a screen of low-copy nuclear genes reveals the lfy gene as

Schluumlter amp al bull A screen of low-copy nuclear genesTAXON 56 (2) bull May 2007 493ndash504

493

INTRODUCTIONThe European orchid genus Ophrys is remarkable

for its pollination by sexual deception which makes it an interesting system for evolutionary studies (Kullenberg 1961 Paulus amp Gack 1990) However the reconstruction of relationships within Ophrys especially among very closely related species has been hindered by the lack of resolution obtained with standard chloroplast or nuclear ribosomal internal transcribed spacer (ITS) sequence markers (Pridgeon amp al 1997 Aceto amp al 1999 Soliva amp al 2001 Bateman amp al 2003) The availability of highly variable sequence markers is therefore highly desirable to address the question of species relationships within Ophrys

Ophrys section Pseudophrys represents a monophy-letic group within which standard sequence markers do not provide any resolution (Soliva amp al 2001 Bateman amp al 2003 Bernardos amp al 2005) This section is characterised by attachment of pollinia to a pollinatorrsquos abdomen rather than its head Section Pseudophrys contains the morpho-logically readily distinguishable O lutea sl O fusca sl and O omegaifera sl complexes and the O iricolorO mesaritica species group which has often been considered to be a sub-group of the O fusca sl complex (Paulus amp al 1990 Paulus 1998) The relationships among and within these complexes have so far been amenable only to speculation based upon morphology chromosomal

data not permitting additional insights apart from the identification of tetraploid taxa in the east Mediterranean (Greilhuber amp Ehrendorfer 1975 Bernardos amp al 2003 DrsquoEmerico amp al 2005)

The present study therefore seeks to evaluate nuclear low-copy genes to identify sequence markers that are phylogenetically informative and can be used to infer relationships within Ophrys at a fine level using sect Pseudophrys as a model system The usefulness of low-copy nuclear sequence markers is becoming increasingly recognised since they frequently outperform ITS and plastid markers (eg Bailey amp Doyle 1999 Emshwil-ler amp Doyle 1999 Lewis amp Doyle 2002 Sang 2002 Oh amp Potter 2003 Howarth amp Baum 2005) We have screened a large number of available PCR primers for nuclear genes to identify gene regions that may be useful within Ophrys and related orchids and in addition have designed novel primers from sequences in the sequence databases

MATERIALS AND METHODSPlant material and DNA extraction mdash Ophrys

plant material (Table 1) was collected in the field and leaves preserved in silica gel Non-Ophrys material was from Orchis italica Serapias cf bergonii Himan-toglossum hircinum and Himantoglossum (syn Barlia)

A screen of low-copy nuclear genes reveals the LFY gene as phylogenetically informative in closely related species of orchids (Ophrys)

Philipp M Schluumlter12 Gudrun Kohl1 Tod F Stuessy1 amp Hannes F Paulus2

1 Department of Systematic and Evolutionary Botany University of Vienna Rennweg 14 1030 Vienna Austria philippschluetersystbotuzhch (author for correspondence)

2 Department of Evolutionary Biology University of Vienna Althanstraszlige 14 1090 Vienna Austria Current address Ecological Plant Genetics Swiss Federal Institute of Technology Zuumlrich (ETH)

CHN G29 Universitaumltsstrasse 16 8092 Zuumlrich Switzerland

This paper presents PCR primers and PCR conditions for low-copy nuclear genes in Ophrys and related orchid genera identified via screening of both published and newly designed primers For Ophrys the most useful markers identified in this screen are the LFYFLO gene which contains an intron of 2 kb size and the MADS-box PIGLO gene whose 2 first introns contain single nucleotide polymorphisms with variation at the populational level In the taxa tested our PCR primers amplified single-copy regions Phylogenetic analysis of closely related taxa of Ophrys section Pseudophrys based on LFY revealed the following groups that are delimited by morphology O lutea sl O omegaifera sl with O iricolor nested in this group the two O fusca sl taxa O leucadica and O bilunulata and the O fusca sl taxon O cinereophila together with a group of endemics from Crete

KEYWORDS LEAFYFLORICAULA (LFYFLO) low-copy nuclear sequence markers Ophrys fusca sl Ophrys section Pseudophrys PISTILLATAGLOBOSA (PIGLO) sexually deceptive orchids

494

TAXON 56 (2) bull May 2007 493ndash504Schluumlter amp al bull A screen of low-copy nuclear genes

robertianum Additional plant material (Dendrobium Vanilla Asparagus) was obtained from plants grown at the Botanical Garden of the University of Vienna DNA was extracted using DNeasy Plant Mini Kit (Qiagen) and the manufacturerrsquos protocol eluting DNA in 200 microL Tris-EDTA pH 80 In addition genomic DNA from Arabidopsis thaliana (Invitrogen included in the AFLP Core Reagent Kit) was used

Primer design mdash For design of new primers we used sequences available in the public databases and amino-acid alignments of exons between distantly related taxa (where available including orchid sequences) to iden-tify highly conserved regions and noted known intron positions Alignments were carried out using Clustal X (Thompson amp al 1997) and Bioedit 7 (Hall 2001) Primers were then designed from nucleotide sequence alignments such that (1) their binding sites would lie in conserved exonic gene regions (2) PCR would amplify enough exonic sequence to allow gene identification by BLAST searches and (3) also variable intronic or exonic sequence would be amplified In particular PI and LFY primer design was aided by GenBank sequence AB094985 from Orchis italica and the orchid LFY sequences ob-tained by Montieri amp al (2004) respectively Primers were checked for expected melting temperature loops and primer-primer interactions using Oligo Analyzer 102 software (Kuulasmaa 2002)

Marker screening via polymerase chain reaction (PCR) mdash Both published and new primers (Tables 2

and 3) were screened with standard PCR protocols on a gradient PCR machine (Thermo Hybaid PX2 or Corbett Research Palm-Cycler) using annealing temperatures between 40degC and 65degC degrees Initial reactions were performed in a volume of 25 microL containing 125 microL RED-Taq ReadyMix PCR Reaction Mix (Sigma-Aldrich) 1 microL of each 5 microM forward and reverse primers and c 25 ng genomic DNA Thermal cycling conditions were 95degC 4 min 38times (95degC 40 sec TA 40 sec 72degC 3 min) 72degC 10 min 4degC hold where in each PCR annealing temperatures (TA ) varied over a 15degC temperature gra-dient depending on the expected melting temperatures of the primers used PCR products were loaded on 1 agarose gels in TAE (tris acetate EDTA) buffer stained with ethidium bromide (028 mgL) and photographed under UV light using a Gel Doc 2000 system (BioRad) If no amplification product was obtained DNA and primer concentrations were varied different polymerases (eg Taq DNA polymerase recombinant from Fermentas) used and in some cases the thermal cycling conditions altered PCR reactions that yielded either a smear or weak amplification products were subjected to a two-step PCR optimisation testing different buffer systems and PCR en-hancers using PCR Optimization Kit II (Sigma-Aldrich) and the manufacturerrsquos protocol If multiple bands were obtained they were separated by excision and elution from gel using QIAquick Gel Extraction Kit (Qiagen) Ampli-fied fragments were then sequenced directly to check a PCR productrsquos identity by BLAST searches or cloned and

