a new approach to the study of haematopoietic development ... · full cdna cloning, sequence and...

3335Development 121, 3335-3346 (1995)Printed in Great Britain © The Company of Biologists Limited 1995

A new approach to the study of haematopoietic development in the yolk sac

and embryoid bodies

M. Jorge Guimarães1,*, J. Fernando Bazan1, Albert Zlotnik1, Michael V. Wiles2, J. Christopher Grimaldi1,Frank Lee1,† and Terrill McClanahan1

1DNAX Research Institute of Molecular and Cellular Biology, 901 California Avenue, Palo Alto, CA 94304, USA2Basel Institute for Immunology, Grenzacherstrasse 487, CH4005 Basel, Switzerland *Author for correspondence†Present address: Millenium Pharmaceuticals, 640 Memorial Drive, Cambridge, MA 02139, USA

To understand the mechanisms that control the differen-tiation of uncommitted mesoderm precursors intohaematopoietic stem cells (HSCs) and the activation ofhaematopoiesis, we conducted a study to identify genesexpressed at the earliest stages of both in vivo and in vitrohaematopoietic development. Our strategy was to utilizeDifferential Display by means of the Polymerase ChainReaction (DD-PCR) to compare patterns of geneexpression between mRNA populations representingdifferent levels of haematopoietic activity obtained fromthe mouse embryo, embryoid bodies (EBs) and mouse celllines. We report the molecular cloning of two groups ofgenes expressed in the yolk sac: a group of genes expressedin the day-8.5 yolk sac at higher levels than in the day-8.5

embryo proper and up-regulated during EB development,and another group of day-8.5 yolk sac genes not expressedin the day-8.5 embryo proper or in EBs. Specifically, wedescribe the molecular cloning of the first nucleobasepermease gene to be found in vertebrates, yolk sacpermease-like molecule 1 (Yspl1). The Yspl1 gene has theunique property of encoding both intracellular, trans-membrane and extracellular protein forms, revealing novelaspects of nucleotide metabolism that may be relevantduring mammalian development.

Key words: cell differentiation, gene expression, haematopoiesis,haematopoietic stem cells, yolk sac, permeases, polymerase chainreaction

SUMMARY

INTRODUCTION

Haematopoiesis is the process by which all blood cells areformed from multipotential, undifferentiated haematopoieticstem cells (HSCs). The first active site of haematopoiesisoccurs in the yolk sac, both in avians (Dieterlen-Lièvre et al.,1979) and in mammals (Moore and Metcalf, 1970), at approx-imately day 7.5 of gestation. In mammals, it has beensuggested that all haematopoietic activity results from the col-onization of the embryo with cells that migrate from the yolksac to the fetal liver after the activation of circulation by day8.5. These cells would later colonize the bone marrow and beresponsible for the formation of blood cells for the entire lifeof the organism (Moore and Metcalf, 1970). HSC activity wasdefined in these studies as the formation of day-8 spleencolony-forming units (CFU-S) - macroscopic colonies on thespleen of recipient mice at 8 days posttransplantation(McCulloch and Till, 1964), an assay later shown to detect onlycommitted haematopoietic progenitors (Jones et al., 1990).Recent studies in the mouse showed that the splancnopleura(Godin et al., 1993), para-aortic (Cumano et al., 1993) or AGMregion (delimited by the aorta, gonada and mesonephros,Medvinsky et al., 1993), contains haematopoietic activityearlier than the fetal liver. Moreover, complete multilineage,

long-term repopulation of irradiated mice with cells derivedfrom the AGM region was reported (Muller et al., 1994).

ES cells are derived from the inner cell mass of blastocystsand appear to resemble the primitive ectoderm of the postim-plantation embryo (Evans and Kaufman, 1981; Martin, G. R.,1981; Robertson et al., 1986). Culture systems for ES cells thatallow their differentiation in vitro into embryoid bodies (EBs)containing haematopoietic activity have been described(Doetschman et al., 1985; Lindenbaum and Grosveld, 1990;Wiles and Keller, 1991; McClanahan et al., 1993; Nakano etal., 1994; Johansson and Wiles, 1995).

Our goal was to identify differentially expressed genes at theearly stages of haematopoietic development, both in vivo andin vitro, to find candidate genes involved in haematopoieticcommitment. The application of the technique of DifferentialDisplay by PCR (DD-PCR) allowed the comparison of geneexpression patterns between multiple mRNA populations(Liang and Pardee, 1992; Guimarães et al., 1995). Here wereport the molecular cloning of two groups of genes preferen-tially expressed in the yolk sac: Group 1 genes are up-regulatedduring EB development and expressed in the day-8.5 embryoproper, whereas Group 2 yolk sac genes are not expressed inEBs or the day-8.5 embryo proper. Specifically, we describe aGroup 2 gene which constitutes the first vertebrate member of

3336 M. J. Guimarães and others

a family of nucleobase permeases described in yeast andbacteria. Moreover, we demonstrate the existence in the yolksac of cDNAs that encode intracellular, transmembrane andextracellular protein forms of this novel yolk sac gene desig-nated Yspl1, yolk-sac permease-like molecule 1. We describean efficient strategy for the identification of differentiallyexpressed genes during early development that can be extendedto inspire similar models for the study of other developmentalsystems.

MATERIALS AND METHODS

AnimalsTimed pregnant ICR female mice were used (Harlan Sprague Dawley,Indianapolis, Indiana). The morning of the day when the vaginal plugwas found was designated as day 0. Somite pairs were carefullycounted and 3- to 6-somite stage embryos were designated as 8.0-dayembryos (Hogan at al., 1986). Mice were killed by CO2 narcosis.Embryos were dissected under a dissecting microscope and sampleswere collected in phosphate-buffered saline (PBS) + 5% (vol/vol)fetal calf serum (FCS; Sigma, St. Louis, MO) and kept on ice duringdissection, centrifuged at 1,000 rpm for 5 minutes, supernatants wereaspirated and pellets were frozen in dry ice before storage at −80˚C.

Three week old Balb/c male mice were killed, as above, for theextraction of multiple organs and peri-visceral abdominal fat from thesplenic region. Femurs and tibias were flushed with PBS + 5% FCSand bone marrow cells filtered through a 70 µm nylon Cell Strainer(Becton Dickinson, Franklin Lakes, N. Jersey), centrifuged, andprocessed as above.

Cell culture conditionsES cells were used and EBs were prepared as previously described(McClanahan et al., 1993). STO cells (American Type Cell Culture -ATCC CRL 1503) were maintained in Dulbecco’s Modified Eagle’smedium + 5% FCS. N2a cells (American Type Cell Culture - ATCCCCl 131) were kept in Dulbecco’s Modified Eagle’s medium + 10%horse serum (GIBCO BRL, Grand Island, NY) containing 100 U/mlpenicillin and 100 µg/ml streptomycin. FDCPmixA4 cells (AmericanType Cell Culture; Ford et al., 1971) were maintained in IscoveModified Eagle medium + 20% horse serum containing 50 mM 2-mercaptoethanol, 100 U/ml penicillin, 100 µg/ml streptomycin and100 U/ml mouse IL-3 (DNAX Research Institute, Palo Alto, CA). Allcell lines were plated in tissue culture dishes at a concentration of1×105 cells/ml and kept at 37˚C in a humidified atmosphere with 5%CO2.

RNA extractionRNA was isolated from cells, embryonic tissues, and adult organsusing RNAzol solution (Tel-test, Inc, Friendswood, TX) according tomanufacturer’s instructions. Heart and testis total RNAs werepurchased from Clontech, Palo Alto, CA.

Differential display by PCR (DD-PCR)Reverse transcription and PCR conditions were as suggested byGenHunter Corporation (Brookline, MA). All reagents were from theRNAmap kit (Genhunter), except AmpliTaq DNA polymerase(Perkin Elmer-Cetus, Norwalk, CT) and [35S]dATP (Amersham,Arlington Heights, IL). A duplicate reverse transcription reaction wasperformed for each sample; PCR reactions were performed with theseduplicate cDNAs and run side by side in the same polyacrylamide gelin order to evaluate the reproducibility of the results.

A DNA ladder was prepared by labeling the 5′ end of DNA MarkerV (Boehringer Mannheim) for sizing purposes. The PCR productswere run on denaturing 6% polyacrylamide gels. Gels were dried and

exposed to Kodak O-mat film (Eastman Kodak, Rochester, NY) for2 to 5 days.

Specific bands were cut from the gels after long runs for better res-olution of the bands, reamplified PCR products were gel extracted,cloned and mini prep DNA was obtained as described by Guimarãeset al. (1995). Three independent clones derived from each polyacry-lamide gel slice were sequenced in order to exclude the possibility ofmore than one PCR product being represented as a single band in thepolyacrylamide gel (Guimarães et al., 1995).

