a novel sarcoma with dual differentiation

A Novel Sarcoma With Dual DifferentiationClinicopathologic and Molecular Characterization of a Combined

Synovial Sarcoma and Extraskeletal Myxoid Chondrosarcoma

Maria E. Vergara-Lluri, MD,* Bradley A. Stohr, MD, PhD,w Balaram Puligandla, MD,zPauline Brenholz, MD,y and Andrew E. Horvai, MD, PhDw

Abstract: We report on an unusual case of a 43-year-old woman

who developed a malignant soft tissue tumor of the arm with

overlapping morphology between synovial sarcoma (SS) and ex-

traskeletal myxoid chondrosarcoma (EMC). The tumor recurred

7 years after the initial diagnosis and continued to demonstrate

both SS and EMC histology. Immunophenotypically, the primary

and recurrent tumors were both positive, focally, for cytokeratin,

S-100, bcl-2, and epithelial membrane antigen. At the time of

recurrence, the primary and recurrent tumors were further char-

acterized for genetic and molecular abnormalities. Intriguingly,

fluorescence in situ hybridization of the primary tumor revealed

rearrangements of both the SS18 and EWSR1 genes. Further-

more, reverse transcriptase-polymerase chain reaction studies of

both the primary tumor and the recurrence confirmed the presence

of both SS18-SSX2 and EWSR1-NR4A3 (exon 3) gene fusions,

characteristic of SS and EMC, respectively. This is the first re-

ported case of a remarkable soft tissue sarcoma that exhibits over-

lapping morphologic features between SS and EMC and that also

harbors a combination of SS18-SSX2 and EWS-NR4A3 gene

fusions. This case supports the fact that specific, reproducible gene

fusions frequently direct, cooperatively or competitively, basic

histogenetic processes to produce tumor phenotypes.

Key Words: synovial sarcoma, extraskeletal myxoid chon-

drosarcoma, dual histotype, gene rearrangement

(Am J Surg Pathol 2012;36:1093–1098)

Synovial sarcoma (SS) and extraskeletal myxoid chon-drosarcoma (EMC) are rare, malignant soft tissue

tumors of uncertain differentiation.11 SS is a highly

aggressive spindle cell neoplasm occurring in adolescentsand young adults with, in some cases, morphologic orimmunophenotypic evidence of epithelial differentiation.By contrast, EMC affects middle-aged and elderly in-dividuals and is associated with prolonged survival. EMCis composed of a mixture of round cells, often formingchains or clusters amid a myxoid stroma.11 Not only arethese sarcomas morphologically and clinically distinct,they can also be distinguished by unique, reproducible,genetic abnormalities. SS is characterized in >95%of cases by t(X;18)(p11;q11), resulting in an in-framefusion of the SS18 gene on chromosome 18 with theSSX1, SSX2, or SSX4 gene on chromosome Xp11.28,30,31

A novel, albeit rare, translocation t(X;20) involvingan SS18 homolog on chromosome 20 resulting in anSS18L1-SSX1 fusion gene has also been described.29 Incontrast, EMC most commonly demonstrates a (9;22),(9;17), or (9;15) translocation, which account for 89% ofcases.24 Approximately 70% of these cases occur as abalanced translocation in t(9;22)(q22;q12), which creates afusion pair between EWSR1 on 22q12 with NR4A3 (alsoknown as CHN, TEC, or NOR1) on 9q22.24 The remain-ing 20% of cases involve fusion gene NR4A3-RBP56 (alsoknown as TAF15), resulting from t(9;17)(q22;q11). A thirdtranslocation containing NR4A3 and TCF12 has also beendescribed, involving t(9;15)(q22;q21).21

Herein, we report a unique case of a novel soft tissuesarcoma that exhibits overlapping morphologic featuresbetween SS and EMC and also harbors both SS18:SSX2and EWS:NR4A3 gene fusions. Although each of thesegenetic changes has been identified in isolation, to date,no reported cases harbor both abnormalities in a singletumor.

