APPLICATION INFORMATION

IntroductionIn the last fifteen years, three devastating fungaldiseases of Theobroma cacao, the chocolate tree,have enveloped virtually all areas of cocoa produc-tion in Central and South America. One of the com-mon mechanisms for dealing with plant diseaseproblems, particularly in areas with minimalresources for application of fungicides, has been theuse of genetically resistant germplasm lines.Unfortunately, cocoa is a commodity that has anextended breeding of six years from seed to pod-bearing mature tree. Partially due to this long peri-od, the tree has been maintained in a state of wildcultivation for almost 400 years without a great dealof crop improvement characteristic of other moderncultivated crops. As a result, there is very littleinformation regarding the genetic diversity of theinternational cocoa germplasm collections.

DNA fingerprinting, a tool that has been widelyused in forensic science, is also useful in a varietyof applications with plants. It is used to identifygenetic diversity within breeding populations, topositively identify and differentiate accessions, cul-tivars, and species that might be difficult to charac-terize due to similar morphological characteristicsor indistinct traits, and to identify plants containinggenes of interest such as the confirmation of trans-formation events. A number of molecular tools andprocedures are being employed to establish DNAfingerprinting profiles and each of these procedureshas its strengths and weaknesses. Amplified restric-tion Fragment Length Polymorphic (AFLP) DNAanalysis, which is the focus of this report, is a use-ful procedure for DNA fingerprinting, especially

when very little information is known about thegenome of the plant under study.

AFLP DNA analysis of plants is a useful proce-dure for quickly assessing the genetic backgroundof selected lines or populations. AFLP techniquesproduce a much higher percentage of polymorphicbands per analysis than the earlier procedures of RFLP(restriction fragment length polymorphisms) or RAPDanalysis (random amplified polymorphisms). Forexample, in a comparative study of AFLP, RFLP, andRAPD analysis of inbred lines of soybean, Lin et al.(1996) reported that AFLP gave a number of discrimi-natory polymorphic bands or probes that was 8 to 10times higher than the other two procedures (see Table 1).

AFLP ConceptAFLP DNA analysis is based on a multistep process(Figure 1) with the following steps: DNA digestion,fragment ligation to adapters, preselective PCR*

amplification, selective PCR amplification, andfragment separation.

For reliability and consistency in AFLP analy-sis of DNA from plants, it is essential that each ofthe parameters of the AFLP process be understoodand followed. Inconsistencies in results betweenlaboratories are often due to small details involvedin the incomplete digestion of the DNA, poor quali-ty or quantity of the DNA, or the improper selectionof the selective PCR primers. Optimization of theseparameters is discussed below.

C E Q 2 0 0 0 X L

A-1910A

THE USE OF AFLP TECHNIQUES FORDNA FINGERPRINTING IN PLANTS

James A. Saunders1, Sue Mischke1, and Alaa A. Hemeida2

1Alternate Crops and Systems Lab, Plant Sciences Institute, Beltsville Agricultural Research Center, USDA/ARS, Beltsville, MD2Genetic Engineering & Biotechnology Research Institute (GEBRI), Sadat City, Minufiya University, Egypt

2

Materials and MethodsDNA IsolationDNA was isolated from fresh or frozen T. cacaoleaf tissue (50 - 100 mg or less) by placing the plantmaterial in a capped tube sandwiched between500 mg of garnet and two ceramic beads (Lysingmatrix, P/N 6540-401 from the FastDNA* kit,Qbiogene, Carlsbad, CA). Modified lysis buffer(400 µL) was added from either the DNeasy* PlantSystem (QIAGEN Inc., Valencia, CA), or from theD2 BioTechnologies DNA X-Tract* Plus IsolationKit (part number D2DNA02P). The plant tissue wascompletely macerated using a Fast Prep* 120(Q-Biogene) shaker/basher at oscillation speed of5.0 rpm for 40 seconds. Further DNA clean up fol-lowed manufacturer’s instructions for the DNA iso-lation protocol used. The PicoGreen* (MolecularProbes, Inc., Eugene, OR) DNA quantitation kitwas used to determine DNA content in the finalpreparation using fluorescence measurement from aFluoroskan Ascent microplate reader equipped with485/538 excitation/emission filter settings(Labsystems, Helsinki, Finland).