Table 1 Taxa used and EMBL sequence database accession numbers for LFY

Species Acces- Taxon groupa Country Island Locality Dateb sion EMBL Sequence NoO atlantica Munby O Spain Alhaurin de la Torre 08042004 196A AM489434O basilissa Alibertis amp Reinhard O Greece Samos Klima 21022004 174A AM489432 O basilissa Alibertis amp Reinhard O Greece Kos Asklepion 27022002 66A AM489423O bilunulata Risso F Spain Coin Las Delicias 09042004 198A AM489435O cinereophila Paulus amp Gack F Greece Crete Akoumia 02042003 114A AM489427 AM489428O creticola Paulus F Greece Crete Jouchtas 30032003 104A AM489426O iricolor Desfontaines F Greece Crete Kato Horio 29032003 100C AM489425O iricolor Desfontaines F Greece Crete Ag Paraskies 30032003 106A AM489419O iricolor Desfontaines F Greece Athens 26032004 208A AM489436O ldquokedrardquo Paulus (nom prov) F Greece Crete SpiliGerakari 07052003 150A AM489431O leucadica Renz F Greece Kos Kephalos 01032002 67A AM489424O omegaifera Fleischmann O Greece Crete Thripti 25032002 37A AM489420O ldquopallidulardquo Paulus (nom prov) F Greece Crete Thripti 04052003 145C AM489430O phryganae Devillers-Terschuren amp Devillers L Greece Rhodes Kattavia 21042003 120A AM489429O sicula Tineo L Greece Samos Klima 22022004 177A AM489433O sitiaca Paulus Alibertis amp Alibertis O or F Greece Crete Jouchtas 14022001 61A AM489422O tenthredinifera Willdenow E Greece Crete Gourtinia 022001 56A AM489421Note All plants collected by HFP with vouchers in WU except accessions 120A and 208A collected by PMS and M Fiedler respectivelyaPutative membership of the listed taxa in morphological species groups within Ophrys sect Pseudophrys are indicated where F Ophrys fusca sl L O lutea sl O O omegaifera sl while E is Ophrys sect Ophrys (syn Euophrys)bDates are given in DDMMYYYY format

495


Table 2 PCR primers developed in this study

I Primers for LFYPrimer Primer sequence (5primerarr3prime) Primer Binding Site Length

PCR primers for amplification of LFY from genomic DNAE1Cf ATGGTGCTGGCCACATCGCAGCAACA 1 26E2Gr GAAGAGGTAATCGAGCCCGTTCTTCTTAGCYC 2791 32Nested PCR primers for LFY E1Jf GGAGCTAGAGGAGGTGTTCGAGG 96 23E1Bf GGTACTCGACGATTGCTCGG 131 20E1Af CGCTCTCGACGCACTTTCC 465 19I1Df CCGTCAGCTTGTTTGTTCCTCAC 576 23I1Ef CGTCTGTTCCATTGAACTTCTTGG 651 24I1Ff ATGTATCTTCATCCGATTTGGAATG 816 25I1Af AAGTCATTTCAGACAATCTTAAGTTTKG 1029 28I1Ar CMAAACTTAAGATTGTCTGAAATGACTT 1029 28I1Gf CGACCGCCAACACGCACCTAACAAAG 1241 26I1Gr CTTTGTTAGGTGCGTGTTGGCGGTCG 1241 26I1Cf GATACAGATATRCTGTTCAAAGAGC 1425 25I1Cr GCTCTTTGAACAGCATATCTGTATC 1425 25I1Kf ATTAGGATGAAAGCAGTAAGATTGC 1714 25I1Kr GCAATCTTACTGCTTTCATCCTAAT 1714 25I1Lf TTGAATATGGCTATTCGCAGTTCA 1837 24I1Lr TGAACTGCGAATAGCCATATTCAA 1837 24I1Jr AATAAAACAAATAGCAAAAGTGCCC 2064 25I1Br TACTAAAATGTGCTGACAAATG 2275 22E2Ar AGCTGCACTGGCTCCTCAG 2524 19E2Lr CCTTTCCATCTCTCCTGCCTA 2578 21E2Kr CCGTCGTCATCCTCATCATTCTC 2739 23

II Primers for other genesTarget genesproteins Primer Primer sequence (5primerarr3prime) LengthAcyl-CoA ∆9 desaturase D9Des1f TTTCAYCAYCARTTYACIGAYWSIGA 26 D9Des1r TCRAAIGCRTGRTGRTTRTTRTGCCA 26Acyl-CoA ∆12 desaturase D12Des2f CAYMGIMGICAYCAYWSIAAYACIGG 26 D12Des3r AAIARRTGRTGIGCIACRTGIGTRTC 26APETALA3DEFICIENS (AP3DEF) Def4f ARGARCTGCGCGGTCTTGAGCAA 23

Def5r GTYTGIGTRSYGATGATSACATGATA 26Asparagine synthetase AsnStAf TGATGATGAAGAGAATCCTTATC 23 AsnStBr GCATTCAGCATCATTCTATCAG 22 AsnStCr ACCTTTCAAAGATCATTCTGTAG 23Ataxia telangiectasia mutated (ATM ) ATM1f GAYGAYCTNAGRCARGAYGCNGT 23

ATM2r CCYTGYTCRAANGCNACNCCNAGRTCDATRTG 32CONSTANS-Like (COL) Col1f TGYGAYGCYGAYATYCAYTCYGCYAAYCC 29

Col2r GCRTAYCTDATNGTYTTYTCRAA 23Cytokinin oxidase 1 (OCkx1) OCko1E2f AGCAGAGCTGATAAAGCTCAG 21

OCko1E3f ATGTTCCACATCCATGGCTC 20 OCko1E3r AGCCATGGATGTGGAACATC 20 OCko1E4r CTGGAATTGAAGTAGACATCC 21 Ockx2f GTGTTAGGAGGTTTGGGWCARTTYGG 26 Ockx3r AGAGRTTRAGCCAWGGATGWGGAAC 25PISTILLATA (PI) M1f AGATCAAGCGSATCGAGAAC 20 K1r CTTGATCCKATCRATYTCCG 20Sucrose synthase Susy7f GRTGTTCAAYGTYGTYATCYTVTCYCCYCAYG 32 Susy8f AYCAAGTICGYGCKITGGAGAAYGARATGC 30 Susy11r CRATYTCTTGGAAIGTRCTKGTGATGATGAARTC 34 Susy12r GASACRATRTTGAACTTIGGRTCRAAIACATC 32Note All primers are written as 5primerarr3prime sequences (where I is inosine) and the length of primers is indicated For LFY primers the 5prime nucleotide of the primer binding-site is indicated the sequence used here as a reference is that of O iricolor (accession 106A EMBL accession AM489419) position 1 corresponding to the first nucleotide in exon 1 LFY primers are sorted in order of their occurrence in the gene (5prime to 3prime see also Fig 1) The first two characters of LFY primer names indicate exon 1 2 and in-tron 1 the third letter being a unique primer position within that gene region and f and r denoting forward and reverse primers PI primers M1f and K1r bind in the MADS and K-domains of the gene respectively

