated Tfm +/Y (#1) and Tfm +/Y (#2), are compared with acarrier female littermate (Tfm +/+ Ta) and a normal male littermate(+ TaIY). (A) RNA probes corresponding to different portions ofthemouse AR are shown under the linearized form of the plasmids used(see ref. 16 for 1.1AR56 and 1.6AR2; 0.3AR1 contains the first 283coding nucleotides of the mouse AR mnRNA). They are alignedaccording to a schematic representation of the coding region (A/B,transactivation domain; C, DNA-binding domain; D, linker region;and E, hormone-binding domain). The origin and direction of tran-scription are indicated by arrows under each plasmid, and capitalletters denote restriction enzyme sites: N, Not I; RI, EcoRI; P, PvuII. (B) Protection of probe EcoRI/1.1AR from RNase A digestion bythe indicated amounts of total kidney RNA. The position and lengthin nucleotides of the protected and unprotected probe are indicatedby arrows. (C) Protection of a mouse P-actin probe (16) by the samekidney RNA preparations. Exposure times were 7 and 1 day, withintensifying screens, for B and C, respectively.

translational readout to a frame that encounters a stop codonat position 1235. Premature termination of AR translationexplains the complete insensitivity of Tfm/Y mice to andro-gens, since these animals are expected to produce a short-ened amino-terminal polypeptide devoid of both the DNA-and the hormone-binding domains (see Fig. 3A). However,this finding is apparently at variance with the claims notedabove of a shortened mutant protein able to bind androgenand DNA.

Internal Trantion Initiation Sites Precede the DNA-Binding Domain. The following possibilities could explainhow translation of a mutant mRNA may resume past aninternal stop codon. First, a translationally competentmRNA species could Se formed by skipping the prematuretermination codon through an alternative splicing of thenuclear precursors. Second, a single AR messenger couldgenerate two different proteins, an amino-terminal polypep-tide from the normal initiator codon and a carboxyl-terminalone by internal initiation of translation.We have previously demonstrated that normal mouse liver

contains a single AR mRNA of about 10 kilobases (kb), with

Genetics: Gaspar et al.

Proc. Natl. Acad. Sci. USA 88 (1991)

A

B

A G

EXON 1

Complete (518 aa)

4 Truncated (486 aa)

IN VITROTRANSCRIPTION

ANDTRANSLATION

CNORMAL Tfm + Yk 1, Tfm . Y ( .-:2)

kDa c T C T C T

92 -

69-

46

Tfm + Y NORMALT C Ci A T C G A.......T

L ` :

-i

30

FIG. 2. Detection of a frameshift mutation by PCR amplificationfollowed by in vitro transcription and translation. (A) The completeor truncated AR exon 1 sequences from normal and Tfm mice wereenzymatically amplified by using primers indicated by arrows (seeoligonucleotides 1-3 in Table 1). A T3 RNA polymerase recognitionsite introduced in the sequence of the oligonucleotide used as 5'primer (number 1 in Table 1) is represented by a stippled box. Anarrowhead points to the region that contains a frameshift mutation.aa, Amino acid residues. (B) In vitro translations directed by 5'-capped mRNAs synthesized from the complete (lanes C) or truncated(lanes T) exon 1 sequences of normal mice or of two different Tfm+/Y animals. Translation products were separated by SDS/PAGE(12.5% acrylamide) and compared to radioactive molecular massmarkers (Amersham). (C) Nucleotide sequence of Tfm or normalexon 1 clones. Positions from 1101 to 1130 of the AR sequence (16)are shown. This sequence is deposited with the GenBank database(accession no. M37890). The C-rich region containing the Tfm-specific deletion is marked by brackets.

long 5' and 3' untranslated regions estimated to extend over1.5 kb and more than 5 kb, respectively (16). RNase protec-tion experiments with probes that cover the entire codingregion (shown in Fig. 1) failed to detect alternative RNAsplicings. By contrast, past the spurious stop codon and inphase with the original initiation lie three ATG codons (Fig.3 A and B) that could potentially direct internal initiation andgive rise to a second amino-terminally truncated AR proteincontaining both the DNA- and hormone-binding domains.The sequences flanking the three putative protein reinitiationcodons (Fig. 3C) show that the first of them, at position 503,is in a favorable context for initiation of translation (G atpositions -3 and +4) (26, 27). Although direct binding of the40S ribosomal subunit to internal positions on the mRNA hasbeen inferred in some cases (reviewed in ref. 28), mostinitiations at internal codons do not appear to contradict thestandard model whereby the ribosomal subunit binds at the5' end ofan mRNA and scans the transcript linearly in searchof an initiation codon, usually an AUG, positioned in anappropriate sequence context (reviewed in ref. 29).We produced a complete version ofthe coding region ofthe