CASE REPORTThe patient is a 43-year-old woman who presented to a

referring institution in 2004 with a 5-year history of a left armmass. Her medical history was significant for a probable cysticdysplastic kidney but no malignancies. A 7.5�5.5�4 cm softtissue mass was resected at the referring institution with a micro-scopically positive margin. On the basis of histologic andimmunophenotypic findings, a diagnosis of EMC was rendered.The patient unfortunately lost her medical insurance, did not re-ceive any adjuvant therapy after surgery, and was lost to follow-up.

From the *Department of Pathology, University of California LosAngeles, Los Angeles; wDepartment of Pathology, University ofCalifornia San Francisco, San Francisco; zKaiser Oakland Hospital,Oakland, CA; and yIntegrated Genetics/Integrated Oncology, Lab-Corp Specialty Testing Group, New York.

Conflicts of Interest and Source of Funding: Supported by the UCSFDepartment of Pathology. The authors have disclosed that they haveno significant relationships with, or financial interest in, any com-mercial companies pertaining to this article.

Correspondence: Andrew E. Horvai, MD, PhD, Department of Patho-logy, University of California San Francisco, 1600 Divisadero Street,B220, San Francisco, CA 94115 (e-mail: [email protected]).

Copyright r 2012 by Lippincott Williams & Wilkins

CASE REPORT

Am J Surg Pathol � Volume 36, Number 7, July 2012 www.ajsp.com | 1093

She re-presented at our institution in 2011 for managementof an apparent recurrent tumor at the same site. A fine needleaspiration biopsy was performed on the recurrent soft tissuemass, which was protuberant and firm and located along theposterior arm/triceps muscle. Further diagnostic workup did notdemonstrate any regional or distant metastasis. The cytomor-phology was consistent with a sarcoma, and EMC was favoredin the differential diagnosis. Unexpectedly, analysis of the fineneedle aspiration material by fluorescence in situ hybridization(FISH) revealed the presence of an SS18 rearrangement, and thusa diagnosis of SS was made. On the basis of the diagnosis of ahigh-grade sarcoma, the patient elected to receive inductionchemotherapy with ifosfamide-epirubicin (3 cycles), followed byresection (Figs. 1A, B) with intraoperative and subsequent ex-ternal beam radiation (27 fractions). The mass measured 9.6�7.6�6.5 cm. Tumor necrosis was approximately 20%. She electednot to receive any additional therapy and was disease free5 months after surgery. On the basis of the unexpected geneticfindings, the original and recurrent tumors were evaluated bymorphologic, immunophenotypic, and molecular studies.

Morphologically, the primary and recurrent tumors wereindistinguishable. The hematoxylin and eosin-stained sections ofboth tumors demonstrated a multinodular neoplasm with subtletransitions between spindled and round cell areas. The spindledcell areas showed fascicular to whorled growth and blendedsubtly with myxoid areas containing rounder cells, some witheccentric cytoplasm. The neoplastic cells had round to ovalnuclei, irregular and lobulated nuclear contours, vesicularto coarse chromatin, multiple chromocenters, and a scant tomoderate amount of eosinophilic cytoplasm. Mitoses werereadily appreciated, with up to 12 mitotic figures per 10 high-power fields. Lymphovascular space invasion was identified inthe primary tumor. Intriguingly, although some areas resembledEMC, others were morphologically compatible with mono-phasic SS or morphologically transitional between the two(Figs. 1C–G).

Similarly, the immunophenotype of primary and re-current tumors was identical: both were at least focally positivefor cytokeratin cocktail (AE1/AE3+CAM5.2), epithelialmembrane antigen (EMA), S-100, and MUC4 and diffusely forbcl-2 by immunohistochemistry (Figs. 1H–L). Immunohisto-chemistry results for CD99, synaptophysin, chromogranin,smooth muscle actin, calponin, glial fibrillary acidic protein,desmin, and myogenin were negative.

