Upload File

a prediction approach to well logging.dl.ifip.org/db/conf/ifip12/iip2004/helshs04.pdf · title: a...

  • Home
  • Documents
  • A Prediction Approach to Well Logging.dl.ifip.org/db/conf/ifip12/iip2004/HeLSHS04.pdf · Title: A Prediction Approach to Well Logging. Author: Qing He, Ping Luo, Zhongzhi Shi, Yalei
9

Upload: dinhmien

Post on 23-Mar-2018

217 views

Category:

Documents


1 download

Report

TRANSCRIPT

Page 1: A Prediction Approach to Well Logging.dl.ifip.org/db/conf/ifip12/iip2004/HeLSHS04.pdf · Title: A Prediction Approach to Well Logging. Author: Qing He, Ping Luo, Zhongzhi Shi, Yalei
Page 2: A Prediction Approach to Well Logging.dl.ifip.org/db/conf/ifip12/iip2004/HeLSHS04.pdf · Title: A Prediction Approach to Well Logging. Author: Qing He, Ping Luo, Zhongzhi Shi, Yalei
Page 3: A Prediction Approach to Well Logging.dl.ifip.org/db/conf/ifip12/iip2004/HeLSHS04.pdf · Title: A Prediction Approach to Well Logging. Author: Qing He, Ping Luo, Zhongzhi Shi, Yalei
Page 4: A Prediction Approach to Well Logging.dl.ifip.org/db/conf/ifip12/iip2004/HeLSHS04.pdf · Title: A Prediction Approach to Well Logging. Author: Qing He, Ping Luo, Zhongzhi Shi, Yalei
Page 5: A Prediction Approach to Well Logging.dl.ifip.org/db/conf/ifip12/iip2004/HeLSHS04.pdf · Title: A Prediction Approach to Well Logging. Author: Qing He, Ping Luo, Zhongzhi Shi, Yalei
Page 6: A Prediction Approach to Well Logging.dl.ifip.org/db/conf/ifip12/iip2004/HeLSHS04.pdf · Title: A Prediction Approach to Well Logging. Author: Qing He, Ping Luo, Zhongzhi Shi, Yalei
Page 7: A Prediction Approach to Well Logging.dl.ifip.org/db/conf/ifip12/iip2004/HeLSHS04.pdf · Title: A Prediction Approach to Well Logging. Author: Qing He, Ping Luo, Zhongzhi Shi, Yalei
Page 8: A Prediction Approach to Well Logging.dl.ifip.org/db/conf/ifip12/iip2004/HeLSHS04.pdf · Title: A Prediction Approach to Well Logging. Author: Qing He, Ping Luo, Zhongzhi Shi, Yalei
Page 9: A Prediction Approach to Well Logging.dl.ifip.org/db/conf/ifip12/iip2004/HeLSHS04.pdf · Title: A Prediction Approach to Well Logging. Author: Qing He, Ping Luo, Zhongzhi Shi, Yalei

Do Prediction Markets AddDo Prediction Markets Add Value ... · Do Prediction Markets AddDo Prediction Markets Add ... didi hdeciding how many contttracts, x, ... 1996 researchers

ICT Innovation and Application (ICIIA2007) · International Conference on ICT Innovation and Application (ICIIA2007) Zhongzhi Shi [email protected] Institute of Computing Technology

Linear Prediction Problem: Forward Prediction Observing Predict Backward Prediction Observing Predict

Prediction Skill of Global Numerical Weather Prediction

Bo Wang Wenpin Jiao Qijia Tian Zhongzhi Shi Lab of Intelligent Information Processing Institute of Computing Technology Chinese Academy of Sciences, China

Approaches to Skin Sensitisation Prediction...Defined approach prediction vs in vivo outcome LLNA n = 174 Acc = 73% no cat cat no at no at Under-prediction Over-prediction Under-prediction

Prediction Markets 2018columns.virtualprivatelibrary.net/Prediction_Markets_2018_Dec17_Co… · Prediction Markets 2018 ... 17