496


Table 3 Nuclear genes screened in this study

Results inGene product (Acronym) Number of primers (Ref)a Ophrysb CommentsActin 2 (Arab 368) ndashAcyl-CoA ∆9 desaturase 2 (this study) ndash ndash in positive controlAcyl-CoA ∆12 desaturase 2 (this study) -Alcohol dehydrogenase (ADH) 2 (Strand amp al 1997) - +S in Dendrobium 2 (Small amp Wendel 2000) Apetala3Deficiens (AP3DEF) 2 (this study) + (multiple) Multiple bands not further analysedAsparagine synthetase 3 (this study) - + in AsparagusAtaxia telangiectasia mutated (ATM) 2 (this study) +Calmodulin (CaM) 2 (Strand amp al 1997) -Cellulose synthase (CEL) 2 (Rice 313) +Cellulose synthase (CES) 2 (Arab 222) ndashChalcone isomerase (CHI) 2 (Strand amp al 1997) ndashChalcone synthase (CHS) 2 (Strand amp al 1997) ndashChloroplast-expressed glutamine synthetase 2 (Emshwiller amp Doyle 1999) - Constans-like (COL) 2 (this study) + (multiple) Multiple bands not further analysedCytokinin oxidase 1 (OCkx1) 6 (this study) - +S in Dendrobium eIF2-γ 2 (Arab 156) ndashGlyceraldehyde 3-phosphate dehydrogrenase 2 (Strand amp al 1997) +S (G3PDH GAPDH GapC locus) 2 (Wall 2002) 2 (this study) Heat shock protein 70 putative (Hsp70) 2 (Arab 262) -LeafyFloricaula (LFYFLO) 2 (+ nested primers this study) +SV Malate synthase 2 (Lewis amp Doyle 2002) +Methionine synthase 2 (Arab 379) +Phosphoenolpyruvate carboxylase (PEPC) 2 (Gehring amp al 2001) + +S in Vanilla 2 (D Fulop pers comm) 2 (Arab 163)6-Phosphoglucose isomerase (PGI GPI) 2 (Strand amp al 1997) -Phytochrome C 5 (Mathews amp Donoghue 1999) - - in positive control for some combinationsPhosphoribulokinase (PRK) 7 (Lewis amp Doyle 2002) + PistillataGlobosa (PIGLO) 2 (this study) +SV RNA polymerase II (RPB1) 2 (Arab 183) ndashSerineThreonine protein kinase putative 2 (Arab 069) +Splayed (SPD) 2 (Arab 076) -Sucrose synthase 4 (this study) 2 (Arab 185) +S Triose phosphate isomerase (TPI TIM) 2 (Strand amp al 1997) ndashaAn asterisk () in the reference column identifies primers that were developed by use of the database approach of Xu amp al (2004) and whose sequences were kindly provided by J Padolina For these the primer database code is given bResults in the study group are no amplification at all (ndash) no clear amplification product (-) good amplification product (+) good amplification with sequence matching target gene in BLAST searches (+S) and (+SV) as before but with sequence variation in Ophrys fusca sl taxa

497


sequenced as detailed below Initial screening was on DNA material from Ophrys and positive controls which were Arabidopsis thaliana where suitable and otherwise the organism from which the gene under consideration was first isolated Variability of sequences was compared between closely related Ophrys accessions (Table 1 at least 5 randomly chosen DNAs)

Sequencing mdash Amplification products were se-quenced using BigDye 31 (Applied Biosystems) and Dy-enamic ET dye terminators (Amersham) using the manu-facturersrsquo protocols scaled to a reaction volume of 10 microL Sequences were loaded on ABI 377 or ABI 3130XL DNA sequencers (Applied Biosystems) after loading preparations as recommended by the sequencer manufacturer

Cloning of PCR products mdash PCR products were cloned into pGEM-T vector (Promega) and inserted into E coli JM109 cells (Promega) by chemical transformation using the manufacturerrsquos protocols Cells were plated out on LB medium containing 50 mgL ampicillin IPTG and X-Gal so as to identify positive clones Inserts were ampli-fied from apparently positive clones by colony PCR using M13 forward (ndash20) and reverse vector-located primers At least 16 colonies were screened for insert size variation per cloning reaction and 5 clones of every size class were then directly sequenced

Cloning of the LFY genomic PCR product mdash All attempts to clone the LFY genomic PCR fragment (see be-low) failed using pGEM-T (Promega) StrataClone Blunt PCR Cloning Kit (Stratagene) TOPO TA (Invitrogen) or TOPO Zero Blunt (Invitrogen) and the manufacturersrsquo protocols for cloning and preparation of PCR fragments for cloning ie blunting of PCR fragment ends using Pfu DNA polymerase or A-tailing using Taq DNA polymerase Since simple cloning proved impracticable PCR products were subcloned using Alu I and Rsa I-digested amplicons in Sma I-digested pUC18 vector (enzymes protocols and vector from Fermentas) Inserts were then amplified by colony PCR using M13 primers and sequenced as detailed above

Routine amplification conditions for PI mdash PI could be amplified reliably under a wide range of PCR con-

ditions both from genomic DNA and floral cDNA Typical conditions for PCR performed in 20 microL used 08 microL of each 5 microM M1f forward and K1r reverse primer (Table 2) 10 microL REDTaq ReadyMix (Sigma-Aldrich) and 1 microL 1 10 dilution of genomic DNA (c 25 ng) The following PCR programme is suitable for amplification of PI from Ophrys and related orchids 95degC 4 min 38times (95degC 30 sec 50degC 30 sec 72degC 3 min) 72degC 10 min 4degC hold

Routine amplification conditions for LFY mdash The amplification of LFY from genomic DNA was only possible under optimised PCR conditions Antibody hotstart PCR was performed with primers (Table 2 and Fig 1) located in exons 1 and 2 of LFY Reactions were performed in 20 microL volume using 2 microL 10times AccuTaq LA PCR buffer (Sigma-Aldrich 500 mM Tris-HCl pH 93 adjusted with NH4OH 150 mM (NH4)2SO4 25 mM MgCl2 1 Tween 20) 1 microL 10 mM each dNTP (Fermen-tas) 16 microL of each 5 microM E1Cf forward and E2Gr reverse primer 1 microL 1 umicroL Jumpstart REDAccuTaq LA DNA polymerase (Sigma-Aldrich) and 1 microL genomic DNA extract (c 250 ng) The PCR programme used was 96degC 25 sec 37times (94degC 10 sec 60degC 30 sec 68degC 5 min) 68degC 15 min 4degC hold Resulting PCR products were separated on a 1 agarose-TAE gel excised and PCR products of ~3 kb length purified from the gel 1 microL of a 1 10 dilution of purified Ophrys LFY PCR fragment was used as a template for each nested PCR with a dif-ferent combination of nested primers (Table 2 and Fig 1) Nested PCR was performed in 20 microL reactions using 08 microL of each 5 microM forward and reverse primer 10 microL RedTaq ReadyMix (Sigma-Aldrich) and the following PCR programme 95degC 1 min 38times (94degC 20 sec 60degC 30 sec 72degC 3 min) 72degC 10 min 4degC hold All nested primer combinations expected to work could be ampli-fied typical combinations being E1JfndashI1Ar I1EfndashI1Jr and I1CfndashE2Kr For routine sequencing of LFY removal of residual primers and nucleotides from nested PCR frag-ments was accomplished by cleaning them enzymatically with E coli exonuclease I (Fermentas) and calf intestine alkaline phosphatase (Fermentas) using the method of Werle amp al (1994) with slight modifications 5ndash7 microL of