In light of the discrepant initial diagnosis of EMC with anSS18 rearrangement in the tumor recurrence, tissue from theprimary resection specimen was studied for both SS18 andEWSR1 rearrangements (Figs. 2A, B). FISH analysis was pos-itive for a rearrangement involving SS18 in 188 of 200 cells(94%). Remarkably, FISH was also positive for a rearrange-ment involving the EWSR1 gene at chromosome 22q12 in 70 of200 cells (35%). Further reverse transcriptase-polymerase chainreaction (RT-PCR) and direct sequencing of primary and re-current tumors revealed the presence of both an SS18-SSX2gene fusion and an EWS-NR4A3 fusion (Figs. 2C–E)

METHODS

FISHSlides of 4-mm thickness obtained from formalin-

fixed paraffin-embedded sections were hybridized withfluorescent probes using standard techniques.16 Theprobes were LSI EWSR1 Dual Color Break Apart Re-arrangement Probe, mapped to 22q12, and LSI SS18

Dual Color Break Apart Rearrangement Probe, mappedto 18q11.2, both from Vysis (Abbott Park, IL). Twohundred cells were scored for each probe.

RT-PCRRNA was prepared from paraffin or frozen tissue

using an RNAqueous-4PCR Kit (Ambion, Austin, TX) orRecoverAll Kit (Ambion) according to the manufacturer’sdirections. The RNA was eluted into 30mL of elutionsolution and quantified using a NanoDrop spectropho-tometer (NanoDrop Products, Wilmington, DE). All RT-PCRs were performed using a 2-step RETROscript Kit(Ambion) according to the manufacturer’s directions.Briefly, 1mg of total RNA was reverse transcribed in 20mLat 421C for 1 hour followed by inactivation of the reversetranscriptase at 921C for 10 minutes. A parallel reactionwas carried out without addition of the reverse tran-scriptase (no-RT). The PCR conditions and primer pairs todetect specific EWS-NR4A3 and SS18-SSX fusion geneswere exactly as reported previously.1,23 All primers andconditions have been summarized in Table 1. Each PCRreaction contained 1 to 2mL of template RNA solution,0.25mM of each primer, 1.5mM MgCl2, 2U Taq (NewEngland Biolabs, Ipswich, MA), and 0.125mM of eachdNTP. Controls without template or with “no-RT” RNAfrom the previous step were run in parallel. Intron-span-ning primers specific for the GAPDH gene were run inparallel to control for RNA quality. The RT-PCR prod-ucts were analyzed on 3% agarose gels. The reactionsyielding a band of the expected size were purified using theQiagen (Valencia, CA) PCR Cleanup kit according to themanufacturer’s directions and analyzed by direct auto-mated sequencing using the PCR primers.

DISCUSSIONTo our knowledge, the current case represents the first

report of a malignant soft tissue tumor harboring mixedmorphologic and genetic phenotypes of SS and EMC. Weconsidered a variety of possible diagnoses to explain thehistologic and/or genetic findings. First, given the initialFISH results, which detected break-apart rearrangementsof SS18 and EWSR1, we considered the possibility of asarcoma harboring a novel EWSR1-SS18 fusion gene.However, this possibility is excluded by the EWSR1-NR4A3 and SS18-SSX2 fusions identified by RT-PCR. Asoft tissue myoepithelioma (also known as soft tissue mixedtumor or parachordoma) was also considered because it canhave morphologic and immunophenotypic overlap withboth EMC and SS. Its broad histologic spectrum can in-clude a monomorphic neoplastic population embedded in ahyalinized to chondromyxoid matrix,11 which can resembleEMC. Rarely, the histopathology of myoepithelioma can beindistinguishable from SS, requiring further molecularanalysis to resolve this diagnostic conundrum.7 The vastmajority of myoepitheliomas display immunopositivity forcytokeratin and S-100,13,18 further blurring the distinctionfrom SS and EMC, respectively. Most notably, recentstudies have demonstrated EWSR1 gene fusions in soft