AFLP ProtocolThe AFLP protocol initially described by Vos et

al. (1995), was performed using components fromvarious commercial AFLP kits (e.g., AFLP preampprimer mix I and AFLP core reagent kit from AFLPAnalysis System I for plant genomes, LifeTechnologies, Rockville, MD; or AFLP amplifica-tion core kit, AFLP I preselective primer mix forregular genomes and AFLP EcoRI + MseI adaptorsfrom Applied Biosystems, Foster City, CA).Alternatively, adaptors and pre-selective primerscan be synthesized as described in the literature

(Vos et al., 1995; Lin et al., 1996; Waugh et al.,1997; Reineke and Karlovsky, 2000; and Saunderset al., 2001). The selective primers with theWellRED™ fluorescent dyes for the final PCRamplification in this procedure can be ordered fromResearch Genetics, Inc. (Huntsville, AL).

Digestion of Genomic DNA andLigation of Oligonucleotide Adapters

Digestion of genomic DNA by the restrictionenzymes EcoRI and MseI and ligation of oligonu-cleotide adapters compatible with these endonucle-ases as shown in Figure 1 were accomplished in asingle reaction mixture of 11 µL. Final concentra-tions of reagents were: 50 mM Tris-HCl (pH 7.5),10 mM MgCl2, 10 mM dithiothreitol, 1 mM ATP,25.5 µg/mL bovine serum albumin, 5 mM NaCl,45 µL/mL MseI (900 U/mL of New EnglandBiochemical 525CL), 45µL/mL of EcoRI (4500U/mL of NEB 101CL), 30 µL/mL T4 ligase (6.1 x105 Cohesive End Units/mL, or 6700 U/reaction, ofNEB 202CL). Each 11-µL reaction aliquotcontained approximately 50-200 ng of templateDNA (at a final concentration of 5-20 µg/mL) inaddition to EcoRI and MseI adaptor pairs, at con-centrations recommended by the manufacturer. Priorto each use, the adaptor pairs were preheated to95ºC for 5 minutes, then allowed to cool slowly,over a ten-minute period, to room temperature. Themixture was incubated overnight at room tempera-ture so that template DNA was completely digested,then each reaction was diluted 1:18 (11 µL +189 µL) with 15 mM Tris (pH 8.0), 0.1 mM EDTA.The minimum time needed for complete digestioncan be determined empirically by running a time-course experiment and visualizing the fragments onan agarose electrophoretic gel.

Table 1. Comparisons of RFLP, RAPD and AFLPAnalysis Number of Primers (Probes) % Number of Procedure Primers (Probes) with Polymorphic Bands/

Examined Polymorphisms Primer (Probe)

RFLP 209 104 50 0.5RAPD 245 85 35 0.7AFLP 64 60 94 5.6

Adapted from Lin et al., 1996.

3

Genomic double-stranded DNA 5´ GAATTC TTAA 3´ 3´ CTTAAG AATT 5´

Digest DNA into Fragments

EcoRI site AATTC T MseI site G AAT

EcoRI ligation adapter MseI ligation adapterGACTGCGTACC TA CTCAGGACTCATCCTGACGCATGG TTAA GAGTCCTGAGTAG

PCR preselective amplificationPre-amplification with 2 user-selected nucleotides Pre-amplificationwith EcoRI primer+A with MseI primer+C

5´- GACTGCGTACCAATTC GTTACTCAGGACTCATC-3´3´- CTGACGCATGGTTAAGT C AATGAGTCCTGAGTAG-5´

PCR selective amplification withSelective amplification 4 more user-selected nucleotides Selective amplificationEcoRI primer+ACT MseI primer+CAT

5´-GACTGCGTACCAATTC ACT -3´3´-CTGACGCATGGTTAAG TGA TAC AAT GAGTCCTGAGTAG-5´

Separation of DNA amplified fragmentsby capillary electrophoresis

A

ATGTTACTCAGGACTCATC

Figure 1. The AFLP Concept.