13

13

13

Fig 1 LFY primer map showing exon 1 intron 1 and exon 2 of the gene using a sequence from O iricolor as reference se-quence (accession 106A EMBL accession AM489419) Major insertions and deletions found in Ophrys sect Pseudophrys relative to O iricolor are indicated The letter indicated for primer designations (see Table 2) is unique within each exon and intron Bold face is used for genomic PCR primers and italics for intronic primers

498


cleaned nested PCR fragments were used for sequencing as detailed above

PCR walking mdash PCR walking was carried out following the protocol of Siebert amp al (1995) using 1 microg of genomic DNA for generation of adapter-ligated DNA libraries after digestion with Dra I Eco RV (Eco 32I) Ssp I Stu I (Eco147I) Pvu II Sma I or Sca I (all enzymes from Fermentas) and a PCR set-up as detailed for the ampli-fication of LFY from genomic DNA Differing from the original protocol (Siebert amp al 1995) the short adapter strand used was 5prime-pACCTGCC-s-ddC-3prime where s indi-cates a phosphothiorate linkage to prevent exonucleolytic cleavage (as suggested by Padegimas amp Reichert 1998) and ddC is a terminal 2prime3prime-dideoxy-C to prevent priming from the oligonucleotidersquos 3prime end during PCR

Reverse transcriptase (RT)-PCR for PI mdash Flow-ers collected in the field were dissected into lip petals sepals and column and frozen in liquid N2 Messenger RNA was extracted with QuickPrep Micro mRNA Puri-fication Kit (Amersham) and the manufacturerrsquos protocol All mRNA obtained (suspended in a volume of 10 microL) was reverse transcribed using 100 pmol anchored oligo-dT primer (5prime-pT18VN-3prime) RevertAid H Minus M-MuLV Reverse Transcriptase (Fermentas) and Ribonuclease In-hibitor (Fermentas) according to the supplierrsquos protocol and PCR carried out for PI as described above but using Jumpstart REDAccuTaq LA Polymerase (Sigma-Aldrich) and 68degC extension temperature

Single-strand conformational polymorphism (SSCP) analysis of PI PCR products mdash SSCP were performed for PI to assess the allelic variation pattern PI was amplified by PCR both from genomic DNA of Oph-rys populations (not sequenced) and clones with known sequence in a volume of 20 microL as described above Five microlitres of PCR products were then digested with 1 u Rsa I (Fermentas) in a reaction volume of 10 microL for 3 hrs at 37degC and then kept at 4degC The restriction digest (10 microL) was then combined with 10 microL of SSCP loading dye (10 mM NaOH 003 bromophenol blue 003 xylene cyanol in formamide abs) denatured for 5 min at 95degC and immediately chilled on ice for a minimum of 3 min until loading of 5 microL on a native 12 polyacrylamide gel (50 1 acrylamide bis-acrylamide with 0 or 5 glycerol) in Tris-borate EDTA (TBE) buffer Electrophoresis was carried out at 22degC and 50 V for 20 min followed by 250 V for 3 hrs in a Hoefer SE 600 Electrophoresis sys-tem (Amersham) coupled to a MultiTemp Thermostatic Circulator (Amersham) Gels were stained with PlusOne DNA Silver Staining Kit (Amersham) and the manufac-turerrsquos protocol and included digested but undenatured PI dsDNA controls as well as undenatured Generuler 100 bp DNA ladder (Fermentas)

Phylogenetic analysis of LFY mdash Sequences were edited using SeqMan II (DNAStar Inc) and entered into

the EMBL sequence database (for accession numbers see Table 1) and aligned using Clustal X (Thompson amp al 1997) and Bioedit 7 (Hall 2001) Where clearly distin-guishable allelic variants were encountered in a single individual two allelic sequences were compiled that were maximally different Partial intron sequences of several individuals of the same population were checked for ad-ditional allelic variation A model of molecular evolution was estimated using Modeltest 37 (Posada amp Crandall 1998) for the entire nucleotide dataset and separately for exon and intron sequence using MrModelTest 22 (Nylan-der 2004) The model of evolution selected for the entire nucleotide data was HKY + Γ in a hierarchical likelihood ratio test (hLRT) and TVM + I using the Akaike infor-mation criterion (AIC) When exon and intron data were treated separately the models F81 + I + Γ or GTR + I were selected for exon and HKY + Γ or GTR + Γ for intron data using hLRTs or the AIC respectively Maximum parsi-mony (MP) analysis with equal character weights was per-formed in PAUP 4b10 (Swofford 2002) using a heuristic search with 10 random sequence addition replicates Most parsimonious trees were summarised by consensus tree methods available in PAUP Maximum likelihood (ML) analysis in PAUP using a heuristic search with 10 random sequence addition replicates were performed with both the model selected using hLRT and AIC Bootstrap branch support in ML and MP reconstructions was estimated using 100 pseudo-replicates

For Bayesian inference information from insertiondeletion (indel) characters compiled from the sequence alignment were included using complex indel coding (Simmons amp Ochoterena 2000) Indel characters were largely unambiguous so that the use of step matrices was unnecessary Bayesian phylogenetic inference was carried out in MrBayes 312 (Ronquist amp Huelsenbeck 2003) on the complete nucleotide sequence combined with the indel data matrix Separate models of evolution for exon and intron characters were used as selected in either hLRT or AIC indel information being treated as lsquostandardrsquo (morphological) data Two parallel analyses with three Markov-chain Monte Carlo (MCMC) chains were run for 10 million generations Results from the first one million generations were discarded MCMC sampling seemingly having converged by this time in all cases

RESULTSMarker screening mdash The results of the PCR

marker screen are summarised in Table 3 Most primer combinations either did not yield PCR products yielded PCR products that were unsuitable or PCR products did not contain sequences that corresponded to target loci

499


Amongst those genes that could be amplified were Adh and Cko1 in Dendrobium PIGLO LFYFLO AP3DEF and genes for G3PDH and sucrose synthase for Ophrys However lack of variability or poor sequence quality that precluded design of more specific primers led us to discontinue laboratory efforts for most of these leaving only PI and LFY for further characterisation

The PIGLO gene mdash Based on the sequence of the 441 bp PI PCR product spanning the first two in-trons and PCR walking experiments the positions of the first three introns in Ophrys thriptiensis PI (EMBL accessions AM489437 to AM489439) compared with the Orchis italica cDNA sequence correspond to in-tron positions in Antirrhinum majus GLO (Troumlbner amp al 1992) rather than Arabidopsis thaliana PI (Goto amp Meyerowitz 1994) In Ophrys PI introns 1 2 and 3 are 85 90 and gt 119 bp in length with exon-intron junctions ACGTAGGT (exonintronexon) AGGTAGAA and AGGT respectively Variation among PI clones was limited identifying two alleles in O thriptiensis dif-fering by two point mutations in intron 2 These but no additional alleles were also found in O cinereophila O iricolor O creberrima and O leucadica individuals Additional putative alleles were identified using SSCP of Rsa I-digested PI PCR products from an Ophrys pop-ulational sample of the same taxa although occurrence of these alleles did not seem to coincide with Ophrys

populations or taxa Because PI variation was unlikely to be phylogenetically informative putative SSCP alleles were not cloned and PI not pursued further as a phylo-genetic marker within Ophrys fusca sl Comparison of PI sequences of exons 1ndash3 (266 bp) show 19 silent sub-stitutions among Ophrys thriptiensis and Orchis italica PCR of cDNA from dissected Ophrys fusca sl flowers showed PI to be expressed in the lateral and dorsal sepal petals the lip and the column