Northern blot analysisLarge preparations of plasmid DNA containing the DD-PCR productswere done using the QIAGEN Plasmid Maxi Kit (QIAGEN)following the manufacturer’s instructions. Plasmid DNA was cut withEcoRI (Boehringer Mannheim) or BstXI (Biolabs, New England), gelextracted with the QIAEX gel extraction kit (QIAGEN) and randomprimed with [32P]dCTP (Amersham) using the Prime-It II kit (Strat-agene, La Jolla, CA) all in accordance with manufacturer’s instruc-tions.

10-20 µg of total RNA were run in formaldehyde gels (Sambrooket al., 1989) and transferred to Nytran membranes (Schleicher &Schuell, Keene, NH) by standard methods (Sambrook et al., 1995),and blots were hybridized and washed at 65˚C as described (McClana-han et al., 1993).

Full cDNA cloning, sequence and structural analysisPoly(A)+ RNA was obtained and cDNA libraries were made andscreened as described (Guimarães et al., 1995). Group II genes (seebelow) were subcloned into the pMET7 plasmid (DNAX) after asmall scale λ DNA prep (Grimaldi and Grimaldi, 1989). The DNAwas fully sequenced as described (Guimaraes et al., 1995). Thecomplete sequence of Mouse Yspl1 Form 1 cDNA (longer transcript)has been deposited in GenBank (Benson et al., 1994) with accessionnumber U25739.

The FASTA (Pearson and Lipman, 1988) and BLAST (Altschul etal., 1990) programs were used to comb nonredundant protein andnucleotide databases (Benson et al., 1994; Bairoch and Boeckman,1994) with the resultant cDNA and encoded protein sequences. Thesensitive search strategies of Altschul et al. (1994) and Koonin et al.(1994) served as examples of how to locate distant structural homo-logues of protein chains. Multiple alignments of collected homo-logues were carried out with ClustalW (Thompson et al., 1994) andMACAW (Schuler et al., 1991).

The membrane topologies of Yspl1 and a cohort of putative homo-logues were analyzed by a variety of methods that sought to determinethe consensus number of hydrophobic membrane-spanning helicesand the likely cytoplasmic or extracellular exposure of the hydrophilicconnecting loops. For single sequence analysis, the ALOM andMTOP (Klein et al., 1985; Hartmann et al., 1989) programs wereaccessed from the PSORT World-Wide Web site (Nakai andKanehisa, 1991, 1992); in turn, the TopPredII program (Claros andvon Heijne, 1994; MacIntosh PPC version) was used to parse chainsinto probable hydrophobic transmembrane and loop regions, andfurther predict the localization of these latter regions by prevalenceof charged residue types (von Heijne, 1992; Sippos and von Heijne,1993). MEMSAT (Jones et al., 1994; MS-DOS PC version) waslikewise used to fit individual sequences into statistically basedtopology models that render judgement on membrane spanning andloop chain segments. Two Web-accessible programs that are able tomake use of evolutionary data by analyzing multiply alignedsequences are PHD (Rost et al., 1994, 1995) and TMAP (Persson andArgos, 1994); the former utilizes a neural network system to accu-rately predict the shared location of helical transmembrane segmentsin a protein family.

PCR analysisTotal RNA (5 µg) was reverse transcribed and conditions for PCR

3337Haematopoietic development

Fig. 1. Strategy followed in this study. (A, top) Schematicrepresentation of a mouse embryo. YS - Yolk sac, H - Headprimordium, T, posterior region; FL, fetal liver; AGM, AGM region(see text). (Middle) Schematic representation of the in vitro culturesystem of embryoid bodies (EBs) derived from embryonic stem (ES)cells. d3, d6 and d9, day 3, day 6 and day 9 EB development.(Bottom) Mouse cell lines: fibroblastic cell line STO, neuronal cellline N2a and haematopoietic cell line FDCPmixA4 (as described inthe text). Grey areas represent cells or tissues for whichhaematopoietic activity has been demonstrated. (B) PCR analysis ofthe expression of the common β chain of the Interleukin 3 (IL-3)receptor (AIC2B). W, early day-8.5 embryo proper; R, late day-8.5embryo proper; Y.S., day-8.5 yolk sac; H, head primordium of day-8.0 embryos; T, posterior region of day-8.0 embryos; E.S., d3, d6,d9, STO, N2a and FDCPmixA4 as above; RT(W), RT(d3) andRT(d9), reverse transcriptase controls (samples for which no reversetranscriptase enzyme was added in the cDNA synthesis reaction);H2O, no cDNA added.

H

YS

T

ES d3 d6 d9

STO N2a

A

B

FLAGM

reactions were as described by McClanahan et al. (1993). Primerswere chosen to flank intron sequences. The primers for AIC2B PCRanalysis were as described by McClanahan et al. (1993), primers forBrachyury as described by Keller et al. (1993), and βH1-globinprimers were as described by Johansson and Wiles (1995). For Hypox-anthine-phosphoribosyl-transferase (HPRT). s.p. - 5′ GTAATGATC-AGTCAACGGGGGAC 3′; a.p. - 5′ CCAGCAAGCTTGCAACCT-TAACCA 3′; i.p. - 5′ TCCCTTGGGGATGCCCAGGTC 3′; expectedsize of the PCR product (e.s.p.p.): 214 base pairs (bp). For α-feto-protein (Gorin et al., 1981): s.p. - 5′ GAAGGAACAAGCAGCCAT-GAAG 3′, a.p. - 5′ GCACATGAAGAAAACAGGGCAG 3′, i.p. - 5′GTGACGGAGAAGAATGTG 3′; e.s.p.p.: 503 bp. For Clone 240(Yspl1): s.p. - 5′ AGAGCAAAGATGCCAAGACCAG 3′, a.p. - 5′GATCACCTCTCCATCCCATTC 3′, i.p. - 5′ CTGCCACCACTGC-TAC 3′; e.s.p.p.: 191 bp. EBs were developed in the absence of serumas described by Johansson and Wiles (1995) for the PCR analysis ofYspl1 expression. Identity of the PCR product was confirmed by sizeon agarose gels and hybridization with an i.p. after transfer to a nylonmembrane (Southern, 1975). Probes were labeled at the 5′ end with[32P]ATP using polynucleotide kinase (Boeheringer Mannheim).Blots were hybridized in 0.5 M NaHPO4, pH 7.2, 7% sodium dodecylsulfate (SDS) and 0.5 M EDTA, pH 8.0 at 42˚C for 24 hours, thenwashed in 6× SSC, 0.2% SDS at 42˚C for 1 hour with one change ofbuffer, and exposed to Kodak O-mat film (Eastman Kodak) at −80˚C.

Protein expression of Yspl1Constructs for the expression of Forms 3 and 4 of Yspl1 were madein which a tag (FLAG) sequence (Hopp et al., 1988) was introducedin the protein. The open reading frame of cDNAs 240-4 and 240-210B, corresponding to Forms 3 and 4 of Yspl1 (see below) wasamplified by PCR to introduce the FLAG peptide sequence (IBI, NewHaven, CT) at the C terminus of both protein Forms 3 and 4 of Yspl1.Primers used for Form 3 Yspl1 - s.p.: 5′ ACTTCTCGAGGCAC-CATGTTTCTTCGTTCTTTGCTGGCA 3′; a.p.: 5′ CTAGGTCTA-GATTTACTTGTCATCGTCGTCCTTGTAGTCCTGGGACCTAA-CCCCTTCTCTGCTAGCTGT 3′. Primers used for Form 4 Yspl1 -s.p.: 5′ ACTTCTCGAGGCACCATGCTTCAGCAATCCAGGAG-GAAAG 3′; a.p. as described above for Form 3. PFU enzyme (Stratagene) was used with 12 cycles PCR: 94˚C 30 seconds; 55˚C 1minute; 72˚C 4 minutes. These constructs were cloned into thePME18X vector (DNAX) using XhoI and XbaI sites incorporated intothe 5′ and 3′ primers, respectively.

COS-7 cells were maintained in DMEM, 10% FCS, 4 mM L-glutamine (JRH Biosciences, Lenexa, KS), 100 U/ml penicillin and100 µg/ml streptomycin. Plasmid DNA was transfected by electro-poration (BIORAD, Hercules, CA) (20 µg/1×107 cells) and plated intotissue culture dishes. The medium was replaced after 24 hours andcell lysates and media were collected 3 days after transfection. Lysisbuffer (25 mM Hepes pH 7.5, 2 mM EDTA, 1.0% NP-40, 150 mMNaCl, 0.01% Aprotinin (Sigma, St Louis, MO), 0.01% Leupeptin(Sigma)) was added to the plates. Plates were kept on ice for 45minutes. Lysates were centrifuged for 15 minutes to eliminate celldebris. Supernatants of centrifuged cell lysates and sterile-filteredmedia from cultured cells were incubated with anti-Flag M2 AffinityGel (IBI) at 4˚C overnight and washed four times with PBS. Immuno-precipitates were eluted in a Econocolumn (BIORAD) with 2.5 Mglycine, pH 2.5. Eluates were neutralized with Hepes, pH 7.4 (JRHBiosciences) and concentrated by precipitation with 24% TCA and2% deoxycholic sodium salt (Sigma). Pellets were eluted in 2×Sample Buffer (NOVEX, San Diego, CA), electrophoresed on 4-20%tris-glycine gels (Novex) and transferred to PVDF membranes(Immobilon-P, Millipore Corporation, Bedford, MA). Membraneswere exposed to 3% non-fat milk for 1 hour at 37˚C. Anti-Flag M2antibody was used as recommended (IBI). Anti-mouse Ig horseradishperoxidase conjugate (Amersham) was used at 1:2,000 dilution andthe peroxidase detection was performed with ECL detection reagents(Amersham).