Tfm AR messenger by fusing the 5' exon segment containingthe frameshift mutation to a wild-type 3'-terminal cDNAfragment, as shown in Fig. 3A. In vitro transcriptions andtranslations using this construct produced, in addition to theprematurely terminated receptor, two polypeptides with ap-parent molecular masses ofabout 60 and 45 kDa, respectively(marked with arrowheads in Fig. 3D, lane 2). Both polypep-tides are translated within the authentic reading frame, sinceno open reading frame larger than 116 amino acids is presentin the AR mRNA (16). On account of its size the smallerpolypeptide appears to initiate at one of the clustered in-frame AUGs (most likely at position 503, cf. Fig. 3C), as itcomigrates (Fig. 3D, lane 4) with the translation product of a

Table 1. Synthetic oligonucleotides sequence used as primersNo. Sequence

1 GCAAflAAICCTCACIAAAGGGTGGAAGCTAGA-GACAAGCTC

2 AACTTACCGCATGTCCCCATAAGG3 AACTCCACCAGV&IAMACACTrC4 GCAATTAACCCTCACTAAAGGCCCAGTCCCAATT-

GTGTCAAAAG

5 CGAATTAACC CACTAAA CTGTCCGGGCCGC-CGCAC

6 CG _AA~rAACCCTCACTAA AAGGATGCTGTCC-GGGCCGCCGCAC

7 TTAECGAICTENCTGTGTGTGGAAATAGATGGG8 ATCT CTGTGTGTGGAAATA9 GCACTGCTGCTG1TCAC;GATTAGT10 TITrCAGCCCATCCACTGGAACT11 CGAATGAACTACATCAAGGAACTCGenomic exon 1 sequences were amplified (Fig. 2A) by using

oligonucleotides 1 and 2 or 1 and 3. The upstream oligonucleotide 1contains a T3 RNA polymerase promoter (underlined) and the firstnucleotide of the synthetic RNA is marked by an arrowhead.Segments from wild-type or Tfm cDNA clones containing a T3promoter (cf. Fig. 3A) were constructed by PCR amplification, usingoligonucleotides 4, 5, and 6 as upstream primers for the productionof the synthetic RNAs denoted C1, C2, and *C2, respectively, andoligonucleotide 7 as the downstream primer. An ATG translationstart codon is shown in italics within oligonucleotide 6. Portions ofAR nuclear RNA precursors were amplified after reverse transcrip-tion primed by oligonucleotide 8, using oligonucleotides 9 and 10,which prime at the boundaries of intron 6, or 11 and 7, which primein exons 7 and 8, respectively (cf. Fig. 4A). Artificial Kpn I and ClaI sites in oligonucleotides 3 and 7, respectively, are double-underlined, and triplets complementary to termination codons areboxed in oligonucleotides 7 and 8. Intronic sequences, based onthose reported for the human AR gene (23, 24) are shown in boldcharacters.

synthetic messenger starting 29 nucleotides upstream ofcodon 503 (denoted C1 in Fig. 3A).No AUG codon can be found at a suitable location in the

AR mRNA sequence (16) to account for the initiation of the60-kDa carboxyl-terminal polypeptide. However, residueLeu-382 is encoded by a CUG codon (cf. Fig. 3 B and C) thatis in a favorable context for translation initiation (27). Al-though initiation at non-AUG codons has been shown to bemuch less efficient than that of AUG codons in the samecontext (27), this CUG lies within a long C+G-rich stretch(16), which may enhance its efficiency (27, 30). The possi-bility of initiation at this non-AUG codon was tested by usinga synthetic RNA, denoted C2 in Fig. 3A, which covers the 3'halfofthe normalAR sequence, starting at the Leu codon 364(marked with a starred bracket in Fig. 3B), and contains 55nucleotides upstream ofthe putative non-AUG initiation site.This synthetic RNA indeed directs the efficient translation ofa polypeptide (lane 5 in Fig. 3D) with the same mobility as thelarger of the carboxyl-terminal polypeptides seen in thetranslation of the full-length synthetic Tfm messenger (com-pare with lane 2). The most likely initiation site of thispolypeptide was narrowed down by comparing its gel mo-bility with that of a polypeptide which starts at an artificialAUG introducedjust before Leu-364 (see the starred bracketin Fig. 3B). As shown in Fig. 3D (lane 6) aband cdrrespondingto the 60-kDa carboxyl-terminal polypeptide was indeedfound slightly below the strong band expected from initiationat the AUG codon introduced upstream. It is worth notingthat the relative intensities of the two bands are consistentwith the ribosome scanning model and that the reticulocyte