The LFYFLO gene mdash The ~3 kb LFY genomic PCR product spans intron 1 and sequences can be obtained reliably from nested PCR products LFY was found to be phylogenetically informative within Ophrys sect Pseu-dophrys and a summary of the variability encountered in LFY is presented in Table 4 Intron-exon boundaries of the first Ophrys LFY intron are in good agreement with eukaryotic consensus splice sites (Long amp Deutsch 1999 Moore 2000) We observed great length variation of the LFY genomic PCR product among Ophrys and related genera suggesting considerable variation in intron length (inferred approximated intron lengths are Ophrys iricolor 2 kb Himantoglossum hircinum 15 kb Himantoglossum robertiamum 18 kb Serapias cf bergonii 01 kb Orchis italica 1 kb) Even within Ophrys LFY intron 1 contains a number of indels of gt 30 bp length smaller indels present even within the closely related taxa of the O fusca sl group

Table 4 Comparison of nucleotide and indel characters obtained from LFY (this study) and trnL and ITS data available in the public sequence databases Variation is shown (1) in comparison with an outgroupa taxon and (2) within the ingroupb

Ingroup + Ophrys tenthredinifera Ingroup only Generegion Characters Nt Nu Ni Nv Var Nu Ni Nv VarLFY (nuclear) Ingroup + Ot (Nseq=18 Ntax=14) Ingroup only (Nseq=17 Ntax=13) Total sequence 2847 98 58 156 55 25 57 82 29 Exon sequence 760 16 3 19 25 2 3 5 07 Intron sequence 2087 82 55 137 66 23 54 77 37 Indel characters 37 17 20 37 ndash 5 19 24 ndash

trnL (chloroplast) Ingroup + Ot (Nseq=3 Ntax=3) Ingroup only (Nseq=2 Ntax=2) Total sequence 804 ndash ndash 8 10 ndash ndash 1 01 Exon sequence 311 ndash ndash 4 13 ndash ndash 1 03 Intron sequence 493 ndash ndash 4 08 ndash ndash 1 02 Indel characters 2 ndash ndash 2 ndash ndash ndash 2 ndash

ITS (nuclear ribosomal DNA) Ingroup + Ot (Nseq=12 Ntax=11) Ingroup only (Nseq=11 Ntax=10) Total sequence 629 11 0 11 17 3 0 3 05 ITS1 spacer 237 8 0 8 38 3 0 3 13 58S rRNA gene 153 0 0 0 00 0 0 0 00 ITS2 spacer 239 3 0 3 13 0 0 0 00 Indel characters 0 0 0 0 ndash 0 0 0 ndashNote Column headings are as follows Nseq number of sequences Ntax number of taxa Nt total number of characters Nu parsimony uninformative characters Ni parsimony informative characters Nv total number of variable characters Var percentage of variable nucleotide charactersaO tenthridinifera was used as an outgroup taxon and includes O tenthredinifera LFY exon data from Montieri amp al (2004) ITS data from Soliva amp al (2001) and Bernardos amp al (2005 and 1 unpublished sequence) trnL data from Soliva amp al (2001)bIngroup refers to Ophrys sect Pseudophrys

500


Phylogenetic reconstructions mdash The phylogeny (Fig 2) of closely related taxa of Ophrys sect Pseudo-phrys inferred from the LFY gene is well resolved Tree topologies and branch lengths obtained from different phylogenetic analyses and different models of molecular evolution agreed well with each other whether indel char-

acters were included or not In all reconstructions we found the O lutea sl taxa O sicula and O phryganae as one group which is sister to the group formed by morpho-logically very similar O bilunulata and O leucadica from the west and east Mediterranean respectively Members of the O omegaifera complex including O omegaifera

Fig 2 Phylogenetic reconstructions from the LFY dataset The tree shown is a Bayesian tree with hLRT-selected models of evolution for exon and intron data and indel data Posterior support is shown above branches Bootstrap support for maximum likelihood (hLRT-selected model) and maximum parsimony topologies respectively is indicated below branch-es where support was greater than 50

501


O basilissa O sitiaca and O atlantica appeared as a sister group to these two groups with O iricolor nested in O omegaifera sl A further group obtained contained O cinereophila and the endemic taxa from Crete O creticola O pallidula and O kedra

DISCUSSIONEffectiveness of primer screening for marker

isolation mdash As can be seen from the high number of markers initially tested screening of previously charac-terised markers did not prove to be a very effective means of identifying suitable low-copy markers for use in closely related Ophrys taxa A more efficient approach to marker identification may have been isolation of markers from cDNA (Schluumlter amp al 2005 Whittall amp al 2006) How-ever since good quality mRNA only became available when screening efforts were nearing completion cloning of mRNA was not available as an alternative option The apparent inefficiency of identifying variable sequence markers using a primer screening approach may in part be due to (1) many screened markers having been developed for different plant groups (many are for dicots) and (2) many genes having housekeeping functions and a high degree of sequence conservation It is interesting to note in this respect that the best marker identified in the pres-ent study LFY is a gene involved in development rather than metabolism

The PIGLO gene mdash The PIGLO (PISTILLATAGLOBOSA) gene of eudicots is a MIKC-type B-class MADS-box gene involved in establishing petal and stamen organ identity its function in monocots being less clear (eg Krizek amp Fletcher 2005 and references therein) PI expression in all parts of the Ophrys flower is in agreement with the expression pattern reported by Tsai amp al (2005) The limited variation encountered among clones from PI genomic PCR products suggests that our PCR primers pick up a single copy of the gene in Ophrys despite the fact that our PCR primers target conserved regions of PI This may indicate that a PI homologue is present as a single copy gene in Ophrys as has been found in the tropical orchid Phalaenopsis (Tsai amp al 2005) Southern blot experiments would be necessary to test this hypothesis PI has previously been used for phylogenetic purposes in dicots (Bailey amp Doyle 1999) Although our PI PCR fragment is not phylogenetically informative within Ophrys fusca sl the presence of multiple alleles in this group suggest that PI may be a useful genetic marker for the study of Ophrys populations Also the number of substitutions among Ophrys thriptiensis and Orchis italica PI coding sequences suggest that this gene is likely to be phylogenetically informative at the level of species groups or genera While the here described PCR primers

target a 5prime portion of PI additional sequence variation would be expected in the 3prime region of the gene covering PISTILLATArsquos C domain