RESULTS

Identification of genes differentially expressed in themouse embryo and in EBsOur strategic approach was the direct comparison of geneexpression between the head primordium of 3- to 6-somitestage (day-8.0) mouse embryos, which is deprived of circula-tion at this stage (Godin et al., 1993), and regions of the devel-oping embryo containing haematopoietic activity, circulatingblood or suspected to have the potential to develophaematopoietic activity. For this purpose we used, respec-tively, the day-8.5 yolk sac, the day-8.5 embryo proper and theposterior region of day-8.0 embryos (from which the head pri-mordium and the yolk sac were removed) (Fig. 1A).

Additionally, we compared the gene expression of ES cells,day-3, day-6 and day-9 EBs from a culture system in which


we previously described the activation of genesinvolved in haematopoiesis (McClanahan et al.,1993). We expected that ES cells would notexpress genes involved in haematopoietic com-mitment and predicted that genes that would beimportant in the mesoderm-haematopoietictransition could be activated as early as day-3EBs. Genes involved in early haematopoieticdevelopment were expected to be expressed byday 6 and day 9 of EB development (Fig. 1B).

Finally, we used three different cell lines: thefibroblastic line STO, the neuronal line Neuro-2a, and the multipotential precursor haematopoi-etic cell line FDCPmixA4. Genes potentiallyinvolved in the mesoderm-haematopoietic tran-sition, but not haematopoietic-specific, couldpotentially be expressed in STO, since it is ofmesodermic origin. ES cells, the head pri-mordium of day-8.0 embryos, and the N2a cellline, derived from a spontaneous mouse neuro-blastoma, were used as negative populations.FDCPmixA4 is an IL-3-dependent non-trans-formed cell line that can undergo multilineagemyeloid, lymphoid or osteoclastic differentiation(Ford et al., 1971). The multipotentiality of thiscell line predicts that genes involved in theearliest events of haematopoietic determinationmay be expressed in these cells (Fig. 1C).

Haematopoietic activity was assessed in allsamples by examining the expression of thecommon β chain of the IL-3 receptor (AIC2B)(Kitamura et al., 1991) by PCR. As shown in Fig.1D, AIC2B mRNA is expressed in the body ofearly and late 8.5-day embryos, 8.5-day yolk sacand the posterior region of day-8.0 embryos. Asshown previously (McClanahan et al., 1993),expression of AIC2B mRNA is first observed byday 6 of EB development. Only FDCPmixA4showed significant expression levels of thereceptor among the cell lines used. For the qual-itative evaluation of all these cDNAs, theexpression of HPRT was used (data not shown).

The analysis of the DD-PCR results obtainedafter 20 PCR primer combinations (C/AP1through AP5, G/AP1 through AP5, A/AP1through AP5, T/AP1 through AP5) lead to theidentification of a group of 5 bands (Clones 165,260, 305/310, 560 and 1000 shown in Fig. 2)

Fig. 2. Definition of Group 1 developmentallyregulated genes: genes preferentially expressed inthe yolk sac and in the haematopoietic cell lineFDCPmixA4, which are upregulated duringembryoid body development. On the left are shownthe DD-PCR results and on the right the northernblot analysis for each DD-PCR product. W, earlyday-8.5 embryo proper; R, late day-8.5 embryoproper; YS, day-8.5 yolk sac; H, head primordiumof day-8.0 embryos; T, posterior region of day-8.0embryos; ES, ES cells; d3, d6, d9 – day-3, day-6and day-9 EBs; STO, N2a and FDCPmixA4 asdescribed in the text.


with an expression pattern similar to the one we had predictedfor genes involved in haematopoietic development: bandsexpressed in day-8.5 yolk sac at higher levels than the day-8.5embryo proper or the head primordium of day-8.0 embryos, oflower intensity in ES cells than in day-3 and/or day-6 EBs, and,in general, with higher expression in FDCPmixA4 cells than inSTO and N2a cells (Group 1).

Additionally, a different group of yolk sac bands (Clones240, 320 and 460) was identified which were not expressed inEBs (Group 2) (Fig. 3).

Similar patterns of gene expression were obtainedby DD-PCR and by northern blot analysisIn order to confirm the differential expression results obtained

by DD-PCR, we conducted northern blot analysis on the sameRNA populations that were used to generate cDNAs for DD-PCR. The head primordium and the posterior region of day-8.0 embryos were omitted because insufficient RNA wasavailable for northern analysis. The cloned PCR products wereused as probes. As shown in Figs 2, 3, the expression patternsof the two groups of genes defined by DD-PCR were repro-duced by northern analysis.

Differential expression of Group 1 and Group 2genes in intraembryonic sites of haematopoiesisIn order to characterize further their tissue distribution, partic-ularly in intraembryonic sites of haematopoiesis, we performednorthern blot analysis of both groups of genes.

Fig. 3. Definition of Group 2developmentally regulatedgenes: genes preferentiallyexpressed in the day-8.5 yolksac with no detectableexpression in EBs or in the celllines analyzed in this study(Group 2). On the left are shownthe DD-PCR results and on theright the northern analysis foreach gene. W, early day-8.5embryo proper; R, late day-8.5embryo proper; YS, day-8.5yolk sac; H, head primordium ofday-8.0 embryos; T, posteriorregion of day-8.0 embryos; ES,ES cells; d3, d6, d9 – day-3,day-6 and day-9 EBs; STO, N2aand FDCPmixA4 as described inthe text.


Fig. 4. Northern blot analysis ofexpression of Clones 260 and 305/310in fetal and adult tissues. Both genesare expressed in the day-11.5 AGMregion at higher levels than in the day-11.5 yolk sac. Their expression inday-15 YS is upregulated compared today 11.5. Clone 305/310 ispreferentially expressed in the adultbone marrow. YS, yolk sac; AGM,AGM region; FL, fetal liver; H, headof the embryo; Plac, placenta; BM,bone marrow; S. Muscle, skeletalmuscle; A. Fat, perivisceralabdominal fat, FDCP, FDCPmixA4cell line, STO and N2a as described;28S, ribosomal RNA.

Fig. 5. Northern blot analysis of the expression of Group 2 genes inthe yolk sac and early intraembryonic sites of haematopoieis. Thesegenes are differentially expressed during yolk sac development.None is expressed in intraembryonic sites of early haematopoiesis.Four different messages were identified for Clone 240 (sizes shownon the right).

All Group 1 genes were expressed in a variety of fetal andadult tissues including the AGM region, fetal liver and yolksac (Clones 260 and 305/310 are shown in Fig. 4). Clone305/310 had its highest level of expression in haematopoietictissues: day-11.5 AGM, day-11.5 and day-15 yolk sac andadult bone marrow. The results of the expression of Clones 165and 1000 will be published elsewhere (Guimarães et al.,unpublished data).

However, the expression of Group 2 genes was undetectablein intraembryonic sites of haematopoiesis (day-11.5 AGMregion and day-15.5 fetal liver) (see Fig. 5). A time course ofexpression in the yolk sac from day-8.5 to day-15 revealed thatthese genes were differentially expressed over time in thattissue. Two smaller transcripts of Clone 240 were found at days11.5 and 15, Clone 460 was only expressed in day-8.5 yolksac, and Clone 320 was highly expressed in day-8.5 and 11.5yolk sac.

Molecular cloning of a sialic acid esterase,selenophosphate synthetase and a permease-likemoleculeThe DD-PCR products from both groups of genes weresubmitted to careful sequence analysis aimed at recognizingidentical, closely similar or distant homologues from nonre-dundant DNA and protein databases (Benson et al., 1994;Bairoch and Boeckmann, 1994) in order to determine theirpotential biological structure and function (for review, seeAltschul et al., 1994). In this manner, Clone 560 in Group 1was identified as encoding murine coproporphyrinogenoxidase, an enzyme required for the synthesis of the porphyrinring and therefore essential for the formation of haeme (Martinet al., 1985). Clone 320 in Group 2 appears to encode themouse homologue of calbindin-D9K, a cytoplasmic calcium-binding protein (Jeung et al., 1992); the expression ofcalbindin-D9K in the mouse yolk sac has been previouslydescribed (Bruns et al., 1985). The remaining novel sequencefragments from the DD-PCR screen did not elicit any closerelatives from the available databases.