8608 Genetics: Gaspar et al.

- i ,, ,

- 3C.-

Proc. Natl. Acad. Sci. USA 88 (1991) 8609

AN (411 al

Tim

truncated exon 1

cl

C2

C2

*C2-TIn

BNormal AAAYQNRDYYNFPLA[SGPPHPP

Tfm---------------------- F

Normal PTHPHARIKkENPLDYGSAWAAA

2fin LPIHTPVSSWRTHWTTAAPGLRR

Normal AQCRYGDLGSLHGGSVAGPSTGS

TfA RNAAMGTWVVYMEG All

Normal PATTSSSWHTLFTAEEGQLYGPG

GGGSSSPSDAGPVAPYGYTRPPQ

LTSQESDYSASEVWYPGGVVNEM

3SPNCVKSENGPWNENYSGPY(

NRLDSTRDHVLPIDYYFPPFT(ICGDEASGCHYGALTCGSCKVFE

RAAEGKQKYLCASRNDCTIDKFF

KNCPSCRLRKCYEAGM LGARK

FIG. 3. Premature termit(A) Schematic representati4deletion of a C residue (Alposition 1235), which deternamino-terminal polypeptidebinding domain mark the losenting potential internal stanon-AUG potential start crecognition site, introducedtruncated form of exon 1 (calongside the right margin r(full-length synthetic messenjexon 1 of the Tfm AR gene (of a sequenced wild-type cEsenting specific portions ofDNA segments into which Iduring PCR amplification (pimutation alters the Tfm pIposition 371). Potential reiniland 517 are shown in bold cito a non-AUG start site at pcnucleotide sequences arourpared with the consensus si

27). (D) SDS/PAGE (10%rected by 5'-capped synthet,RNA; lanes 2-7, translaticsynthetic RNAs sketched[35S]methionine were loade46-kDa and the 69-kDa mar

lysate assay respects thestart codon efficiency (ca26, 27 and 31). To examirat this non-AUG codonIthe downstream cluster itermination we construct3A), in which the artificlowed by the mutant AR,;at the strong artificial Atpolypeptide composed ofstop codon encountered XWhile the short size of t]tion in the SDS/PAGE go

-I internal-initiations are evident also on this test RNA, yieldinga) stop the same 5'-distal polypeptides. Interestingly, translation of

SITo the shorter one was consistently found enhanced on theRNAA71 D construct featuring the Tfm premature termination (cf. lanes

Normal 6 and 7), indicating that reinitiation after premature termina-2 tion does indeed take place in our in vitro system, albeit3 inefficiently. Although these data cannot be readily extrap-

------- , 4 olated to predict whether both internal initiations observed invitro also take place in vivo, only the described canonical and

5 noncanonical initiation sites are in a location compatible with6 the size and the binding properties of the truncated receptor

characteristic of the Tfm mutation. If scanning of the ARmRNA over a long distance from the cap site also occurs in

C +1 +4 POSION vivo, and allows an internal, albeit 5'-end-dependent initia-?p 372 tion at the CUG codon, a carboxyl-terminal AR polypeptideRP 372 MGn n A.A G ought to be synthesized regardless of the Tfm mutation.LA 396 A A A T (i)503 Moreover, initiation at either of the downstream AUGFQ 396 T G G 507 codons is expected to be significantly enhanced by the3P 420 (9 A C A T C 517 frameshift mutation, since these start sites are located at aI

(a)) A G C0Z09 382 distance from the stop-codon that is suitable for reinitiation