Vergara-Lluri et al Am J Surg Pathol � Volume 36, Number 7, July 2012

1094 | www.ajsp.com r 2012 Lippincott Williams & Wilkins

FIGURE 1. Morphologic and immunophenotypic features. Grossly (A, B), the tumor was relatively encapsulated, fleshy with cysticspaces containing myxoid material. Hematoxylin and eosin-stained sections (C–G) demonstrated a multinodular neoplasm(C, �40) with subtle transitions between spindled and round cell areas (D, E, �200). Focally, some areas resembled EMC(F, �200) or SS (G, �400). Immunohistochemical stains (�100) showed that the tumor was focally positive for cytokeratins (H),S-100 (I), EMA (J), MUC4 (K), and diffusely positive for bcl-2 (L).

Am J Surg Pathol � Volume 36, Number 7, July 2012 A Novel Sarcoma With Dual Differentiation

r 2012 Lippincott Williams & Wilkins www.ajsp.com | 1095

tissue myoepithelial tumors.12 However, the fusion partnersdescribed to date include PBX15 and POU5F1,3 whereasthe SS18-SSX and EWSR1-NR4A3 fusions have not beendescribed in soft tissue myoepitheliomas. Therefore, thegenetic findings of the current tumor are not compatiblewith this diagnosis and instead support a distinct tumorwith a combined genotype and phenotype.

EMC is a histologically distinctive neoplasm em-bedded within abundant myxoid stroma, with a charac-teristic multinodular growth pattern of cords and clustersof chondrocyte-like cells. Interestingly, some examples ofEMC have shown ultrastructural and immunophenotypicevidence of neuroendocrine differentiation.14 However,EMC can display a wide morphologic spectrum with more

FIGURE 2. Genetic and molecular features. FISH using EWSR1 (A) and SS18 (B) break-apart probes demonstrating the presence ofboth rearrangements. Detection of fusion transcripts by RT-PCR in 3% agarose gel (C): each triplet of lanes (eg, lanes 1 to 3)corresponds to cDNA, no RT, and water templates, respectively. The sequence-specific primers for each triplet are listed above thelane numbers. Lane M, molecular weight markers (100 bp); lanes 1 to 6, GAPDH controls; lanes 7 to 9, EWS exon 12-NR4A3 exon3; lanes 10 to 12, EWS exon 7-NR4A3 exon 2; lanes 13 to 15, EWS exon 11-NR4A3 exon 2; lanes 16 to 18, SS18-SSX1; lanes 19 to21, SS18-SSX2; lanes 22 to 24, SS18-SSX4. A positive signal of the expected size is identified for EWS exon 12-NR4A3 exon 3 fusionand SS18-SSX2 fusion. Sequence chromatograms of RT-PCR products confirming the presence of EWS-NR4A3 fusion (D) and type1 SS18-SSX2 fusion (E).



cellular variants being difficult to distinguish from othersmall, round, blue cell tumors and at times resemblingpoorly differentiated and/or monophasic SS.4 SSs maycontain less cellular areas with calcification, hyalinization,and, occasionally, prominent myxoid change,19 raising thedifferential diagnosis of EMC. The S-100 immunostain,reportedly useful for the diagnosis of EMC, can be focallypositive in SS,10 complicating the distinction between thetwo entities. In difficult cases, presence of EWSR1-NR4A3or SS18-SSX fusions can confirm the diagnosis of EMC andSS, respectively. SSs are known to exhibit genetic instabilityand can show secondary complex or variant translocationsin addition to t(X;18) in multiple chromosomes.17,22 Sim-ilarly, EMC can also exhibit complex secondary cytogeneticaberrations in addition to t(9;22).8 However, the combina-tion of t(X;18) and t(9;22) has not been previously describedin a single tumor.