In order to characterize these remaining clones further, fulllength cDNAs corresponding to the cloned DD-PCR fragmentswere isolated. The protein encoded by the full sequence ofClone 165 contains regions that closely match two shortpeptide fragments previously isolated from a rat liver sialic

acid-specific esterase (Butor et al., 1993; Guimarães et al.,unpublished data). Clone 1000, also from Group 1, is predictedto be the mouse homologue of E. coli selenophosphate syn-thetase, an enzyme that is capable of activating seleniummetabolism by synthesizing monoselenophosphate fromselenide and ATP (Veres et al., 1994; Guimarães et al., unpub-lished data). However, the full length sequences of Clones 260,305/310 and 460 have not yet been found to have any rela-tionship to extant protein families.


form 11

19

52

86

119

152

186

219

252

286

319

352

386

419

452

486

519

552

586

18

51

85

118

151

185

218

251

285

318

351

385

418

451

485

518

551

585

611

form 2

form 3

form 4

TM1

X

TM2

TM3

TM4

TM5

TM6

TM7

TM8

TM9

TM10

TM11

TM12

. . . . . . . . . . CCCACGCGTCCGCTGGGGCAGCCAAGACGCAATCAAGTCAGGGCAGCATGAGCCGATCACCTCTCCATCCCATTCCACTTCTATCTGAGGGCTACCAGGA 1 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 100 M S R S P L H P I P L L S E G Y Q D

. . . . . . . . . . TACCCCTGCTCCCCTGCCACCACTGCTACCCCCTCTCCAGAATCCCTCCTCCCGTTCTTGGGCCTCTCGGGTGTTTGGGCCTTCCACCTGGGGGCTCAGC 101 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 200 T P A P L P P L L P P L Q N P S S R S W A S R V F G P S T W G L S

. . . . . . . . . . TGTCTTCTGGCTCTACAGCATTTCCTGGTCTTGGCATCTTTGCTCTGGGCCTCCCACCTGCTGCTGCTTCATGGTCTTCCCCCAGGAGGGCTCTCATACC 201 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 300 C L L A L Q H F L V L A S L L W A S H L L L L H G L P P G G L S Y P

. . . . . . . . . . CACCCGCTCAGCTCCTGGCTTCCAGTTTCTTTTCATGTGGCCTGTCTACGGTCCTGCAGACTTGGATGGGCAGCAGGCTACCTCTAATCCAGGCTCCGTC 301 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 400 P A Q L L A S S F F S C G L S T V L Q T W M G S R L P L I Q A P S

. . . . . . . . . . CCTAGAGTTTCTTATCCCCGCACTGGTGCTGACAAACCAGAAGCTACCTCTGACGACCAAGACACCTGGAAATGCCTCCCTCTCACTGCCCCTGTGTAGT 401 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 500 L E F L I P A L V L T N Q K L P L T T K T P G N A S L S L P L C S

. . . . . . . . . . TTGACAAGAAGCTGCCATGGCCTGGAGCTCTGGAACACTTCTCTCCGAGAGGTGTCGGGGGCAGTGGTGGTGTCCGGGCTGCTGCAGGGCACTATAGGAC 501 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 600 L T R S C H G L E L W N T S L R E V S G A V V V S G L L Q G T I G L

. . . . . . . . . . TTCTAGGGGTGCCTGGCCGTGTGTTCCCCTACTGTGGGCCACTGGTGCTGGCTCCCAGCCTGGTTGTGGCAGGGCTTTCTGCCCACAAGGAGGTGGCCCA 601 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 700 L G V P G R V F P Y C G P L V L A P S L V V A G L S A H K E V A Q

. . . . . . . . . . GTTCTGTTCTGCTCACTGGGGCCTGGCCTTGCTGCTCATCCTGCTCATGGTGGTATGCTCTCAGCACCTGGGTTCATGCCAGATACCCCTTTGCTCCTGG 701 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 800 F C S A H W G L A L L L I L L M V V C S Q H L G S C Q I P L C S W

. . . . . . . . . . AGGCCATCTTCAACTTCAACTCACATTTGTATTCCCGTCTTCCGACTCCTTTCGGTGCTTGCCCCTGTGGCCTGTGTGTGGTTCATCTCTGCCTTTGTGG 801 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 900 R P S S T S T H I C I P V F R L L S V L A P V A C V W F I S A F V G

. . . . . . . . . . GTACGAGTGTTATCCCTCTGCAGCTGTCTGAGCCCTCGGATGCACCTTGGTTTTGGCTGCCACACCCAGGTGAGTGGGAATGGCCCTTGCTGACACCCAG 901 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 1000 T S V I P L Q L S E P S D A P W F W L P H P G E W E W P L L T P R

. . . . . . . . . . GGCCCTGGCTGCAGGCATCTCCATGGCTTTGGCAGCCTCCACCAGCTCCTTGGGTTGCTATGCTCTGTGTGGCCAGCTGCTGCGTTTGTCTCCTCCGCCA1001 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 1100 A L A A G I S M A L A A S T S S L G C Y A L C G Q L L R L S P P P

. . . . . . . . . . CCTCATGCCTGCAGTCGAGGGCTGAGCCTGGAGGGGCTGGGCAGTGTGCTGGCAGGGCTGCTGGGGAGCCCCCTGGGCACTGCATCCAGCTTCCCCAACG1101 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 1200 P H A C S R G L S L E G L G S V L A G L L G S P L G T A S S F P N V

. . . . . . . . . . TAGGCACAGTGAGTCTTTTTCAGACTGGCTCTCGGAGAGTGGCCCACCTAGTGGGGTTGTTCTGCATGGGGCTTGGGCTCTCCCCAAGGCTGGCTCAGCT1201 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 1300 G T V S L F Q T G S R R V A H L V G L F C M G L G L S P R L A Q L

. . . . . . . . . . ATTTACCAGCATCCCACTGCCTGTGCTTGGTGGGGTACTGGGAGTGACCCAGGCTGTAGTTCTGTCTGCTGGATTCTCCAGCTTTCACCTGGCTGACATT1301 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 1400 F T S I P L P V L G G V L G V T Q A V V L S A G F S S F H L A D I

. . . . . . . . . . GACTCTGGGCGAAATGTCTTCATCGTGGGCTTCTCCATCTTCATGGCCTTGCTTTTGCCAAGGTGGCTCAGGGAAGCCCCAGTCCTGCTCAACACAGGCT1401 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 1500 D S G R N V F I V G F S I F M A L L L P R W L R E A P V L L N T G W

. . . . . . . . . . GGAGCCCCCTGGATATGTTTCTTCGTTCTTTGCTGGCAGAACCCATTTTCTTAGCTGGTCTACTGGGCTTTCTCCTAGAAAACACTATATCTGGTACACG1501 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 1600 S P L D M F L R S L L A E P I F L A G L L G F L L E N T I S G T R

. . . . . . . . . . GGCTGAGAGAGGCTTAGGTCAGAGGCTGCCAACTTCTTTCACTGCCCAAGAAATTCAAATGCTTCAGCAATCCAGGAGGAAAGCTGCTCAAGAGTATGGG1601 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 1700 A E R G L G Q R L P T S F T A Q E I Q M L Q Q S R R K A A Q E Y G

. . . . . . . . . . CTTCCTTTACCCATCAAAAACCTGTGTTCCTGCATCCCACAGCCTCTCCACTGCCTCTGTCCAATGCCTGAAGACTCTGGGGATGAAGGAGGATCCTCTA1701 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 1800 L P L P I K N L C S C I P Q P L H C L C P M P E D S G D E G G S S K

. . . . . . . . . . AAACAGGAGAGAGAGCCGACTTGTTGCCTAACTCTGGGGAATCGTACTCCACAGCTAGCAGAGAAGGGGTTAGGTCCCAGTAATCATCAAGACCACCATT1801 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 1900 T G E R A D L L P N S G E S Y S T A S R E G V R S Q *

. . . . . . . . . . TTTGTCTTAGTTTAGCAGTAACTGCCACCTTGCTGGAGTCTGtATACTTTGTCCCAGTGGAGGTGGATGTGGCCCACTTGCAAAATGGGCTGCCTTTCCT1901 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 2000

. . . . . . . . CCTCTTAAGACTTGAGCAGAGGCCATGGTTTAGCGGGTTGGAACTGAATAAATGAGATTTCTGCCTGTAAAAAAAAAAAAAAAAA2001 ---------+---------+---------+---------+---------+---------+---------+---------+----- 2085

Fig. 6. Nucleotideand deduced proteinsequence of Clone240 (Yspl1). Thefour protein formsderived from theYspl1 gene areindicated by arrows.The grey boxes,labeled TM1-12,representpresumptivemembrane spanninghydrophobicsegments. Thehydrophobicsequence labeled asbox X represents aninserted domain inthe canonicalnucleobasepermease fold ofYspl1 - it may alsobe membraneassociated butshould not alter theconsensustopological featuresof Yspl1.