The LFYFLO gene mdash In flowering plants LFY (LEAFY in Arabidopsis thaliana FLORICAULA [FLO] in Antirrhinum majus) is a floral meristem identity gene and an important flowering time pathway integrator several genetic pathways resulting in the expression of LFY (Wei-gel amp al 1992 Blaacutezquez amp Weigel 2000 Parcy 2005 Simpson amp Dean 2005 Yoon amp Baum 2005) The LFY protein acts as a transcription factor and its activation in turn leads to the activation of the floral meristem and consequently to flowering (Blaacutezquez amp al 1997 Wagner amp al 2004 William amp al 2004 Maizel amp al 2005) LFY is present as a single-copy or low-copy gene in many plant groups (Frohlich amp Meyerowitz 1997 Frohlich amp Parker 2000 Gocal amp al 2001 Wada amp al 2002 Bomblies amp al 2003) In Orchis and other investigated orchid genera including Ophrys a single copy of LFY could be identified by Southern blotting (Montieri amp al 2004) Therefore at least in diploid European Orchidoideae paralogy is unlikely to be an issue when using LFY for phylogeny reconstructions LFY has been used for phylogenetic pur-poses in other plant groups (Oh amp Potter 2003 2005 Grob amp al 2004 Hoot amp al 2004 Howarth amp Baum 2005) where the second intron of LFY typically is the longer one (eg Bomblies amp al 2003) In Orchis however the first intron (1 kb) is larger than the second (01 kb) intron (Montieri amp al 2004) which is likely also true for Ophrys and related genera The observed intron length variation among genera is also mirrored by the large number of LFY indels within Ophrys sect Pseudophrys as compared to ITS Clearly the overall information content is higher for LFY than for ITS or trnL LFY harbouring 58 times more per cent variable nucleotide characters in the ingroup than ITS Moreover since the amplified LFY gene region is longer than ITS the absolute number of characters obtain-able from it is greater

Phylogenetic inference mdash The phylogeny (Fig 2) of closely related taxa of Ophrys taxa based on LFY is well resolved and represents a major improvement over previous phylogenetic reconstructions (Pridgeon amp al 1997 Aceto amp al 1999 Soliva amp al 2001 Bateman amp al 2003 Bernardos amp al 2005) It clearly shows the potential of the first intron of the single-copy gene LFY Unfortunately the rather tedious laboratory work neces-sary to extract sequence information from this gene makes it difficult to use LFY for routine sequencing with a large number of samples

Our phylogenetic reconstructions in part confirm relationships of taxa based on morphology and pollination biology LFY data support the distinctness of O fusca sl O lutea sl and O omegaifera sl although two sepa-rate groups including O fusca sl taxa were identified

502


Aceto S Caputo P Cozzolino S Gaudio L amp Moretti A 1999 Phylogeny and evolution of Orchis and allied genera based on ITS DNA variation morphological gaps and molecular continuity Molec Phylog Evol 13 67ndash76

Bailey CD amp Doyle JJ 1999 Potential phylogenetic utility of the low-copy nuclear gene pistillata in dicotyledonous

This would suggest that an O fusca-type species may have been at the base of Ophrys sect Pseudophrys The placement of O sitiaca in the O omegaifera complex is in agreement with AFLP data (Schluumlter amp al in press) How-ever based on morphology O iricolor would have been expected to be nested in the mainly Andrena-pollinated O fusca complex rather than in the O omegaifera complex which is pollinated by Anthophora rather than Andrena males Taken together our phylogenetic reconstruction is in good agreement with the grouping of taxa based on pollinators and on morphology and for the first time pro-vides a molecular hypothesis for the relationship among O fusca sl O lutea sl and O omegaifera sl groups However it is clear that a phylogeny based on a single gene does not necessarily reflect organismic history (see eg Sang 2002) Particularly recent speciation events or hybridisation may lead to incongruence between species and gene trees where recent species divergence may mean that coalescence of alleles can pre-date the establishment of reproductive isolation among speciating populations especially if ancestral population size was large Like-wise gene flow among species may lead to the presence of additional alleles in a species which depending on the amount of genetic divergence of hybridising species may or may not be readily distinguishable from ancestral polymorphism Clearly inference of evolutionary history in Ophrys should ideally employ multiple nuclear genes the highly variable single-copy gene LFY being one of the tools required We hope that the availability of low-copy markers for the genus Ophrys will further our understand-ing of evolution in this difficult group

ACKNOWLEDGEMENTSWe wish to thank Eva Hotwagner for help with lab work

Daniel Fulop and Elena Kramer for access to unpublished se-quence and primer information David Baum for initial help with primer design Joanna Padolina for access to her primer database Herta Steinkellner for helpful discussions Matthias Fiedler for additional plant material Eleni Maloupa for help with collection permits and two anonymous reviewers for providing valuable comments We are grateful for funding by the Austrian Science Fund (FWF) on project P16727-B03

LITERATURE CITED

plants comparison to nrDNA ITS and trnL intron in Sphaerocardamum and other Brassicaceae Molec Phylog Evol 13 20ndash30

Bateman RM Hollingsworth PM Preston J Yi-Bo L Pridgeon AM amp Chase MW 2003 Molecular phylo-genetics and evolution of Orchidinae and selected Haben-ariinae (Orchidaceae) Bot J Linn Soc 142 1ndash40

Bernardos S Amich F amp Gallego F 2003 Karyological and taxonomical notes on Ophrys (Orchidoideae Orchid-aceae) from the Iberian Peninsula Bot J Linn Soc 142 395ndash406

Bernardos S Crespiacute A del Rey F amp Amich F 2005 The section Pseudophrys (Ophrys Orchidaceae) in the Iberian Peninsula a morphometric and molecular analysis Bot J Linn Soc 148 359ndash375

Blaacutezquez MA Soowal LN Lee I amp Weigel D 1997 LEAFY expression and flower initiation in Arabidopsis Development 124 3835ndash3844

Blaacutezquez MA amp Weigel D 2000 Integration of floral induc-tive signals in Arabidopsis Nature 404 889ndash892

Bomblies K Wang R-L Ambrose BA Schmidt RJ Meeley RB amp Doebley J 2003 Duplicate FLORI-CAULALEAFY homologs zfl1 and zfl2 control inflores-cence architecture and flower patterning in maize Devel-opment 130 2385ndash2395

DrsquoEmerico S Pignone D Bartolo G Pulvirenti S Ter-rasi C Stuto S amp Scrugli A 2005 Karyomorphology heterochromatin patterns and evolution in the genus Oph-rys (Orchidaceae) Bot J Linn Soc 148 87ndash99

Emshwiller E amp Doyle JJ 1999 Chloroplast-expressed glu-tamine synthetase (ncpGS) potential utility for phyloge-netic studies with an example from Oxalis (Oxalidaceae) Molec Phylog Evol 12 310ndash319

Frohlich MW amp Meyerowitz EM 1997 The search for flower homeotic gene homologs in basal angiosperms and Gnetales a potential new source of data on the evolution-ary origin of flowers Int J Pl Sci 158 S131ndashS142

Frohlich MW amp Parker DS 2000 The mostly male theory of flower evolutionary origins from genes to fossils Syst Bot 25 155ndash170

Gehring H Heute V amp Kluge M 2001 New partial sequences of phosphoenolpyruvate carboxylase as mo-lecular phylogenetic markers Molec Phylog Evol 20 262ndash274

Gocal GFW King RW Blundell CA Schwartz OM Andersen CH amp Weigel D 2001 Evolution of floral meristem identity genes Analysis of Lolium temulentum genes related to APETALA1 and LEAFY in Arabidopsis Pl Physiol 125 1788ndash1801

Goto K amp Meyerowitz EM 1994 Function and regulation of the Arabidopsis floral homeotic gene PISTILLATA Genes Dev 8 1548ndash1560

Greilhuber J amp Ehrendorfer F 1975 Chromosome numbers and evolution in Ophrys (Orchidaceae) Pl Syst Evol 124 125ndash138