Of course, predicting the biological behavior of thisunusual tumor on the basis of a single case is impossible.Nevertheless, it is an interesting observation that thistumor has demonstrated a relatively indolent clinicalcourse, more in keeping with EMCs than SS. However,long survival with late local recurrence is not entirelyincompatible with the diagnosis of SS.20

The biological implications of the combined SS18-SSX2 and EWS-NR4A3 fusions in a single tumor areunclear but intriguing. Early publications suggested acommon histogenesis between SS and EMC on the basisof ultrastructural evidence and morphologic overlap.15

The current paradigm, however, is that these are tumorsof uncertain differentiation and their classification de-pends on their respective, unique, genetic features.11,31

The observation that the current tumor displayed mor-phology characteristic of SS and EMC, as well as regionsof overlapping histomorphology, underscores the linkbetween specific gene rearrangements and phenotype. ForSS, the connection between genotype and phenotype isbest supported by the discovery that the biphasic subtypemore commonly displays the SS18-SSX1 rather than theSS18-SSX2 fusion.20 Although the product of eitherfusion gene disrupts cell cycle regulation, possibly throughcyclin D1-dependent mechanisms,16,32,33 the SS18-SSX1protein seems to be more permissive to epithelial differ-entiation by allowing greater expression of e-cadherin.26

The functional significance of the EWS-NR4A3 fusion andits role in promoting the EMC phenotype is less clear. Theprotein product of the EWS domain is a powerful trans-activator, and EWS fusions in other tumors seem to beinitiating events in a variety of mesenchymal tumors.6,9 Anattractive hypothesis is that the C-terminal fusion partnerdetermines the specificity of EWS transactivation and thusdetermines the phenotype and clinical behavior of the tu-mor. In EMC, although t(9;22) is most common, othertranslocations [t(9;17) and t(9;15)] have been described.27

That NR4A3 is conserved as the C-terminal partner inthese fusions lends support to the hypothesis that thisprotein promotes the EMC phenotype. However, the dis-ordered structure of some EWS fusion proteins also allowsinteraction with a myriad of intracellular pathways.9 Fur-ther, some fusions (eg, EWS-ATF1) manifest in tumorswith disparate morphologic and clinical pictures.2,24,25

Thus, the variable relationship between genotype andphenotype is likely affected by the genetic background ofthe host cell.

In conclusion, we present here a highly unusualsarcoma with unique dual morphologic, cytogenetic, andmolecular signatures of SS and EMC. From a clinicalperspective, unraveling the diagnosis of SS in this tumorwas the most important determinant of the managementand treatment of this patient given current treatmentprotocols. It remains to be determined whether geneticinstability or other mechanisms might give rise to similarbiphenotypic tumors. As the prevalence of comprehensivegenetic testing of sarcomas increases, additional tumorswith dual genotypes may better elucidate how molecularsignatures drive tumor morphology.

REFERENCES1. Amary MF, Berisha F, Bernardi Fdel C, et al. Detection of SS18-

SSX fusion transcripts in formalin-fixed paraffin-embedded neo-plasms: analysis of conventional RT-PCR, qRT-PCR and dual colorFISH as diagnostic tools for synovial sarcoma. Mod Pathol. 2007;20:482–496.

2. Antonescu CR, Katabi N, Zhang L, et al. EWSR1-ATF1 fusion is anovel and consistent finding in hyalinizing clear-cell carcinoma ofsalivary gland. Genes Chromosomes Cancer. 2011;50:559–570.

3. Antonescu CR, Zhang L, Chang NE, et al. EWSR1-POU5F1 fusionin soft tissue myoepithelial tumors. A molecular analysis of sixty-sixcases, including soft tissue, bone, and visceral lesions, showing

TABLE 1. Summary of Primers and PCR Conditions

Transcript

PCR

Product

(bp) Forward Primer Reverse Primer Conditions

GAPDH1 87 TGCAACAACAACTGCTTAGC GGCATGGACTGTGGTCATGAG 40 cycles�(30 s 951C, 1min 551C,30 s 721C), 10min 721CGAPDH2 156 CATGTTCGTCATGGGTGTGAACCA ATGGCATGGACTGTGGTCATGAGT