T M 4

4 G W L D V L F P P A A M G A I V A V I G L E L A G V A A G M7 G W L M K I L P P V V V G P V I I V I G L G L A S T A V N M5 R W V M K L L P P V V V G P V I I V I G L G L A G T A V G M1 H L A R R I I T P L V S G V V V M I I G L S L I Q V G L T S3 K V I Q K I F P P I V T G P T V M L I G I S L I G T G F K D7 R L L K A L F P P I V T G P T V F L I G A S L I G N A M K D5 G K L V S F F P P V V T G S V V T I I G I T L M P V A M N N7 D R L A K L F T P V V T G V Y L L L L V M Q L S Q P I I K G9 P G R V F P Y C P L V L A P S L V V A G L S A H K E V A Q F

T M 9

0 G K L A A A I Q M I P L P V M G G V S L L L Y G V I G A S G I R V L I

The screening of a 8.5 day-yolk sac cDNA library byhybridization with clone 240 lead to the isolation of fourdifferent cDNAs: 240-7 (2.1 kb), 240-205 (1.8 kb), 240-4 (0.7kb) and 240-10B (0.6 kb). The size of these cDNAs is inagreement with the northern blot analysis results shown inFig. 5 and correspond, respectively, to the protein Forms 1,2, 3 and 4 of Clone 240 shown in Fig. 6. The frequency ofClone 240 positive clones, all 4 cDNA forms together, wasapproximately 1/63,000. Forms 3 and 4 cDNAs of Clone 240,undetectable in day-8.5 yolk sac by northern analysis, wererepresented in the day-8.5 yolk sac-derived cDNA librarywith a frequency three times lower than that ofForms 1 and 2 cDNAs. The deduced proteinsequence of the longer cDNA sequence of Clone240-7 immediately revealed in the jaggedcontours of its hydropathic profile (Kyte andDoolittle, 1982) that it was probably an integralmembrane protein with 10-13 transmembrane(TM) helices. Accordingly, databank searchingdisclosed a faint but significant chain similarity toa family of nucleobase permeases described inbacteria and yeast (Diallinas et al., 1995) (Fig.7A). Due to its preferential expression in the yolk

EcUraA 11BsPyrP 11BcPyrP 11EcORF 15AnUAPA 23AnUAPC 20BsXpt 11BsORF 11MoYSPL1 18

EcUraA 32

A

BsPyrPBcPyrPEcORFAnUAPAAnUAPCBsXptBsORFMoYSPL1

EcUraABsPyrPBcPyrPEcORFAnUAPAAnUAPCBsXptBsORFMoYSPL1

0-4

-3

-2

-1

0

1

2

3

4

<H>

NH2

Fig. 7. Identification of Yspl1 as a nucleobase permease.(A) A nucleobase permease family. Portions of aClustalW-derived (Thompson et al., 1994b) sequencealignment between Yspl1 and permease homologues arepresented in regions that display family-specificsequence patterns. TM helices are labeled as in Fig. 6.Shading indicates identities (dark) or conserved (light)residues in a column. The sequences include an E. coliuracil permease (EcUraA; GenBank Acc. no. X73586;Andersen et al., unpublished data) and a permease-likegene (EcORF, GenBank Acc. no. L10328; Burland etal., 1993), pyrimidine permeases from B. subtillus(BsPyrP, GenBank Acc. no. M59757; Quinn et al.,1991) and B. caldolyticus (BcPyrP, GenBank Acc. no.X76083; Ghim and Neuhard, 1994), xanthine permeasefrom B. subtillus (BsXpt, GenBank Acc. no. X83878;Saxild et al., 1995) and a similar hypothetical protein(BsORF, GenBank Acc. no. X73124; Schneider et al.,1993), and two uric acid-xanthine permeases from A.nidulans (AnUAPA; GenBank Acc. no. X71807;Gorfinkiel et al., 1993; AnUAPC, GenBank Acc. no.X79796; Diallinas et al., 1995). Mouse Yspl1 isabbreviated MoYSPL1. (B) Membrane topology ofYspl1. (Top) A TopPredII (Claros and von Heijne,1994) profile of the Yspl1 sequence showing peaks thatreach beyond ‘Putative’ or ‘Certain’ baselines. Peaksrepresenting the consensus twelve TM segments arelabeled above, as is the hydrophobic X region outlinedin Fig. 6. (Bottom) Schematic arrangement of the TMhelices in the membrane. The Yspl1 chain weavesthrough the membrane in an in-out fashion determinedby TM regions and charged residue bias (von Heijne,1994). There are no N-glycosylation sites in theexposed, extracellular face of the molecule; however,cysteine residues capable of participating in disulfidelinks are marked by dark points. Start positions forForms 1-4 are again indicated by arrows. Notably, Form3 protein commences with the hydrophobic sequence ofTM12 which could serve as a cleavable signal peptide,while a Form 4 molecule would be purely cytoplasmic.

B

sac, we designated this novel gene product as Yolk sacpermease-like molecule 1 (Yspl1).

Protein structure and expression of Yspl1The overriding structural feature of the 611 amino acid Yspl1chain is its patchwork of 20-30 residue hydrophobic segmentsseparated by hydrophilic sequences of varying length (Kyteand Doolittle, 1982). The weave of the chain through themembrane is dictated by these presumed membrane-spanning, hydrophobic helices (for review, see von Heijne,1994). An accurate prediction of the membrane topology of

330 G K I S A L I S S V P S A V M G G V S F L L F G I I A S S G L R M L I325 G K I T A L I S S I P T P V M G G V S I L L F G I I A S S G L R M L I366 P A V S G F V Q H I P E P V L G G A T L V M F G T I A A S G V R I V S459 A K F A A A I V A I P N S V M G G M K T F L F A S V V I S G Q A I V A437 A K F A A A L V A I P S S V L G G M T T F L F S S V A I S G V R I M C323 P K I A A F T T I I P S A V L G G A M V A M F G M V I A Y G I K M L S328 P F F M N T F A S L P S P V G F A V N F V V F S A M G G L A F A E F D413 P R L A Q L F T S I P L P V L G G V L G V T Q A V V L S A G F S S F H

T M 1 0

358 V D Y N K A Q N L I L T S V I L I I G V S G A K V N I G368 I D Y E N N R N L I I T S V I L V I G V G G A F I Q V S363 V D F G Q T R N L V I A S V I L V I G I G G A V L K I S401 R E P L N R R A I L I I A L S L A V G L G V S Q Q P L I494 K A P F T R R N R F I L T A S M A L G Y G A T L V P T W472 S V D W T R R N R F I L T A S F A V G M A A T L V P D W359 I D F A K Q E N L L I V A C S V G L G L G V T V V P D I365 E K E E S K R V R S I I G I S L L T G V G I M F V P E T449 A D I D S G R N V F I V G F S I F M A L L L P R W L R E

100 200 300 400 500 600

PutativeCertain

Amino Acid Position

12

3 4 5 6 7 8 910 11 12x

1 2 3 4 5 6 7 8 9 10 11 12

Cytoplasm

COOH

XForm 2 Form 3

Form 4


Fig. 8. Protein expression of Form3 and Form 4 cDNAs of Yspl1.Western blot obtained using theM2 antibody directed to the FLAGsequence introduced at the Cterminus of the Yspl1 proteinconstructs. Protein Form 3 ofYspl1 can be observed bothintracellularly (lysates) andextracellularly (media). ProteinForm 4 of Yspl1 is intracellular.PME, PME18X plasmid withoutinsert was transfected into COS-7cells and used as a negative controlfor the expression of Yspl1.

Yspl1 then depends on the correct number and sequencelocation of TM segments as well as their orientation in themembrane - protein termini and TM-linking regions mayeither be surface exposed or cytoplasmic (Hartmann et al.,1989; Sippos and von Heijne, 1993; Jones et al., 1994; vonHeijne, 1994).