4

Preselective PCR AmplificationPreselective PCR amplification as depicted in

Figure 1, was performed using either of two com-mercial AFLP kits. For the Applied BiosystemsAFLP kit, the 20 µL reaction contained 4 µL of thediluted restricted/ligated DNA and 16 µL of a mix-ture with 1 µL of EcoRI+A and MseI+C AFLP pre-selective primers with 15 µL of AFLP core mix.The Life Technologies AFLP kit contained 50 µL ofthe following: 5 µL of diluted restricted-and-ligatedDNA and 45 µL of a cocktail made with 40 µL pre-amp primer mix, 5 µL 10X PCR buffer for AFLPand 0.2 Units Taq polymerase. The PCR programfor the preselective amplification was: 72ºC for 3minutes, followed by 20 repetitive cycles of 94ºCfor 20 seconds, 56ºC for 30 seconds, and 72ºC for 2minutes, with a final hold at 60ºC for 30 minutes.All samples were stored at 4ºC following amplifica-tion on a GeneAmp* 9700 PCR system (AppliedBiosystems). The amplified product was diluted20-fold using 15 mM Tris-HCl buffer (pH 8.0) con-taining 0.1 mM EDTA.

Selective PCR AmplificationFor selective PCR amplification of restriction

fragments, custom primers were prepared for recog-nition of EcoRI and MseI adopters. The EcoRIselective amplification primer had a sequence of5´-GACTGCGTACCAATTCA*NN. For recogni-tion of the MseI adaptor on the other side of the

DNA fragment, primers were synthesized with asequence of 5´-GATGAGTCCTGAGTAAC*NN(Figure 1). The A* and C* bases represent basesselected for primers in the initial preselectiveamplification and the N´s represent user-selectedbases amplified in the second selective PCR amplifi-cation. We routinely use the subset of the 64 primercombinations provided in commercial AFLP kitsmade by either Life Technologies or AppliedBiosystems as shown in Table 2. Fragments arevisualized by attaching a D4, D3 or D2 WellRED™

dye to the 5´ end of each EcoRI selective amplifi-cation primer with no modification made to theMseI primer. Note that not every primer pair inTable 2 was used since 3 to 7 pairs were usuallysufficient to distinguish varieties of plants.

The second, selective, PCR amplification reac-tion requires a DNA template from the preselectivePCR reaction, Taq polymerase, dNTPs, a dye-labeled primer as described above, and the standardbuffers and salts optimized for the reaction. ThePCR reaction mixture consists of 15 µL AFLP reac-tion buffer (Applied Biosystems AFLP kit), 1 µLEcoRI selective primer which is dye labeled andcontains 3 user-selected nucleotides (see Table 2),1 µL MseI selective primer without label that con-tains 3 user-selected nucleotides (at 5 µM to givefinal 0.25 µM final concentration), and finally 3 µLof diluted amplified product from preselectiveamplification.

Table 2. Primer-Pair Combinations

-ψψ = Dye M-CAA M-CAC M-CAG M-CAT M-CTA M-CTC M-CTG M-CTT

E-AAC-ψψ Primer Primer Primer Primer Primer Primer Primer PrimerD2-labeled Pair #1 Pair #2 Pair #3 Pair #4 Pair #5 Pair #6 Pair #7 Pair #8

E-AAG-ψψ Primer Primer Primer Primer Primer Primer Primer PrimerD3-labeled Pair #9 Pair #10 Pair #11 Pair #12 Pair #13 Pair #14 Pair #15 Pair #16

E-ACA-ψψ Primer Primer Primer Primer Primer Primer Primer PrimerD4-labeled Pair #17 Pair #18 Pair #19 Pair #20 Pair #21 Pair #22 Pair #23 Pair #24

E-ACC-ψψ Primer Primer Primer Primer Primer Primer Primer PrimerD2-labeled Pair #25 Pair #26 Pair #27 Pair #28 Pair #29 Pair #30 Pair #31 Pair #32

E-ACG-ψψ Primer Primer Primer Primer Primer Primer Primer PrimerD3-labeled Pair #33 Pair #34 Pair #35 Pair #36 Pair #37 Pair #38 Pair #39 Pair #40

E-ACT-ψψ Primer Primer Primer Primer Primer Primer Primer PrimerD4-labeled Pair #41 Pair #42 Pair #43 Pair #44 Pair #45 Pair #46 Pair #47 Pair #48

E-AGC-ψ Primer Primer Primer Primer Primer Primer Primer PrimerD2-labeled Pair #49 Pair #50 Pair #51 Pair #52 Pair #53 Pair #54 Pair #55 Pair #56