Grob GBJ Gravendeel B amp Eurlings MCM 2004 Potential phylogenetic utility of the nuclear FLORICAULALEAFY second intron comparison with three chloroplast DNA regions in Amorphophallus (Araceae) Molec Phy-log Evol 30 13ndash23

Hall T 2001 BioEdit version 506 Department of Microbiol-ogy North Carolina State University Raleigh


Hoot SB Napier NS amp Taylor WC 2004 Revealing unknown or extinct lineages within Isoeumltes (Isoeumltaceae) using DNA sequences from hybrids Amer J Bot 91 899ndash904

Howarth DG amp Baum DA 2005 Genealogical evidence of homoploid hybrid speciation in an adaptive radiation of Scaevola (Goodeniaceae) in the Hawaiian islands Evolu-tion 59 948ndash961

Krizek BA amp Fletcher JC 2005 Molecular mechanisms of flower development an armchair guide Nat Rev Genet 6 688ndash698

Kullenberg B 1961 Studies in Ophrys pollination Zool Bidr Uppsala 34 1ndash340

Kuulasmaa T 2002 Oligo Analyzer 102 Distributed by the author Kuopio

Lewis CE amp Doyle JJ 2002 A phylogenetic analysis of tribe Areceae (Arecaceae) using two low-copy nuclear genes Pl Syst Evol 236 1ndash17

Long M amp Deutsch M 1999 Association of intron phases with conservation at splice site sequences and evolution of spliceosomal introns Molec Biol Evol 16 1528ndash1534

Maizel A Busch MA Tanahashi T Perkovic J Kato M Hasebe M amp Weigel D 2005 The floral regulator LEAFY evolves by substitutions in the DNA binding do-main Science 308 260ndash263

Mathews S amp Donoghue MJ 1999 The root of angiosperm phylogeny inferred from duplicate phytochrome genes Science 286 947ndash950

Montieri S Gaudio L amp Aceto S 2004 Isolation of the LFYFLO homologue in Orchis italica and evolutionary analysis in some European orchids Gene 333 101ndash109

Moore MJ 2000 Intron recognition comes of AGe Nat Struct Biol 7 14ndash16

Nylander JAA 2004 MrModeltest v2 Program distributed by the author Evolutionary Biology Centre Uppsala Uni-versity Uppsala

Oh S-H amp Potter D 2003 Phylogenetic utility of the second intron of LEAFY in Neillia and Stephanandra (Rosaceae) and implications for the origin of Stephanandra Molec Phylog Evol 29 203ndash215

Oh S-H amp Potter D 2005 Molecular phylogenetic system-atics and biogeography of tribe Neillieae (Rosaceae) using DNA sequences of cpDNA rDNA and LEAFY Amer J Bot 92 179ndash192

Padegimas LS amp Reichert NA 1998 Adapter ligation-based polymerase chain reaction-mediated walking Anal Biochem 260 149ndash153

Parcy F 2005 Flowering a time for integration Int J Dev Biol 49 585ndash593

Paulus HF 1998 Der Ophrys fusca sstr-Komplex auf Kreta und anderer Aumlgaumlisinseln mit Beschreibungen von O blith-opertha O creberrima O cinereophila O cressa O thriptiensis und O creticola spp nov (Orchidaceae) J Eur Orch 30 157ndash201

Paulus HF Alibertis C amp Alibertis A 1990 Ophrys me-saritica H F Paulus und C amp A Alibertis spec nov aus Kreta eine neue Art aus dem Ophrys fusca-iricolor-Arten-kreis Mitteilungsbl Arbeitskr Heim Orch Baden-Wuumlrtt 22 772ndash787

Paulus HF amp Gack C 1990 Pollinators as prepollinating isolation factors evolution and speciation in Ophrys (Or-chidaceae) Israel J Bot 39 43ndash79

Posada D amp Crandall KA 1998 MODELTEST testing the model of DNA substitution Bioinformatics 14 817ndash818

Pridgeon AM Bateman RM Cox AV Hapeman JR amp Chase MW 1997 Phylogenetics of subtribe Orchid-inae (Orchidoideae Orchidaceae) based on nuclear ITS sequences 1 Intergeneric relationships and polyphyly of Orchis sensu lato Lindleyana 12 89ndash109

Ronquist F amp Huelsenbeck JP 2003 MrBayes 3 Bayesian phylogenetic inference under mixed models Bioinforma-tics 19 1572ndash1574

Sang T 2002 Utility of low-copy nuclear gene sequences in plant phylogenetics Crit Rev Biochem Molec Biol 37 121ndash147

Schluumlter PM Ruas PM Kohl G Ruas CF Stuessy TF amp Paulus HF In press Reproductive isolation in the Aegean Ophrys omegaifera complex (Orchidaceae) Pl Syst Evol

Schluumlter PM Stuessy TF amp Paulus HF 2005 Making the first step Practical considerations for the isolation of low-copy nuclear sequence markers Taxon 54 766ndash770

Siebert PD Chenchik A Kellogg DE Lukyanov KA amp Lukyanov SA 1995 An improved PCR method for walking in uncloned genomic DNA Nucl Acids Res 23 1087ndash1088

Simmons MP amp Ochoterena H 2000 Gaps as characters in sequence-based phylogenetic analyses Syst Biol 49 369ndash381

Simpson GG amp Dean C 2005 Arabidopsis the rosetta stone of flowering time Science 296 285ndash289

Small RL amp Wendel JF 2000 Copy number lability and evolutionary dynamics of the Adh gene family in diploid and tetraploid cotton (Gossypium) Genetics 155 1913ndash1926

Soliva M Kocyan A amp Widmer A 2001 Molecular phy-logenetics of the sexually deceptive orchid genus Ophrys (Orchidaceae) based on nuclear and chloroplast DNA se-quences Molec Phylog Evol 20 78ndash88

Strand AE Leebens-Mack J amp Milligan BG 1997 Nu-clear DNA-based markers for plant evolutionary biology Molec Ecol 6 113ndash118

Swofford DL 2002 PAUP Phylogenetic Analysis Using Parsimony (and Other Methods) version 4 Sinauer As-sociates Sunderland

Thompson JD Gibson TJ Plewniak F Jeanmougin F amp Higgins DG 1997 The CLUSTAL_X windows interface flexible strategies for multiple sequence align-ment aided by quality analysis tools Nucl Acids Res 25 4876ndash4882

Troumlbner W Ramirez L Motte P Hue I Huijser P Loumlnnig W-E Saedler H Sommer H amp Schwarz-Sommer Z 1992 GLOBOSA A homeotic gene which interacts with DEFICIENS in the control of Antirrhinum floral organogenesis EMBO J 11 4693ndash4704

Tsai W-C Lee P-F Chen H-I Hsiao Y-Y Wei W-J Pan Z-J Chuang M-H Kuoh C-S Chen W-H amp Chen H-H 2005 PeMADS6 a GLOBOSAPISTILLATA-like gene in Phalaenopsis equestris involved in petaloid formation and correlated with flower longevity and ovary development Pl Cell Physiol 46 1125ndash1139

Wada M Cao Q-f Kotoda N Soejima J-i amp Masuda T 2002 Apple has two orthologues of FLORICAULALEAFY involved in flowering Pl Molec Biol 49 567ndash577