The introduction of evolutionary information in the formof sequence homologues simplifies the structural analysisconsiderably for related molecules which share a commonstructural framework in spite of considerable sequencedivergence (Chothia and Lesk, 1986). This concept can beeffectively extended to the strong prediction of TM regionsacross an aligned protein family, whereas any singlesequence may provide an uncertain topology (Persson andArgos, 1994; Rost et al., 1995). In the case of Yspl1, anumber of sequence homologues were first assembled bycomparative matching to protein and translated nucleotidedatabases (Altschul et al., 1994; Koonin et al., 1994). Thesedistant relatives of Yspl1 prominently include bacterialuracil permeases (Andersen et al. unpublished data; Burlandet al., 1993; Ghim et al., 1994; Quinn et al., 1991; Saxild etal., 1995; Schneider et al., 1993) and fungal uric acid-xanthine permeases (Gorfinkel et al., 1993; Diallinas et al.,1995) (Fig. 7A). These varied purine and pyrimidine −generically, nucleobase − permease sequences weresubjected to parallel analyses by a suite of computerprograms that have greatly improved on the initial Kyte andDoolittle (1982) hydropathic profile as a means of predict-ing the topology of integral membrane proteins. Four algo-rithms (ALOM, MTOP, MEMSAT and TopPredII) (Klein etal., 1985; Hartmann et al., 1989; Jones et al., 1994; Clarosand von Heijne, 1994) were used to individually predict TMextensions and orientations; these predictions were pooledand mapped onto the multiple sequence alignment producedby ClustalW and MACAW (Thompson et al., 1994b; Schuleret al., 1991). Furthermore, these multiply aligned sequencefiles were used as input to PHD and TMAP (Rost et al., 1995;Persson and Argos, 1994) for a familial prediction of sharedTM regions. Structural features that persisted in this two-step analysis were most likely to be shared topological traitspresent in all members of this permease family from bacteriato vertebrates.

The TM analysis for Yspl1 and homologues suggested thepresence of twelve consensus helical TM segments (Fig. 7B).This result likely places this nucleobase permease family intoa larger superfamily of 12-TM helix transporters (Nikaidoand Saier, 1992; Uhl and Hartig, 1992; Griffith et al., 1992;Marger and Saier, 1993; Henderson, 1993; Maloney, 1994)that act as discriminating protein channels for a wide varietyof solutes (Kramer, 1994; Hediger, 1994). There are fewamino acid motifs that survive between branches of this vastsuperfamily of 12-TM molecules (Griffith et al., 1992;Henderson, 1993; Marger and Saier, 1993; Goswitz andBrooker, 1995). The prominent sequence patterns thatdescribe the Yspl1-like family (Fig. 7A) cover TM4, TM9and TM10; these motifs are distinct from other topologicallyanalogous 12-TM patterns (Griffith et al., 1992). Permeasespecificity within a universal TM framework may bemodulated by these different structural motifs (see forexample Bloch et al., 1992). Nevertheless, profile methods(Gribskov et al., 1987; Thompson et al., 1994a) do reveal a

faint but significant global similarity (not shown) to a func-tionally similar family of 12-TM molecules formed by theallantoin and uracil permeases of yeast (Jund et al., 1988; Raiet al., 1988; Yoo et al., 1992) and the cytosine permeases ofE. coli and yeast (Danielsen et al., 1992; Weber et al., 1990).Yspl1 remains the sole vertebrate member of a now expandednucleobase permease family.

The different forms of Yspl1 represent molecules withstaggered N termini and common C termini (Fig. 6) of whichthe longest (611 residue) chain, as discussed previously, formsa prototypical 12-TM transporter. Form 2 which lacks TM1and the hydrophobic ‘X’ stretch (Figs 6, 7B) would still encodea truncated permease with eleven TM helices. Form 3 cDNAencodes a protein of 130 residues (Mr 14×103) with onehydrophobic TM12 stretch that could then resemble an N-terminal secretion peptide for a domain formed by the C-terminal, predicted cytoplasmic segment of Yspl1. Finally, an82 amino acid Form 4 (Mr 9×103) would be formed by ashortened version of this cytoplasmic domain, lacking anyhydrophobic segments. In order to determine if Form 3 Yspl1would be secreted or intracellular, and to confirm the cyto-plasmic localization of Form 4 protein, we expressed con-structs of Yspl1 in which a FLAG epitope tag was introducedat the C termini of both Form 3 and 4 proteins (see Materialsand Methods). Western blot analysis using the M2 antibodydirected to this tag sequence shows that Form 3 Yspl1 can bedetected both inside and outside cells whereas Form 4 is purelyintracellular (Fig. 8).

Yspl1 is a unique marker of yolk sac developmentTo determine if Yspl1 is expressed in EBs at levels unde-tectable by northern hybridization, we conducted 30 cycle PCRanalysis comparing the expression of Yspl1 with that of amesoderm marker (Brachyury), a haematopoietic marker(βH1-globin) and a commonly used marker of yolk sac differ-entiation (α-fetoprotein). In contrast to Brachyury (detectableat day 3 and day 6), βH1-globin (detectable from day 6) andα-fetoprotein (detectable from day 9 of EB development),Yspl1 was not found to be expressed in EBs developed up today 9 under standard conditions (see Materials and methods)or day-5.0 EBs developed in CDM (Chemically DefinedMedium) alone (Johansson and Wiles, 1995), or in thepresence of Activin-A or BMP-4 (mediators of the expressionof mesoderm and haematopoietic markers, respectively;Johansson and Wiles, 1995; and data not shown).


DISCUSSION

We report the molecular cloning of two groups of genes pref-erentially expressed in the yolk sac. Specifically, we identifieda set of genes expressed in the day-8.5 yolk sac at higher levelsthan in the day-8.5 embryo proper, which are expressed in EBs(AIC2B, coproporphyrinogen oxidase, lumenal sialic acidesterase, selenophosphate synthetase, Clones 260 and305/310, βH1-globin and α-fetoprotein), and another set ofgenes expressed in the day-8.5 yolk sac, but not in the day-8.5embryo proper, which are undetectable in EBs, as analyzedhere, up to day 9 of EB development, and in intraembryonicsites of haematopoiesis (Yspl1, Calbindin-D9k and Clone 460).This discrepancy could result from a complete failure or adelay in reproducing certain yolk sac developmental events inEBs and suggests that the haematopoietic potential derived invitro from ES cells may be independent of the complete repro-duction of yolk sac developmental programs. However, EBsderived from ES cells can produce embryonic globin andnucleated erythroblasts (Doetshman et al., 1985), yolk sac-specific events during in vivo development (Brotherton et al.,1979). The relevance of these findings can be related to the factthat intraembryonic haematopoieis is only detected shortlyafter the activation of circulation, when haematopoietic eventsare already occurring in the yolk sac. It is therefore particu-larly difficult to determine if such activity results from the col-onization of the embryo by progenitor cells that originated inthe yolk sac or whether haematopoietic activity arose inde-pendently within the embryo. W/W mutant mice (Bennett,1956) and the c-myb (Mucenski et al., 1991) and PU.1 (Scottet al., 1994) knock-out mice provide evidence for a distinctionbetween yolk sac and embryo-derived haematopoiesis. Yolksac erythropoiesis is unaffected in any of these mutant mice.However, in each of these models, by day 15 the fetus becomesdetectably anemic and severe anemia rapidly develops,resulting in prenatal lethality. The demonstration that certainyolk sac-specific events cannot be reproduced in EBs, or areclearly delayed in relation to the generation of haematopoieticactivity, may provide clues to the resolution of this question.

We have reported the molecular cloning of Yspl1, a novelyolk sac gene that EB developmental programs do not reca-pitulate. Yspl1 represents the first member, to be found in ver-tebrates, of a family of nucleobase permeases described inbacteria and yeast. Interestingly, the intracellular, transmem-brane and extracellular forms of the protein are represented bydifferent cDNAs expressed in the yolk sac. This is the firstreport of intracellular and extracellular protein forms of anucleobase or nucleoside permease. The characterization of thefunction of the Yspl1 gene products is likely to reveal novelaspects of nucleotide metabolism which may play a role inmammalian development.

The number of DD-PCR primer combinations under the con-ditions that we have used in this study represent about 1/15 ofthe number required for the observation of the complete reper-toire of mRNA species (Guimarães et al., 1995). Based on thisnumber, we can predict the existence of a total number of about45 genes specifically expressed in the day-8.5 yolk sac. Thisestimate substantiates efforts to isolate additional novel yolksac genes.

We have established a strategy to understand the relation-ship between haematopoietic events observed in the in vitro

culture system of embryoid bodies with those of in vivo mousedevelopment. Similar strategies could be devised for the dis-section of tissue-specific events involved in cell lineage com-mitment and understanding the development of systems otherthan the haematopoietic.

We gratefully acknowledge Professor J. M. Pina Cabral forguidance and Dr P. Vieira, Dr A. O’Garra, Dr G. Hardiman, Dr A.Vicari, Dr E. Ching and Dr J. Chiller for encouragement, Dr S.Dalrymple for help in the dissection of mouse embryos, D. Liggettand B. Johansson for excellent technical assistance, and Professor M.Teixeira da Silva, Professor M. de Sousa, Dr A. Cumano andProfessor A. Coutinho for advice. M. Jorge Guimarães is supportedby a grant from JNICT, Portugal (CIÊNCIA/BD/2685/93). The BaselInstitute for Immunology was founded and is supported by Hoffmann-La Roche Ltd, CH-4005 Basel, Switzerland. DNAX ResearchInstitute of Molecular and Cellular Biology, Incorporated, issupported by the Schering-Plough Corporation.