E-AGG-ψψ Primer Primer Primer Primer Primer Primer Primer PrimerD3-labeled Pair #57 Pair #58 Pair #59 Pair #60 Pair #61 Pair #62 Pair #63 Pair #64

5

The PCR program for the selected amplificationconsisted of an initial warm-up at 94ºC for two min-utes, one cycle of 94ºC for 20 seconds, 66ºC for30 seconds, 72ºC for 2 minutes, followed by tensubsequent cycles, each with a 1ºC lowering of theannealing temperature, followed by 25 cycles of94ºC for 20 seconds, 56ºC for 30 seconds and 72ºCfor two minutes and finally a hold at 60ºC for30 minutes before storing the samples at 4ºC.

When PCR primers for selective amplificationanneal to the restriction fragment, the addition ofthe three specific nucleotides at the 3´ ends (whichextend into the restriction fragment) results inrecognition and amplification of only a subset of theDNA. If eight different primers of each type (EcoRIand MseI) are synthesized, 64 combinations ofprimer pairs are possible. “E-NNN” is the primerfor recognition of the EcoRI side of the fragmentand “M-NNN is primer for the MseI side. Only theE-NNN primers are labeled with a fluorescent dye;the M-NNN primers are not. Individual dye colorsfor each primer can be specified.

Preparation of DNA AmplificationFragments for Separation by CapillaryElectrophoresis

To prepare DNA fragments for separation bycapillary electrophoresis, sample loading solutionwas prepared with a 400-base-pair (bp) DNA sizestandard labeled with WellRED™ dye D1 (approxi-mately 100:1; Beckman Coulter 608082 and608098). This solution was thoroughly mixed byvortexing for a minimum of two minutes. A 30-µLaliquot of this cocktail was added to 1.5 µL of theselective amplification product. Each well was over-laid with a drop of Sigma mineral oil (M5904) andsamples were analyzed in the CEQ™ 2000XL fromBeckman Coulter.

Results and DiscussionDNA fingerprinting in plants can be applied to anumber of applications and uses. The exampleshown here involves a study of genetic diversity inan important crop plant that has a special place inthe hearts and stomachs of many of us.

The United States Department of Agriculturehas begun a program of genetic characterization ofcocoa via DNA fingerprinting procedures. Our labo-ratory has been involved in DNA fingerprinting of anumber of crops using different molecular

procedures (Saunders et al., 1999; Degani et al.,2001; Matthews et al., 2001; Saunders et al., 2001).We have evaluated the use of AFLP DNA analysisas a potential method for germplasm identificationfor this project.

DNA IsolationTo utilize AFLP DNA analysis to its full potential,it is critical to successfully optimize several steps inthe process. One of the first and most important ofthese steps is the isolation of the DNA for thegenetic analysis. AFLP techniques require 100-500ng of relatively pure DNA. The quality of the DNAis important in view of the fact that the process isdependent upon the complete enzymatic digestionof the DNA via endonucleases. Because these frag-ments are subsequently used in PCR amplification,it is necessary to have complete digestion of theDNA to get reproducible patterns between replicatesamples. We have found that many plants have highlevels of phenolics which sometimes interfere withDNA isolation and, as luck would have it, cocoa isone of those problem crops. Although a number ofDNA isolation procedures and kits have been usedsuccessfully in our laboratory, we have found thatthe convenience, reliability, and cost effectivenessof two commercially available DNA isolation kitsto be particularly desirable. Each of those DNA iso-lation kits comes with detailed manufacturer’sinstructions that are cited in the materials and meth-ods. Further, we have found that the use of mortarsand pestles for DNA isolation raises the potentialfor cross contamination of samples during process-ing. As an alternative, we have used the Q-BiogeneModel 120 FastPrep system (web site www.qbio-gene.com) which we have renamed the“shaker/basher”) for homogenizing plant leaf sam-ples in self-contained microfuge tubes.

DNA DigestionIncomplete digestion of the DNA, either becausethe DNA is under-digested or because the purity ofthe DNA prevents complete digestion, yields highlyvariable banding patterns of little use in DNA pro-filing studies. We recommend an overnight diges-tion at room temperature to ensure completedigestion of DNA. This process can be monitoredeasily by agarose gel electrophoresis.