503


Wagner D Wellmer F Dilks K Dilusha W Smith MR Kumar PP Riechmann JL Greenland AJ amp Meyerowitz EM 2004 Floral induction in tissue culture a system for the analysis of LEAFY-dependent gene regulation Pl J 39 273ndash282

Wall DP 2002 Use of the nuclear gene glyceraldehyde 3-phosphate dehydrogenase for phylogeny reconstruction of recently diverged lineages in Mitthyridium (Musci Calymperaceae) Molec Phylog Evol 25 10ndash26

Weigel D Alvarez J Smyth DR Yanofsky MF amp Meyerowitz EM 1992 LEAFY controls floral meristem identity in Arabidopsis Cell 69 843ndash859

Werle E Schneider C Renner M Voumllker M amp Fiehn W 1994 Convenient single-step one tube purification of PCR products for direct sequencing Nucl Acids Res 22 4354ndash4355

Whittall JB Medina-Marino A Zimmer EA amp Hodges SA 2006 Generating single-copy nuclear gene data for a recent adaptive radiation Molec Phylog Evol 39 124ndash134

William DA Su Y Smith MR Lu M Baldwin DA amp Wagner D 2004 Genomic identification of direct tar-get genes of LEAFY Proc Natl Acad Sci USA 101 1775ndash1780

Xu W Briggs WJ Padolina J Timme RE Liu W Linder CR amp Miranker DP 2004 Using MoBIoSrsquo scalable genome join to find conserved primer pair can-didates between two genomes Bioinformatics 20 Suppl 1 i355ndashi362

Yoon H-S amp Baum DA 2005 Transgenic study of paral-lelism in plant morphological evolution Proc Natl Acad Sci USA 101 6524ndash6529

504

494


robertianum Additional plant material (Dendrobium Vanilla Asparagus) was obtained from plants grown at the Botanical Garden of the University of Vienna DNA was extracted using DNeasy Plant Mini Kit (Qiagen) and the manufacturerrsquos protocol eluting DNA in 200 microL Tris-EDTA pH 80 In addition genomic DNA from Arabidopsis thaliana (Invitrogen included in the AFLP Core Reagent Kit) was used

Primer design mdash For design of new primers we used sequences available in the public databases and amino-acid alignments of exons between distantly related taxa (where available including orchid sequences) to iden-tify highly conserved regions and noted known intron positions Alignments were carried out using Clustal X (Thompson amp al 1997) and Bioedit 7 (Hall 2001) Primers were then designed from nucleotide sequence alignments such that (1) their binding sites would lie in conserved exonic gene regions (2) PCR would amplify enough exonic sequence to allow gene identification by BLAST searches and (3) also variable intronic or exonic sequence would be amplified In particular PI and LFY primer design was aided by GenBank sequence AB094985 from Orchis italica and the orchid LFY sequences ob-tained by Montieri amp al (2004) respectively Primers were checked for expected melting temperature loops and primer-primer interactions using Oligo Analyzer 102 software (Kuulasmaa 2002)

Marker screening via polymerase chain reaction (PCR) mdash Both published and new primers (Tables 2

and 3) were screened with standard PCR protocols on a gradient PCR machine (Thermo Hybaid PX2 or Corbett Research Palm-Cycler) using annealing temperatures between 40degC and 65degC degrees Initial reactions were performed in a volume of 25 microL containing 125 microL RED-Taq ReadyMix PCR Reaction Mix (Sigma-Aldrich) 1 microL of each 5 microM forward and reverse primers and c 25 ng genomic DNA Thermal cycling conditions were 95degC 4 min 38times (95degC 40 sec TA 40 sec 72degC 3 min) 72degC 10 min 4degC hold where in each PCR annealing temperatures (TA ) varied over a 15degC temperature gra-dient depending on the expected melting temperatures of the primers used PCR products were loaded on 1 agarose gels in TAE (tris acetate EDTA) buffer stained with ethidium bromide (028 mgL) and photographed under UV light using a Gel Doc 2000 system (BioRad) If no amplification product was obtained DNA and primer concentrations were varied different polymerases (eg Taq DNA polymerase recombinant from Fermentas) used and in some cases the thermal cycling conditions altered PCR reactions that yielded either a smear or weak amplification products were subjected to a two-step PCR optimisation testing different buffer systems and PCR en-hancers using PCR Optimization Kit II (Sigma-Aldrich) and the manufacturerrsquos protocol If multiple bands were obtained they were separated by excision and elution from gel using QIAquick Gel Extraction Kit (Qiagen) Ampli-fied fragments were then sequenced directly to check a PCR productrsquos identity by BLAST searches or cloned and

Table 1 Taxa used and EMBL sequence database accession numbers for LFY

Species Acces- Taxon groupa Country Island Locality Dateb sion EMBL Sequence NoO atlantica Munby O Spain Alhaurin de la Torre 08042004 196A AM489434O basilissa Alibertis amp Reinhard O Greece Samos Klima 21022004 174A AM489432 O basilissa Alibertis amp Reinhard O Greece Kos Asklepion 27022002 66A AM489423O bilunulata Risso F Spain Coin Las Delicias 09042004 198A AM489435O cinereophila Paulus amp Gack F Greece Crete Akoumia 02042003 114A AM489427 AM489428O creticola Paulus F Greece Crete Jouchtas 30032003 104A AM489426O iricolor Desfontaines F Greece Crete Kato Horio 29032003 100C AM489425O iricolor Desfontaines F Greece Crete Ag Paraskies 30032003 106A AM489419O iricolor Desfontaines F Greece Athens 26032004 208A AM489436O ldquokedrardquo Paulus (nom prov) F Greece Crete SpiliGerakari 07052003 150A AM489431O leucadica Renz F Greece Kos Kephalos 01032002 67A AM489424O omegaifera Fleischmann O Greece Crete Thripti 25032002 37A AM489420O ldquopallidulardquo Paulus (nom prov) F Greece Crete Thripti 04052003 145C AM489430O phryganae Devillers-Terschuren amp Devillers L Greece Rhodes Kattavia 21042003 120A AM489429O sicula Tineo L Greece Samos Klima 22022004 177A AM489433O sitiaca Paulus Alibertis amp Alibertis O or F Greece Crete Jouchtas 14022001 61A AM489422O tenthredinifera Willdenow E Greece Crete Gourtinia 022001 56A AM489421Note All plants collected by HFP with vouchers in WU except accessions 120A and 208A collected by PMS and M Fiedler respectivelyaPutative membership of the listed taxa in morphological species groups within Ophrys sect Pseudophrys are indicated where F Ophrys fusca sl L O lutea sl O O omegaifera sl while E is Ophrys sect Ophrys (syn Euophrys)bDates are given in DDMMYYYY format

495










496




497









13

13

13


498











499










500





501










502







LITERATURE CITED























































503










504

495










496




497









13

13

13


498











499










500





501










502







LITERATURE CITED























































503










504

496




497









13

13

13


498











499










500





501










502







LITERATURE CITED























































503










504

497









13

13

13


498











499










500





501










502







LITERATURE CITED























































503










504

498











499










500





501










502







LITERATURE CITED























































503










504

499










500





501










502







LITERATURE CITED























































503










504

500





501










502







LITERATURE CITED























































503










504

501










502







LITERATURE CITED























































503










504

502







LITERATURE CITED























































503










504






































503










504










504

a screen of low-copy nuclear genes reveals the lfy gene as

Documents