REFERENCES

Altschul, S. F., Gish, W., Miller, W., Myers, E. W. and Lipman, D. J.(1990). Basic local alignment search tool. J. Molec. Biol. 215, 403-410.

Altschul, S. F., Boguski, M. S., Gish, W. and Wootton, J. C. (1994). Issues insearching molecular sequence databases. Nature Genet. 6, 119-129.

Bairoch, A. and Boeckmann, B. (1994). The SWISS-PROT protein sequencedata bank: current status. Nucl. Acids Res. 22, 3578-3580.

Bennett, D. (1956). Developmental analysis of a mutation with pleiotropiceffects in the mouse. J. Morphol. 98, 199-233.

Benson, D. A., Boguski, M., Lipman, D. J. and Ostell, J. (1994). GenBank.Nucl. Acids Res. 22, 3441-3444.

Bloch, J. C., Sychrova, H., Souciet, J. L., Jund, R. and Chevallier, M. R.(1992). Determination of a specific region of the purine-cytosine permeaseinvolved in the recognition of its substrates. Molec. Microbiol. 6, 2989-2997.

Brotherton, T. W., Chui, D. H. K., Gauldie, J. and Patterson, M. (1979).Hemoglobin ontogeny during normal mouse fetal development. Proc. Natl.Acad. Sci. USA 76, 2853-2857.

Bruns, E. H., Kleeman, E., Mills, S. E., Bruns, D. E. and Herr, J. C. (1985).Immunochemical localization of vitamin D-dependent calcium-bindingprotein in mouse placenta and yolk sac. Anat. Rec. 213, 514-517.

Burland, V., Plunkett, G., Daniels, D.L., and Blattner, F. R. (1993). DNAsequence and analysis of 136 kilobases of the Escherichia coli genome:organizational symmetry around the origin of replication. Genomics 16, 551-561. GenBank Acc. no. L10328, orf o463.

Butor, C., Higa, H. H. and Varki, A. (1993). Structural, immunological, andbiosynthetic studies of a sialic acid-specific O-acetylesterase from rat liver. J.Biol. Chem. 268, 10207-10213.

Chothia, C. and Lesk, A. M. (1986). The relation between the divergence ofsequence and structure in proteins. EMBO J. 5, 823-826.

Claros, M. G. and von Heijne, G. (1994). TopPredII - an improved softwarefor membrane protein structure predictions. Comp. Applic. Biosci. 10, 685-686.

Cumano, A., Furlonger, C. and Paige, C. J. (1993). Differentiation andcharacterization of B-cell precursors detected in the yolk sac and embryobody of embryos beginning at the 10- to 12-somite stage. Proc. Natl. Acad.Sci. USA 90, 6429.

Danielsen, S., Kilstrup, M., Barilla, K., Jochimsen, B., and Neuhard, J.(1992). Characterization of the Escherichia coli codBA operon encodingcytosine permease and cytosine deaminase. Molec. Microbiol. 6, 1335-1344.Genbank Acc. no. X63656.

Diallinas, G., Gorfinkel, L., Arst, H. N., Cecchetto, G., and Scazzocchio, C.(1995). Genetic and molecular characterization of a gene encoding a widespecificity purine permease of Aspergillus nidulans reveals a novel family oftransporters conserved in prokaryotes and eukaryotes. J. Biol. Chem. 270,8610-8622. GenBank Acc. no. X79796.

Dieterlen-Lièvre, F., Beaupin, D. and Martin, C. (1979). Potencialities andmigrations of hematopoietic stem cells of yolk sac and intraembryonicorigins, studied in avian chimeras obtained by blastoderm recombination incell lineage, stem cells and cell determination, Inserm Symposium 10, 175.

Doetschman, T. C., Eistetter, H., Katz, M., Schmidt, W. and Kemler, R.


(1985). The in vitro development of blastocyst-derived embryonic stem celllines: Formation of visceral yolk sac, blood islands, and myocardium. J.Embryol. Exp. Morphol. 87, 27-45.

Evans, M. J. and Kaufman, M. H. (1981). Establishment in culture ofpluripotential cells from mouse embryos. Nature 292, 154-156.

Ford, A. M., Healy, L. H., Bennet, C. A., Navarro, E., Spooncer, E. andGreaves, M. F. (1971). Multilineage phenotypes of interleukin-3-dependentprogenitor cells. Blood 79, 1962-1971.

Ghim, S.Y., and Neuhard, J. (1994). The pyrimidine biosynthesis operon ofthe thermophile Bacillus caldolyticus includes genes for uracilphosphoribosyltransferase and uracil permease. J. Bacteriol. 176, 3698-3707. GenBank Acc. no. X76083.

Godin, I. E., Garcia-Porrero, J. A., Coutinho, A., Dieterlen-Lièvre, F. andMarcos, M. A. R. (1993). Para-aortic splanchnopleura from early mouseembryos contains B1a cell progenitors. Nature 364, 67-70.

Gorfinkiel, L., Diallinas, G., and Scazzocchio, C. (1993). Sequence andregulation of the uapA gene encoding a uric acid-xanthine permease in thefungus Aspergillus nidulans. J. Biol. Chem. 268, 23376-23381. GenBankAcc. no. X71807.

Gorin, M. B., Cooper, D. L., Eiferman, F., van de Rijn, P. and Tilghman, S.M. (1981). The evolution of alpha-fetoprotein and albumin: I. A comparisonthe primary amino-acid sequences of mammalian alpha-fetoprotein andalbumin. J. Biol. Chem. 256, 1954-1959.

Goswitz, V. C. and Brooker, R. J. (1995). Structural features of theuniporter/symporter/antiporter superfamily. Prot. Sci. 4, 534-537.

Gribskov, M., McLachlan, A. D. and Eisenberg, D. (1987). Profile analysis:detection of distantly related proteins. Proc. Natl. Acad. Sci. USA 84, 4355-4358.

Griffith, J. K., Baker, M. E., Rouch, D. A., Page, M. G. P., Skurray, R. A.,Paulsen, I. T., Chater, K. F., Baldwin, S. A. and Henderson, P. J. F.(1992). Membrane transport proteins: implications of sequence comparisons.Curr. Opin. Cell Biol. 4, 684-695.

Grimaldi, A. and Grimaldi, C. (1989). Small-scale λ DNA prep. In CurrentProtocols in Molecular Biology, supplement 5: Red Book Bulletin (Winter,1989). New York: John Wiley.

Guimarães, M. J., Lee, F., Zlotnik, A. and McClanahan, T. (1995).Differential display by PCR: novel findings and applications. Nucl. AcidsRes. 23, 1832-1833.

Hartmann, E., Rapoport, T. A. and Lodish, H. F. (1989). Predicting theorientation of eukaryotic membrane-spanning proteins. Proc. Natl. Acad.Sci. USA 86, 5786-5790.

Hediger, M. A. (1994). Structure, function and evolution of solute transportersin prokaryotes and eukaryotes. J. Exp. Biol. 196,15-49.

Henderson, P. J. (1993). The 12-transmembrane helix transporters. Curr.Opin. Cell Biol. 5, 708-721.

Hogan, B., Constantini, F. and Lacy, E. (1986). Manipulating the MouseEmbryo: A Laboratory Manual. Cold Spring Harbor, NY: Cold SpringHarbor Laboratory Press.

Hopp, T. P., Prickett, K. S., Price, U., Libby, R. T., March, C. J., Cerretti,P., Urdal, D. L., and Conlon, P. J. (1988). A short polypeptide markersequence useful for recombinant protein identification and purification.Biotechnol. (NY) 6, 1205-1210.

Jeung, E-B., Krisinger, J., Dann, J. L. and Leung, P. C. K. (1992).Molecular cloning of the full-length cDNA encoding the human calbindin-D9k. FEBS Lett. 307, 224-228.

Johanssson, B. and Wiles, M. V. (1995). Evidence for the involvement ofactivin A and BMP-4 in mammalian mesoderm and hematopoieticdevelopment. Mol. Cell. Biol. 15, 141-151.

Jones, D. T., Taylor, W. R. and Thornton, J. M. (1994). A model recognitionapproach to the prediction of all-helical membrane protein structure andtopology. Biochem. 33, 3038-3049.

Jones, R. J., Wagner, J. E., Celano, P., Zicha, M. S. and Sharkis, S. J.(1990). Separation of pluripotent haematopoietic stem cells from spleencolony-forming cells. Nature 347, 188-189.

Jund, R., Weber, E., and Chevallier, M. R. (1988). Primary structure of theuracil transport protein of Saccharomyces cerevisiae. Eur. J. Biochem. 15,417-424. GenBank Acc. no. X06830.

Keller, G., Kennedy, M., Papayannopoulou, T. and Wiles, M. V. (1993).Hematopoietic commitment during embryonic stem cell differentiation inculture. Mol. Cell. Biol. 13, 473-486.