3G 444 D (32). At any rate a5'-end-independent internal initiation (28))G 468 may also explain the in vivo data, particularly because theVP 492 native AR mRNA has a long 5' "noncoding" region whoseGD 51 6 -69 structure is unknown (16).CL 540 -- - Normal Levels of Nuclear AR mRNA Precursors in Tfin/YFK 564 - 46 Mice. The molecular basis of the qualitative defect havingEA 588 been defined, it became important to check whether the sameLK 612 anomaly or additional mutations are responsible for the

markedly reduced levels of AR mRNA in Tfm/Y mice (seenation and internal translation initiation. Fig. 1). We examined the steady-state levels of AR nuclearon of the Tfm mRNA. Shown are the RNA precursors by enzymatic amplification after reverse1112) and the resulting stop codon (at transcription, under conditions that allow quantitative resultsnines the production of a 411-amino acid (20). As outlined in Fig. 4A, complementary DNA synthesisThree vertical bars before the DNA- from total kidney RNA was primed in the last exon (E8),cation of in-frame AUG codons repre- using an AR-specific oligonucleotide. Intron 6 sequences

art sites, and a dot indicates an in-frame were amplified with intron-specific oligonucleotides, andnodon. The arrow points to a. Kpn I primers within exons E7 and E8 were used to simultaneouslywith the 3' primer used to produce the amplify intron 7 sequences and the corresponding region of. Fig. 2A). Horizontal bars labeled 2-7 the mature mRNA. Since the structural organization of thisepresent synthetic RNAs. To produce ager a sequenced 5' segment derived from portion of the mouse AR gene is not known, the position and(hatched bar) was fused to the 3' portion the probable size of introns was inferred from the known)NA (open bar). Synthetic RNAs repre- organization ofthe human gene (23, 24). The intron 6-specificthe AR mRNA were transcribed from primers were designed according to the murine cDNA se-the T3 promoter had been incorporated quence to cover the expected 5' or 3' exon-intron junction.rimers 4-6 in Table 1). (B) The frameshift The intensity ofthe hybridization bands containing the intronrotein sequence (underlined starting at 6 sequences amplified from nuclear mRNA precursors wastiation methionines at positions 503, 507, remarkably reproducible in the two littermates shown in Fig.iaracters, and the leucine corresponding 4B and also in two additional littermates (a normal + TaIY

aid the corresponding codons are com male, and a second Tfm +/Y mutant; data not shown). Intquence for initiation oftranslation (26 contrast, the intensity of the band derived from mRNAacrylamide) of in vitro translations di- sequences was lower for Tfm +/Y animals (Fig. 4C), asic RNAs. Lane 1, control with no added demonstrated by using probe 1-7, which detects both the 1-kbn products, in the same order as the fragment containing intron 7 sequences and the 0.3-kb frag-in A. Equal amounts of incorporated ment derived from the mature mRNA. Densitometric anal-Dd on each lane. The positions of the yses of these autoradiograms indicate that mRNA levelsrkers (Amersham) are indicated. estimated by this method in Tfm/Y animals are approxi-

e commonly accepted hierarchy of mately 25% those of heterozygous littermates, in good agree-anicmolyateptedn hierAUG;rchyso ment with the 20%6 value estimated by RNase A protectionnicalh betativereffciency of ini (cf. Fig. 1B). From these experiments, we conclude that the

ae the relative efficiency of intiation reduced levels of mRNA found in Tfm mutants cannot beand at the in-frame AUG codons of accounted for by a transcriptional defect. As no other mu-tn the context of the Tfm premature tation was found within the 2.7-kb coding sequence ofthe ARted a variant RNA (*C2oTfm in Fig. mRNA of Tfm mice (unpublished data), the lowmRNA levelsSala upstream AUG codon was fol- are most likely the consequence of the translational abnor-sequence. Protein synthesis initiated mality, as has been described for other premature terminationJG codon should yield in this case a mutations (33-37).f only 49 amino acids, because of the In conclusion, the mouse Tfm mutation differs from all ARafter the Tfm frameshift (cf. Fig. 3B). mutations so far described. In humans, mostDNA alterationshis polypeptide precludes its detec- result in the deletion of a large portion of the AR gene (38) orel shown in Fig. 3D (lane 7), the two in point mutations affecting the hormone-binding domain (24,

Genetics: Gaspar et al.