Several commercial plant AFLP kits are avail-able that yield very good results. Fortunately, most

6

Figure 3. Example of AFLP DNA fingerprints from some Cocoa samples using E-ACC primers labeled withD2-WellRED dye. Note: some peaks, as indicated by green, black, and red arrows, are present in some samplesbut not in others.

Figure 2. AFLP DNA fingerprint of T. cacao TSA654 and primer pair E-ACT/M-CAT labeled with theD4-WellRED dye.

7

manufacturers of these kits have followed a com-mon protocol for the AFLP process which involvesthe digestion of genomic DNA by two commonlyavailable endonucleases: EcoRI and MseI restrictionenzymes. MseI is a 4-bp frequent cutting endonucle-ase which is typically mixed together with the lessfrequent 6-bp cutting endonuclease known as EcoRI(see Figure 1 for restriction cut site details). The useof these two restriction enzymes typically digestsplant genomic DNA into fragments with a sizerange of 50-2000 bp.

DNA Ligation and PCR AmplificationThe crux of the AFLP process is the selectiveamplification of portions of the genomic DNAusing PCR primers ligated onto the endonucleasecut sites of the DNA. Since the sequence of therestriction sites are known, additional selectivity canbe gained by adding specific nucleotides to the PCRprimer sequence. The primers are designed toamplify only DNA fragments with an EcoRI restric-tion site on the 5´ end of the double-stranded DNAand an MseI restriction site on the 3´ end. By con-vention, the addition of an adenine (A) to the PCRprimer increases the selectivity of the EcoRI siteand the addition of a cytosine (C) to the PCRprimer increases the selectivity of the MseI site dur-ing preselective PCR amplification. Once the prese-lective PCR amplification is accomplished, aliquotsof the preselective amplification process can beused for a second more selective amplificationusing a variety of 64 different combinations of addi-tional user selected PCR primers provided in com-mercially available kits as shown in Table 2. Forexample in Figure 1, the EcoRI primer is extendedby two additional base pairs (CT) and the MseI siteis also is extended by two base pairs (AT). Thestrength of this technique lies in the fact that multi-ple primers can be run from the preselective ampli-fication mixture to determine if they can distinguishbetween unknown samples. In our experience, wecan typically detect differences in AFLP DNA frag-ments patterns when more than 3 to 7 primer pairsare used. Note that there are total of 256 potentialPCR primer combinations that are possible by vary-ing only the last two base pairs of each restrictionsite, but somebody has used the good sense to limitcommercially available primers to 64 unique combi-nations (Table 2).

DNA SeparationAlthough the fragmented DNA from AFLP proto-cols covers a fairly broad range of sizes, a one-base-pair separation of DNA fragments is oftennecessary to distinguish between samples. We canachieve this degree of separation reliably on DNAfragments that fall within the general range of 60 to350 base pairs. The PCR parameters are usuallyoptimized so that larger fragments are notamplified. Capillary electrophoresis systems havethe advantage of low operator input, automatedsample injection and processing, and one-base-pairseparation of DNA fragments within a moderateworking range of 60 to 350 bp. The CEQ™ 2000XLDNA fragment analyzer from Beckman Coulteroffers the convenience of the capillary electrophore-sis systems along with reasonably high-throughputoperations by processing eight samples at once.

These types of DNA analyzers separate DNAprofiles extracted from each plant into specific frag-ments that can be evaluated on an electrophero-gram. The electropherogram (Fig. 2) showsstandard DNA fragments (in red) that are injectedinto the same separation run as the samples (peaksin blue). The sizes of various sample DNAfragments are determined and the position of theindividual peaks that are detected for each samplerepresent the DNA fingerprint that is unique to thattype of plant. The DNA fingerprints (Fig. 3) notonly identify one plant from another, they also helpto establish the genetic relationship between plantsso that individuals that are closely related are linkedtogether and plants that are more distantly relatedare identified.