Kitamura, T., Hayashida, K., Sakamaki, K., Yokota, T., Arai, K-i,Miyajima, A. (1991). Reconstitution of functional receptors for humangranulocyte/macrophage colony-stimulating factor (GM-CSF): Evidence

that the protein encoded by the AIC2B cDNA is a subunit of the murine GM-CSF receptor. Proc. Natl. Acad. Sci. USA 88, 5082.

Klein, P., Kanehisa, M. and DeLisi, C. (1985). The detection andclassification of membrane-spanning proteins. Biochim. Biophys. Acta 815,468-476.

Koonin, E. V., Bork, P. and Sander, C. (1994). Yeast chromosome III: newgene functions. EMBO J. 13, 493-503.

Kramer, R. (1994). Functional principles of solute transport systems: conceptsand perspectives. Biochim. Biophys. Acta 1185, 1-34.

Kyte, J. and Doolittle, R. F. (1982). A simple method for displaying thehydropathic character of a protein. J. Mol. Biol. 157, 105-132.

Liang, P. and Pardee, A. B. (1992). Differential display of eukaryoticmessenger RNA by means of the polymerase chain reaction. Science 257,967-971.

Lindenbaum, M. H. and Grosveld, F. (1990). An in vitro globin geneswitching model based on differentiated embryonic stem cells. Genes Dev. 4,2075.

Maloney, P. C. (1994). Bacterial transporters. Curr. Opin. Cell Biol. 6, 571-582.

Marger, M. D., and Saier, M. H. Jr. (1993). A major superfamily oftransmembrane facilitators that catalyse uniport, symport and antiport.Trends Biochem. Sci. 18, 13-20.

Martin, G. R. (1981). Isolation of a pluripotent cell line from early mouseembryos cultured in medium conditioned by teratocarcinoma stem cells.Proc. Natl. Acad. Sci. USA 78, 7634-7638.

Martin, Jr., D. W. (1985). Porphyrins and bile pigments. In Harper’s Reviewof Biochemistry 20th edition (ed. Martin, D. W., Mayes, P. A., Rodwell, V.W. and Granner, D. K.), pp. 331-347. Los Altos, California: Lange MedicalPublications.

McClanahan, T., Dalrymple, S., Barkett, M. and Lee, F. (1993).Hematopoietic growth factor receptor genes as markers of lineagecommitment during in vitro development of hematopoietic cells. Blood 81,2903-2915.

McCulloch, E. A. and Till, J. E. (1964). Proliferation of hemopoietic colonyforming cells transplanted into irradiated mice. Rad. Res. 22, 383.

Medvinsky, A. L., Samoylina, N. L., Muller, A. M. and Dzierzack, E. A.(1993). An early pre-liver intra-embryonic source of CFU-S in thedeveloping mouse. Nature 364, 64-67.

Moore, M. A. S. and Owen, J. J. T. (1967). Stem-cell migration in developingmyeloid and lymphoid systems. Lancet ii, 658-659.

Moore, M. A. S. and Metcalf, D. (1970). Ontogeny of the hematopoieticsystem: yolk sac origin of in vivo and in vitro colony forming cells in thedeveloping mouse embryo. Br. J. Haematol. 18, 279.

Mucenski, M. L., McLain, K., Kier, A. B., Swerdlow, S. H., Schreiner, C.M., Miller, T. A., Pietryga, D. W., Scott, Jr., W. J. and Potter, S. (1991).A functional c-myb gene is required for normal murine fetal hepatichematopoiesis. Cell 65, 677-689.

Muller, A. M., Medvinski, A., Strouboulis, J., Grosveld, F. and Dzierzack,E. (1994). Development of hematopoietic stem cell activity in the mouse.Immunity 1, 291-301.

Nakai, K. and Kanehisa, M. (1991). Expert system for predicting proteinlocalization sites in gram-negative bacteria. Proteins 11, 95-110.

Nakai, K. and Kanehisa, M. (1992). A knowledge base for predicting proteinlocalization sites in eukaryotic cells. Genomics 14, 897-911.

Nakano, T., Kodama, H. and Honjo, T. (1994). Generation oflymphohematopoietic cells from embryonic stem cells in culture. Science265, 1098-1101.

Nikaido, H., and Saier, M. H. Jr. (1992). Transport proteins in bacteria:common themes in their design. Science 258, 936-942.

Pearson, W. R. and Lipman, D. J. (1988). Improved tools for biologicalsequence comparison. Proc. Natl. Acad. Sci. USA 85, 2444-2448.

Persson, B. and Argos, P. (1994). Prediction of transmembrane segments in proteins utilising multiple sequence alignments. J. Mol. Biol. 237, 182-192.

Quinn, C.L., Stephenson, B.T., Switzer, R. L. (1991). Functionalorganization and nucleotide sequence of the Bacillus subtilis pyrimidinebiosynthetic operon. J. Biol. Chem. 266, 9113-9127. GenBank Acc. no.M59757.

Rai, R., Genbauffe, F. S., and Cooper, T. G. (1988). Structure andtranscription of the allantoate permease gene (DAL5) from Saccharomycescerevisiae. J. Bact. 170, 266-271. Genbank Acc. no. M24098.

Robertson, E., Bradley, A., Kuhen, M. and Evans, M. (1986). Germ-linetransmission of genes introduced into cultured pluripotential cells byretroviral vector. Nature 323, 445-8.


Rost, B., Sander, C. and Schneider, R. (1994). PHD--an automatic mailserver for protein secondary structure prediction. Comp. Applic. Biosci. 10,53-60.

Rost, B., Casadio, R., Fariselli, P. and Sander, C. (1995). Prediction ofhelical transmembrane segments at 95% accuracy. Protein Sci. 4, 521-533.

Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). In Molecular Cloning:A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold SpringHarbor Laboratory Press.

Saxild, H. H., Christensen, L., Nygaard, P., and Schou, S. (1995). The xpt-pbuX operon of Bacillus subtilis. Unpubl. Genbank Acc. no. X83878.

Schneider, E., Schweizer, J., Vertes, A., Rapoport, G., and Danchin, A.(1993). Bacillus subtilis genome project: cloning and sequencing of the 97 kbregion from 325 degrees to 333 degrees. Molec. Microbiol. 10, 371-384.Genbank Acc. no. X73124.

Schuler, G. D., Altschul, S. F. and Lipman, D. J. (1991). A workbench formultiple alignment construction and analysis. Proteins 9, 180-190.

Scott, E. W., Simon, M. C., Anastasi, J. and Singh, H. (1994). Requirementof transcription factor PU.1 in the development of multiple hematopoieticlineages. Science 265, 1573-1577.

Sipos, L. and von Heijne, G. (1993). Predicting the topology of eukaryoticmembrane proteins. Eur. J. Biochem. 213, 1333-1340.

Southern E. M. (1975). Detection of specific sequences among DNAfragments separated by gel electrophoresis. J. Mol. Biol. 98, 503.

Thompson, J. D., Higgins, D. G. and Gibson, T. J. (1994). Improvedsensitivity of profile searches through the use of sequence weights and gapexcision. Comp. Applic. Biosci. 10, 19-29.

Thompson, J. D., Higgins, D. G. and Gibson, T. J. (1994b). CLUSTAL W:improving the sensitivity of progressive multiple sequence alignmentthrough sequence weighting, position-specific gap penalties and weightmatrix choice. Nucl. Acids Res. 22, 4673-4680.

Uhl, G. R., and Hartig, P. R. (1992). Transporter explosion: update on uptake.Trends Pharm. Sci. 13, 421-425.

Veres, Z., Kim, I. Y., Scholz, T. D. and Stadtman, T. C. (1994).Selenophosphate synthetase. J. Biol. Chem. 269, 10597-10603.

von Heijne, G. (1992). Membrane protein structure prediction. Hydrophobicityanalysis and the positive-inside rule. J. Molec. Biol. 225, 487-494.

von Heijne, G. (1994). Membrane proteins: from sequence to structure. Ann.Rev. Biophys. Biomolec. Struc. 23, 167-192.

Weber, E., Rodriguez, C., Chevallier, M. R., and Jund, R. (1990). Thepurine-cytosine permease gene of Saccharomyces cerevisiae: primarystructure and deduced protein sequence of the FCY2 gene product. Molec.Microbiol. 4, 585-596. Genbank Acc. no. X51751.

Wiles, M. V. and Keller, G. (1991). Multiple hematopoietic lineages developfrom embryonic stem (ES) cells in culture. Development 111, 259.

Yoo, H. S., Cunningham, T. S., and Cooper, T. G. (1992). The allantoin anduracil permease gene sequences of Saccharomyces cerevisiae are nearlyidentical. Yeast 8, 997-1006. GenBank Acc. no. Z15121.

(Accepted 4 July 1995)

a new approach to the study of haematopoietic development ... · full cdna cloning, sequence and...

Documents