8610 Genetics: Gaspar et al.

A1-6 1-7 _ PROBES

E6 E7 E8

}kb 0ikd-..................c............... |CDNA

IIUnspliced0.8kb 1kb 1 RNA

0.3 kb mRNA

BTfm +/Y (#1)

1LlgA Ac 4

C mock cDNA2 ig Tfmr+Y(#1)

.,A X e ,-\ x N C

Tfm +.+Ta

N t-Zt-

Tfm +/+Ta

,, AbN.V

I_1.Okb

0.Q3 kb

FIG. 4. Quantitative comparisons ofnuclear AR precursorRNAsof Tfm/Y mice and their littermates. (A) Outline of the strategy. Thedesign of the two pairs of primers used to amplify introns 1-6 and 1-7,respectively, was based on the mouse AR cDNA sequence, and, forintron 1-6, also on the conservation of the GT and the AG dinucle-otides at the 5'- and the 3'-intron boundaries (see oligonucleotides 9and 10, respectively, in Table 1). Probes used to reveal the DNA blotsare marked with thin lines above the scheme. Note that the I-7 probealso contains short exon sequences (filled boxes). (B) Autoradio-grams obtained after amplification of intron, -6 from dilutions of thecomplementary DNAs corresponding to the indicated amounts oftotal kidney RNA. No signal was obtained in lanes containing theproducts of mock cDNA amplifications from which the reversetranscriptase had been omitted or when no template was used Qanemarked -). (C) Simultaneous quantitation of intron 1-7-containingmRNA precursors and of spliced mRNA. The use of the essentiallyintronic hybridization probe 1-7 leads to a great overestimation ofintron-containing precursor mRNAs relative to the mature ARmRNA. Quantitative comparisons of nuclear precursors or maturemessengers between littermates are possible, since the enzymaticreactions remained within the exponential range of amplification.

39-41). A point mutation in the hormone-binding domain hasalso been reported in rats (15). A second mouse Tfm mutanthas been described (42), which results in a greatly reducedaffinity for androgens, suggesting that it may carry a mutationin the hormone-binding domain. Premature terminationwithin the DNA-binding domain of the human receptorresults in complete loss of hormone binding as well as offunctional activity (43). In contrast with all the examplescited above, the frameshift mutation in the classical Tfm/Y

Proc. Nati. Acad. Sci. USA 88 (1991)

mice allows the production of a carboxyi-terminal peptideinitiated upstream of the DNA-binding domain and explainsthe previous observations of residual DNA- and hormone-binding activity.

We thank Christiane Duponchel for help in the initial phase of thiswork and Girard Masson for assistance in the densitometric analysis~f autoradiograms. We are grateful to Philip Avner, Matthieu LUvi-Etrauss, and Alan Korman for valuable comments on the manuscript.M.-L.G. was the recipient ofa fellowship awarded by the Colegio deEspafia-Fundaci6n Banco Exterior.

1. Lyon, M. F. & Hawkes, S. G. (1970) Nature (London) 227, 1217-1219.2. Dofliku, R., Tettenbirn, V. & Ohno, S. (1971) Nature NewBiol. 232,5-7.3. Ohno' S. & Lyon, M. (1970) Clin. Genet. 1, 121-127.

Bardin, C. W. & Catterall, J. F. (1981) Scient6 211, 1285-1294.5.Aftardi, B. & Ohno, S. (1974) Cell 2, 205-212.

6. Bullock, L. P. & Bardin, C. W. (1974) Endocrinology 94, 746-756.7. Gehring, V. & Tomkins, G. M. (1974) Cell 3, 59-64.8. Ohno, S., Geller, L. N. & Young Lai, E. V. (1974) Cell 3, 235-242.9. Young, C. Y. F., Johnson, M. P., Prescott, J. L. & Tindall, D. J. (1989)

Endocrinology 124, 771-775.10. Wieland, S. J. & Fox, T. 0. (1979) Cell 17, 781-7$7.11. Fox, T. D. & Wieland, S. J. (1981) Endocrinology ift, 790-797t12. Schenkein, I., Levy, M., Bueker, E. D. & Wilson, J. D. (1974) Endo-

crinology 94, 840-84.13. Toole, J. J., Hastie, N. D. & Held, W. A. (1979) Cell 17, 441-44M.14. Lubahn, D. B., Joseph, D. R., Sullivan, P. M., Willard, H. F., French,

F. S. & Wilson, E. M. (1989) Science 240, 327-330.15. Quarmby, V. E., Yarbrough, W. G., Lubahn, D. B., French, F. S. &

Wilson; E. M. (1990) Mol. Endocrinol. 4, 22-28.16. Gaspar, M. L., Meo, T. &Tosi, M. (1990)Mol. Endocrinol. 4,1600-1610.17. Green, M. C. (1981) Genetic Variants and Strains of the Laboratory

Mouse (Fisher, Jena), pp. 243-244.18. Pelham, H. R. B. & Jackson, R. J. (1976) Eur. J. Biochem. 67, 247-256.19. Sambrook, J., Fritsch, E. F. & Maniatis, T. (19S9) Molecular Cloning:A

Laboratory Manual (Cold Spring Harbor Lab., Cold Spring Haibor, NY),2nd Ed., pp. 9.16-9.19.