AFLP analysis of Theobroma cacao with a sin-gle PCR primer set based on the EcoRI and theMseI cut site plus three selective nucleotides fromeach end of the DNA template. Separation of indi-vidual peaks is achieved at the one-base-pair resolu-tion within the range of 50 to 350 bp. In AFLPanalysis, each peak is either present or it is absentand the output text allows for automatic scoringof the AFLP fingerprints using a bioinformaticstool such as AFLP Dominant Scoring softwareavailable from Beckman Coulter’s web site(http://www.beckmancoulter.com/Beckman/biorsrch/prodinfo/autodna/aflpsoftinst.asp). An example of aportion of data output from this software with “1”representing the presence and “0” the absence of apeak is illustrated in Table 3.

In view of this, minimal threshold levels forpeak analysis should be set high enough to clearlydistinguish the presence of a true peak from irregu-lar background noise.

8

ConclusionThe use of AFLP DNA analysis as a molecularmarker to determine the genetic diversity of a plantpopulation is a reliable procedure when coupledwith a separation system capable of resolving DNAfragments of 50 to 350 bp with one-base-pair reso-lution. High-throughput sample processing can beachieved with the multi-channel CEQ 2000XL cap-illary electrophoresis system by virtue of its abilityto process eight samples at a time with a 30- to 40-minute cycle time and unattended sample loading

between runs. AFLP DNA analysis can also be usedin a variety of other DNA fingerprinting and geneticmapping procedures to provide markers for traits ofinterest in plants when very little preliminaryknowledge of gene sequence is available. This typeof information is especially important in the geneticanalysis of tree crops due to the long lead timesrequired to determine actual field performance ofbreeding results.

Table 3.An Example of a Portion of Data Output fromAFLP Dominant Scoring Software

Marker Size A01 B01 C01 D01 E01 F01 G01 H01 A02 B02 C02 D02 E02 F02 F0159 0 0 0 0 1 0 1 1 1 1 1 0 0 1 162 1 1 1 0 1 1 1 0 1 1 0 1 0 1 184 1 1 1 0 1 0 1 0 1 1 0 1 1 1 187 0 1 0 1 0 0 0 0 1 0 1 0 0 0 098 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0104 0 0 1 0 0 0 0 1 1 0 1 0 0 0 0118 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0134 0 0 0 0 1 0 1 0 1 1 0 0 0 1 1136 1 1 1 0 1 1 1 1 1 1 1 1 0 1 1138 0 1 1 1 0 0 0 0 1 0 0 0 1 0 0140 1 1 1 0 0 1 1 1 1 1 1 1 0 1 1148 1 1 0 0 0 1 1 0 0 1 0 1 0 0 0173 0 0 0 0 1 1 0 1 1 1 1 0 0 0 1178 0 1 1 1 0 0 0 0 0 0 1 0 0 0 0188 0 1 1 1 0 0 0 0 1 0 1 0 0 0 0211 0 0 1 0 0 1 0 1 1 0 1 0 1 1 1215 1 0 1 0 1 1 1 1 0 0 0 1 1 1 1218 0 1 1 1 0 0 0 0 1 0 0 0 0 0 0226 0 0 0 0 1 1 0 0 0 0 0 0 1 0 0228 1 0 0 0 0 0 1 0 0 0 0 1 1 0 0258 0 1 1 1 0 0 0 0 1 0 1 0 0 0 0285 0 0 0 0 1 0 0 1 0 0 0 0 1 0 1287 0 0 1 0 0 1 1 1 1 0 0 0 0 1 1298 0 1 1 1 0 0 0 0 1 0 1 0 0 0 0305 0 0 0 0 1 1 0 1 1 0 1 0 1 0 0318 0 1 1 1 0 1 0 0 1 0 1 0 0 0 0326 0 0 1 0 0 0 0 1 1 0 1 0 1 0 1331 1 1 0 0 1 0 0 0 0 1 0 1 1 1 0378 0 1 1 1 0 1 0 0 1 0 1 0 0 0 0

Developing innovative solutions in genetic analysis, drug discovery, and instrument systems.