EWS12NR4A33 89 GCGATGCCACAGTGTCCTATG ATATTGGGCTTGGACGCAGGG 40 cycles�(1min 941C, 45 s 551C,50 s 721C), 10min 721CEWS7NR4A32 146 CTCCAAGTCAATATAAGCCAAC GGACGTCCGGCGAGGCGAAGC

EWS11NR4A32 133 TCTGGCAGACTTCTTTAAGCASYT SSX1 108 ACACTCCCTTCGAATCATTTTCG 7min 951C, 10 cycles�(45 s 941C,

45 s 661C [decreasing 11C percycle for 10 cycles], 90 s 721C),30 cycles�(45 s 941C, 45 s 561C,90 s 721C), 5min 721C

SYT SSX2 108 AGACCAACACAGCCTGGACCAC GCACTTCCTCCGAATCATTTCSYT SSX4 108 GCACTTCCTTCAAACCATTTTCT

Am J Surg Pathol � Volume 36, Number 7, July 2012 A Novel Sarcoma With Dual Differentiation

r 2012 Lippincott Williams & Wilkins www.ajsp.com | 1097

common involvement of the EWSR1 gene. Genes ChromosomesCancer. 2010;49:1114–1124.

4. Bergh P, Meis-Kindblom JM, Gherlinzoni F, et al. Synovialsarcoma: identification of low and high risk groups. Cancer.1999;85:2596–2607.

5. Brandal P, Panagopoulos I, Bjerkehagen B, et al. Detection ofa t(1;22)(q23;q12) translocation leading to an EWSR1-PBX1 fusiongene in a myoepithelioma. Genes Chromosomes Cancer. 2008;47:558–564.

6. Codrington R, Pannell R, Forster A, et al. The Ews-ERG fusionprotein can initiate neoplasia from lineage-committed haemato-poietic cells. PLoS Biol. 2005;3:e242.

7. Coindre JM, Pelmus M, Hostein I, et al. Should molecular testing berequired for diagnosing synovial sarcoma? A prospective study of204 cases. Cancer. 2003;98:2700–2707.

8. Doecke JD, Day CJ, Stephens AS, et al. Association of functionallydifferent RUNX2 P2 promoter alleles with BMD. J Bone Miner Res.2006;21:265–273.

9. Erkizan HV, Uversky VN, Toretsky JA. Oncogenic partnerships:EWS-FLI1 protein interactions initiate key pathways of Ewing’ssarcoma. Clin Cancer Res. 2010;16:4077–4083.

10. Fisher C, Schofield JB. S-100 protein positive synovial sarcoma.Histopathology. 1991;19:375–377.

11. Fletcher CDM, Unni KK, Mertens F. Pathology and Genetics ofTumours of Soft Tissue and Bone. Lyon: IARC Press; 2002:427.

12. Flucke U, Palmedo G, Blankenhorn N, et al. EWSR1 generearrangement occurs in a subset of cutaneous myoepithelialtumors: a study of 18 cases. Mod Pathol. 2011;24:1444–1450.

13. Folpe AL, Fanburg-Smith JC, Billings SD, et al. Most osteomala-cia-associated mesenchymal tumors are a single histopathologicentity: an analysis of 32 cases and a comprehensive review of theliterature. Am J Surg Pathol. 2004;28:1–30.

14. Goh YW, Spagnolo DV, Platten M, et al. Extraskeletal myxoidchondrosarcoma: a light microscopic, immunohistochemical, ultra-structural and immuno-ultrastructural study indicating neuroendo-crine differentiation. Histopathology. 2001;39:514–524.

15. Hajdu SI, Shiu MH, Fortner JG. Tendosynovial sarcoma: aclinicopathological study of 136 cases. Cancer. 1977;39:1201–1217.

16. Horvai AE, Kramer MJ, O’Donnell R. Beta-catenin nuclearexpression correlates with cyclin D1 expression in primary andmetastatic synovial sarcoma: a tissue microarray study. Arch PatholLab Med. 2006;130:792–798.