20. Lipson, K. E. & Baserga, R. (1989) Proc. Nati. Acad. Sci. USA 86,9774-9777.

21. Chomczynski, P. & Sacchi, N. (1987) Anal. Biochem. 162, 156-159i22. Faber, P. W., Kuiper, G. G. J. M., van Rooij, H. C. J., van der Korput,

J. A. G. M., Brinkmann, A. 0. & Trapman, J. (1989) Mol. Cell. Endoc.61, 257-262.

23. Kuiper, G. G. J. M., Faber, P. W., van Rooo, H. C. J., van her Korput,J. A. G. M., Ris-Stalpers, C., Klaassen, P., Trapman, J. & Brinkmann,A. O. (1989) J. Mol. Endocrinol. 2, R1-R4.

24. Lubahn, D. B., Brown, T. R., Simental, J. A., Higgs, H. N., Migeon,C. J., Wilson, E. M. & French, F. S. (1989) Proc. Nail. Acad. Sci. USA86, 9534-9538.

25. Furthmayr, H. & Timpl, R. (1971) Anal. Biochem. 41, 510-516.26. Kozak, M. (1987) Nucleic Acids Res. 15, 8125-8148.27. Kozak, M. (1989) Mol. Cell. Biol. 9, 5073-5080.28. Herman, R. C. (1989) Trends Biochem. Sci. 14, 219-222.29. Kozak, M. (1989) J. Cell Biol. lID, 229-241.30. Prats, H., Kaghad, M., Prits, A. C., Klagibrun, M., Lelias, J. M.,

Liauzun, P., Chalon, P., Tauber, J. P., Amalric, F., Smith, J. A. &Caput, D. (1989) Proc. Natl. Acad. Sci. USA 86, 1836-1840.

31. Kozak, M. (1990) Nucleic Acids Res. 18, 2828.32. Kozak, M. (1987) Mol. Cel. Biol. 7, 3438-3445.33. Atweh, G. F., Brickner, H. E., Zhu, X.-X., Kazazian, H. H. & Forget,

B. G. (1988) J. Clin. Invest. 82, 557-561.34. Baserga, S. J. & Benz, E. J. J. (1988) Proc. Natl. Acad. Sci. USA 85,

2056-2060.35. Baunann, B., Potash, M. J. & K6hler, G. (1985) EMBO J. 4, 351-359.36. DaarI. 0. & Maquat, L. F,. (1988) Mol. Cell. Biol. 8, 802-813.37. Kadowaki, X., Kadowaki, H. & Taylor, S. I. (1990) Proc. Natl. Acad.

Sci. USA 87, 658-662.38. Browp, T. R., Lubahn, D. B., Wilson, E. M., Joseph, P. R., French,

F. S. & Migeon, C. J. (1988) Proc. Natl. Acad. Sci. USA 85, 8151-8155.39. Marcelli, M., Tilley, W. D., Wilson, C. M., Griffin, J. E., Wilson, J. D.

& McPhaul, M. J. (1990) Mol. Endocrinol. 4, 1105-1116.40. Sai, T., Seiho, S., Chang, C., Trifiro, M., Pinsky, L., Mhatre, A.,

Kaufman, M., Lambert, B., Trapman, J., Brinkmann, A. O., Rosenfield,R. L. & Liao, S. (1990) Am. J. Hum. Genet. 46, 1095-1100.

41. Ris-Stalpers, C., Kuiper, G. G. J. M., Faber, P. W., Schweikert, H. U.,van Rooij, H. C. J., Zegers, N. D., Hodgins, M. B., Degenhart, H. J.,Trapman, J. & Brinkmann, A. 0. (1990) Proc. Natd. Acad. Sci. USA 87,7866-7870.

42. Politch, J. A., Fox, T. 0., Houben, P., Bullock, L. & Lovell, D. (1988)Biochem. Genet. 26, 213-221.

43. Marcelli, W. D., Tilley, W. D., Wilson, C. M., Wilson, J. D., Griffin,J. E. & McPhaul, M. J. (1990) J. Clin. Invest. 85, 1522-1528.

fw4w .-Om Oft.."'NO-ATM"; --40.8kb