Beckman Coulter, Inc.• 4300 N.Harbor Boulevard,Box 3100 • Fullerton,California 92834-3100Sales:1-800-742-2345 • Service:1-800-551-1150 • Telex:678413 • Fax:1-800-643-4366 • www.beckmancoulter.com

Worldwide Bioresearch Division Offices:Australia (61) 2 9844-6000 Canada (905) 819-1234 China (86) 10 6515 6028 Eastern Europe, Middle East, Africa (41) 22 994 07 07 France 01 49 90 90 00 Germany (89) 35870-0 Hong Kong (852) 2814 7431 / 2814 0481 Italy 02-953921 Japan 03-5404-8359 Mexico 525-559-16-35 Netherlands 0297-230630 Singapore (65) 339 3633 South Africa (27) 11-805-2014/5 Spain (34) 91 3836080Sweden 08-564 85 900 Switzerland 0800 850 810 Taiwan (886) 2 2378 3456 Turkey 90 216 309 1900 U.K. 01494 441181 U.S.A. 1-800-742-2345

B2001-4594 © 2001 Beckman Coulter, Inc.

* The PCR process is covered by patents owned by Roche Molecular Systems, Inc., and F. Hoffmann-La Roche, Ltd. FastDNAis a trademark of Qbiogene, Inc. DNeasy is a registered trademark of QIAGEN Corp. DNA X-Tract is a registered trademarkof D2 BioTechnologies, Inc. FastPrep is a registered trademark of Qbiogene, Inc. PicoGreen is a registered trademark ofMolecular Probes, Inc. GeneAmp is a registered trademark of Roche Molecular Systems, Inc. HitKit is a trademark andCellomics and ArrayScan are registered trademarks of Cellomics, Inc. Microsoft is a registered trademark of MicrosoftCorporation. All other trademarks are the property of their respective owners.

References1. Lin, J. J., Kuo, J., Ma, J., Saunders, J. A.,

Beard, H. S., MacDonald, M. H., Kenworthy,W., Ude G. N., Matthews, B. F. Identificationof molecular markers in soybean comparingRFLP, RAPD and AFLP DNA mapping tech-niques. Plant Molecular Biology Reporter14(2): 156-169 (1996)

2. Saunders, J. A., Pedroni, M. J., Daughtry, C. S.DNA Fingerprinting of Marijuana by the AFLPTechnique. Focus 20: 10-11 (1999)

3. Degani, C., Rowland, L. J., Saunders, J. A.,Hokanson, S. C., Ogden, E. L., Golan-Goldhirsh, A., Galletta, G. J., A comparison ofgenetic relationship measures in strawberry(Fragaria ananassa Duch.) based on AFLP’s,RAPD’s, and pedigree data. Euphytica 117:1-12 (2001)

4. Saunders, J. A., Pedroni, M. J., Penrose, L.,Fist, A.J. AFLP DNA analysis of opium Poppy.Crop Science 41: number 5, (Sept. 2001)

5. Matthews, B. F., Devine, T. E., Weisemann, J.M., Beard, H. S., Lewers, K. S., MacDonald,M. H., Park, Y. B., Maiti, R., Lin, J. J., Kuo, J.,Pedroni, M. J., Cregan, P. B., and Saunders,J. A. Incorporation of sequenced cDNA andgenomic markers into the Soybean genetic map.Crop Science 41: 516-521 (2001)

6. Vos, P., Hogers, R., Bleeker, M., Reijans, M.,van de Lee, T., Hornes, M., Frijters, A., Pot, J.,Peleman, J., Kulper, M., Zabeau, M. AFLP: anew technique for DNA fingerprinting. NucleicAcids Research 23:(21), 4407-4414, (1995).

7. Waugh, R., Bonar, N., Baird, E., Thomas, B.,Graner, A., Hayes, P., Powell, W. Homology ofAFLP products in three mapping populations ofbarley. Mol. Gen. Genet. 255: 311-321 (1997)

8. Reineke, A., Karlovsky, P. Simplified AFLPprotocol: Replacement of primer labeling by theincorporation of µ-labeled nucleotides duringPCR. Biotechniques 28: 622-623 (2000)

For Research Use Only. Not for use in diagnostic procedures.

© 2014 AB SCIEX. SCIEX is part of AB Sciex. The trademarks mentioned herein are the property of AB Sciex Pte. Ltd. or their respective owners. AB SCIEX™ is being used under license.

AB SCIEX Headquarters500 Old Connecticut Path | Framingham, MA 01701 USAPhone 508-383-7700www.absciex.com

View SCIEX products at www.sciex.comFind your local offi ce at www.sciex.com/offi ces

www.sciex.com/ce