17. Iliszko M, Rys J, Wozniak A, et al. Complex tumor-specific t(X;18)in seven synovial sarcoma tumors. Cancer Genet Cytogenet. 2009;189:118–121.

18. Kilpatrick SE, Doyon J, Choong PF, et al. The clinicopathologicspectrum of myxoid and round cell liposarcoma. A study of 95 cases.Cancer. 1996;77:1450–1458.

19. Krane JF, Bertoni F, Fletcher CD. Myxoid synovial sarcoma: anunderappreciated morphologic subset. Mod Pathol. 1999;12:456–462.

20. Ladanyi M, Antonescu CR, Leung DH, et al. Impact of SYT-SSXfusion type on the clinical behavior of synovial sarcoma: a multi-institutional retrospective study of 243 patients. Cancer Res. 2002;62:135–140.

21. Meis-Kindblom JM, Sjogren H, Kindblom LG, et al. Cytogeneticand molecular genetic analyses of liposarcoma and its soft tissuesimulators: recognition of new variants and differential diagnosis.Virchows Arch. 2001;439:141–151.

22. Nishio J, Iwasaki H, Ishiguro M, et al. Synovial sarcoma with asecondary chromosome change der(22)t(17;22)(q12;q12). CancerGenet Cytogenet. 2002;137:23–28.

23. Okamoto S, Hisaoka M, Ishida T, et al. Extraskeletal myxoidchondrosarcoma: a clinicopathologic, immunohistochemical, andmolecular analysis of 18 cases. Hum Pathol. 2001;32:1116–1124.

24. Panagopoulos I, Mertens F, Debiec-Rychter M, et al. Moleculargenetic characterization of the EWS/ATF1 fusion gene in clearcell sarcoma of tendons and aponeuroses. Int J Cancer. 2002;99:560–567.

25. Rossi S, Szuhai K, Ijszenga M, et al. EWSR1-CREB1 and EWSR1-ATF1 fusion genes in angiomatoid fibrous histiocytoma. ClinCancer Res. 2007;13:7322–7328.

26. Saito T, Nagai M, Ladanyi M. SYT-SSX1 and SYT-SSX2 interferewith repression of E-cadherin by snail and slug: a potentialmechanism for aberrant mesenchymal to epithelial transition inhuman synovial sarcoma. Cancer Res. 2006;66:6919–6927.

27. Sandberg AA. Genetics of chondrosarcoma and related tumors.Curr Opin Oncol. 2004;16:342–354.

28. Skytting B, Nilsson G, Brodin B, et al. A novel fusion gene, SYT-SSX4, in synovial sarcoma. J Natl Cancer Inst. 1999;91:974–975.

29. Storlazzi CT, Mertens F, Mandahl N, et al. A novel fusion gene,SS18L1/SSX1, in synovial sarcoma. Genes Chromosomes Cancer.2003;37:195–200.

30. Sun B, Sun Y, Wang J, et al. The diagnostic value of SYT-SSXdetected by reverse transcriptase-polymerase chain reaction (RT-PCR) and fluorescence in situ hybridization (FISH) for synovialsarcoma: a review and prospective study of 255 cases. Cancer Sci.2008;99:1355–1361.

31. Weiss SW, Goldblum JR. Enzinger and Weiss’s Soft Tissue Tumors.St Louis: Mosby; 2008.

32. Xie Y, Skytting B, Nilsson G, et al. SYT-SSX is critical for cyclin D1expression in synovial sarcoma cells: a gain of function of thet(X;18)(p11.2;q11.2) translocation. Cancer Res. 2002;62:3861–3867.

33. Xie Y, Skytting B, Nilsson G, et al. The SYT-SSX1 fusion type ofsynovial sarcoma is associated with increased expression of cyclin Aand D1. A link between t(X;18)(p11.2; q11.2) and the cell cyclemachinery. Oncogene. 2002;21:5791–5796.



a novel sarcoma with dual differentiation

Documents