Exogenous BMP-7 Facilitates the Recovery of Cardiac ... · Signaling Pathway Yalei Jin,1 Xinyao Cheng, 2 Jinping Lu1 and Xia Li1 1Department of Geriatrics, Zhongnan Hospital, Wuhan

Assessment of prediction error of risk prediction models

Prediction Markets 2020columns.virtualprivatelibrary.net/Prediction_Markets...Prediction Markets 2020 ... 20

Prediction of protein disorder - aidanbudd.github.io · IDP prediction and other 1D prediction methods Secondary structure prediction methods Coil is an ordered, irregular structural

Sale Prediction & History - Champion & Skin Prediction

RNA Structure Prediction Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction

Intelligent Technology for Well Logging Analysis.dl.ifip.org/db/conf/ifip12/iip2004/ShiLHLSHQ04.pdf · Title: Intelligent Technology for Well Logging Analysis. Author: Zhongzhi Shi,

Prediction Market Uses (Other Than Prediction) - Bitcoin Hivemindbitcoinhivemind.com/papers/3_PM_Applications.pdf · 2020-04-14 · Prediction Market Uses (Other Than Prediction)

Lecture 9: Branch Prediction, Dependence Speculation, and Data Prediction

Chapter 1 LINK PREDICTION IN SOCIAL NETWORKS Link Prediction · Link Prediction in Social Networks 5 3. Feature based Link Prediction We can model the link prediction problem as a

Distributed Classification in Peer-to-Peer Networks Ping Luo, Hui Xiong, Kevin Lü, Zhongzhi Shi Institute of Computing Technology, Chinese Academy of Sciences

10/24/05 Promoter Prediction RNA Structure & Function Prediction

Drug Response Prediction as a Link Prediction Problem

Gene prediction. Gene Prediction: Computational Challenge aatgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatg ctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgc

Data Mining: Classification. Classification and Prediction zWhat is classification? What is prediction? zIssues regarding classification and prediction

Hypersonic Aerothermoelastic Response Prediction of … · Hypersonic Aerothermoelastic Response Prediction of Skin ... 4 Hypersonic Aerothermoelastic Response Prediction ... coe

Gene prediction in flies ● Background ● Gene prediction pipeline ● Resources

Brain Machine Integration - 智能科学网站 · 2018/7/4 Zhongzhi Shi: Brain Machine Integration 10 IFIP AICT 510 Zhongzhi Shi Ben Goertzel Jiali Feng (Eds.) Intelligence Science

D3.2 Link prediction models - redalertproject.euredalertproject.eu/.../D3-2-Link-prediction-models... · D3.2 Link prediction models Report: Link prediction models Project acronym:

Advanced Hydrologic Prediction Services: Ensemble ... · Advanced Hydrologic Prediction Services: Ensemble Streamflow Prediction ... Ensemble Streamflow Prediction ... NWSRFS Models

Protein Tertiary Structure Prediction. Protein Structure Prediction & Alignment Protein structure Secondary structure Tertiary structure Structure prediction

Earthquake Prediction and Earthquake Damage Prediction

Analyses of Chloroplast Genomic and Morphological ...article.agricultureforestry.org/pdf/10.11648.j.ajaf.20190705.17.pdf · Ziyuan yu Zaipei Liyong [7], Shijie Yulanshu Zhiwu Zhongzhi

Multiclass Prediction Model for Student Grade Prediction

Classification and Prediction - SRM · PDF file1 Classification and Prediction • What is classification? What is prediction? • Issues regarding classification and prediction •

Prediction Markets 2018 - VirtualPrivateLibrarywhitepapers.virtualprivatelibrary.net/Prediction Markets.pdfPrediction Markets 2018 White Paper Link Compilation ... enric/papers/prediction-markets-ArgMAS.pdf

An Efficient Data Indexing Approach on Hadoop using Java ... · Java Persistence API Yang Lai, Shi Zhongzhi To cite this version: Yang Lai, Shi Zhongzhi. An Efficient Data Indexing

Advancing Climate Prediction Science – Decadal Prediction