8.9.12 rancho santa fe review

Providing The Ranch with Three Decades of Quality Journalism

Our e-mail addresses are: Advertising: [email protected] | Editorial: [email protected] | Web: www.SDRanchCoastNews.com

Volume 31 Number 47 Aug. 9, 2012

LOCALREAL ESTATE

LISTINGSPHOTO PAGES & FEATURES

SECTION B

National Award-Winning

Newspaper

BoxholderRancho Santa Fe

CA 92067ECRWSS

PRESORTEDSTANDARD

U.S. POSTAGE PAIDSAN DIEGO, CA

PERMIT 1980

BY JOE TASHAn increase in residen-

tial burglaries in Rancho Santa Fe this year has prompted a warning from officials for residents to lock their doors and windows, turn on their burglar alarms and call law enforcement if they see suspicious people or vehicles in their neigh-borhood.

RSF Patrol Chief Matt Wellhouser discussed the needed precautions at the Aug. 2 RSF Association board meeting, when he up-

dated directors about the rise in burglaries.

From Jan. 1 through July 31, 2012, 24 residential burglaries were reported in the Covenant. The San Di-ego Sheriff’s Department, which includes an area larg-er than the Covenant in its recording of Rancho Santa Fe crimes, has logged 26 burglaries during that peri-od, Wellhouser said. During the same period in 2011, 13 residential burglaries were

BY KELLY WHEELERCity News Service

Two men accused of stealing three expensive cars over the past year — includ-ing a Ford GT in Rancho Santa Fe worth at least $250,000 — pleaded not guilty Aug. 2 to 11 felony charges, including auto theft, grand theft and own-ing or operating a chop shop.

George William Moore, 48, and Gabriel Castano, 30, each were held without bail because they were on proba-tion at the time they were charged with the current of-fenses.

Castano faces nine years and eight months in prison if convicted. Moore — who has a 1984 convic-tion for burglary — faces 13 years and eight months if convicted, Deputy District Attorney John Philpott said.

The defendants are ac-cused of stealing the 2005 Ford GT from a home in Rancho Santa Fe and two Porsches from other resi-dences in the past six months to a year, the prose-cutor said. Police said the Ford GT disappeared over a three-week period in June

BY JOE TASHNew landscaping, creation

of a chef’s garden and enlarge-ment of an outdoor Jacuzzi are among proposed changes by the new owners of The Inn at Rancho Santa Fe which were approved by the Rancho Santa Fe Association at a board meet-ing on Thursday, Aug. 2.

Representatives of JMI Re-

alty, which purchased the 90-year-old hotel in April for $28 million, attended Thurs-day’s Association board meet-ing to outline the first phase of a $12 million renovation proj-ect. After listening to a presen-tation by JMI Senior Vice Presi-dent Jim Chatfield, the Associ-ation board unanimously gave conceptual approval to a list of

proposed upgrades.Final approval for the

work must still be granted by the Association Art Jury, which is working with The Inn’s new owners. Some interior work, such as renovations to most of the property’s 107 guest rooms and alterations to the lobby, bar and restaurant, does not require Association approval,

said an Association staff report.JMI is also working with

the Art Jury to finalize plans for changes to the historic ho-tel’s main entryway, and a pro-posed cover over an outdoor

RSF Patrol chief urges residents to take safety precautions

Two plead not guilty in theft of expensive Ford GT

Inn upgrades receive conceptual approval

Ice Cream Social at RSF Library

Above: Jasmine Luck, Lucy Rick-erson, Reiko Inouye and Tessora Bustillos make root beer floats during an Ice Cream Social on Aug. 3 at the Rancho Santa Fe Li-brary. The event marked the com-pletion of the 2012 Summer Reading Program. See page 16 for more.

Right: Ethan Dirkes and Charlie Mossy enjoy the event.

PHOTOS/JON CLARK

The Inn at Rancho Santa Fe

• Crime prevention discussed at RSF Association meeting

See CRIME, page 26

See INN, page 26

See THEFT, page 26

CCA antenna facility plan put on hold

The San Dieguito Union High School District has put on hold plans to in-stall a wireless communica-tion facility atop a building at Canyon Crest Academy in Carmel Valley, according to district superintendent Ken Noah.

The issue has been re-moved from the agenda of the board’s Aug. 16 meet-ing, so it will not be dis-cussed at that meeting as previously reported. Noah said the topic has been ta-bled indefinitely at this time.

However, when the is-sue is placed on a future agenda it will be for the board to decide whether it wants to establish a policy against the placement of any antenna facilities at a school site. If they decide to allow the placement of antenna facilities at school sites the district would dis-cuss and establish rules and regulations for that process, Noah said. — Staff report

2 August 9, 2012 Rancho Santa Fe Review

858.755.2280858.755.2280Shawn Rodger

Shawn HethcockShawn HethcockShawn RodgerShawnHethcock.com • ShawnRodger.com

SPECIALIZING IN EXQUISITE RANCH & COASTAL PROPERTIES

SOLD BEFORE HITTING THE OPEN MARKET!EAST DEL MAR – 3BR/4BA - $947,000

SOLD – REPRESENTED BUYER – SUNSET CLIFFSPOINT LOMA – 5BR/3.5BA - $1,075,000

SOLD – REPRESENTED BUYER – FAIRBANKS RANCHRANCHO SANTA FE – 5BR/4.5BA - $2,695,000

SOLD IN 3 DAYS! - SEA VILLAGE CONDODEL MAR – 2BR/2BA - $675,000

The Art Jury’s greatest challenge is to re-view and approve projects while ensuring that the overall look of the Ranch will still be characterized by trees, shrubs and rural vistas and not be dominated by views of homes or have homes looming over their neighbors. Our duty to this challenge is spelled out in the Protective Covenant’s Pre-amble which speaks about “preserving, con-tinuing and maintaining this character of community and rare landscape features and of upholding the quality of all future archi-tecture and improvements; and of restrict-ing the use, height and bulk of buildings;” (emphasis added). The framers of the Cove-nant were far sighted in 1928 to realize that restrictions on “height and bulk” were nec-essary. Since 1928 the size of a new home within the Covenant has grown significant-ly so the need for the Art Jury’s careful re-view of “height and bulk” is more important than ever.

The Art Jury’s restrictions on “height and bulk” keep the scale of buildings in pro-portion to the natural features of the com-munity: the trees, shrubs, groves, hills and canyons which are the source of Rancho Santa Fe’s character. Restricting the height of a home reduces its prominence and also al-lows it to be visually screened by landscap-ing within a reasonable period of time. Large bulky buildings require excessive grad-ing which can obliterate the natural features of the site.

A building’s “bulk” or mass, is assessed when viewed as a whole. Two buildings of the same square footage can have very dif-ferent apparent masses. Consider two sepa-rate building designs, the first building de-sign proposes a uniformly rectangular struc-

ture built along one long axis, the second building design consists of a home with var-ious building wings at different angles. All things being equal, the first structure will seem much more massive – the entire build-ing will be visible when viewed as a whole. The second building with its various wings can never be completely seen from any one perspective. Thus the view from the street will expose only part of the building, the view from one of the neighbors will reveal only another portion, and so on. The overall “bulk” of the building has been broken up. This type of building is normally less promi-nent when seen from various locations and can be adapted to site topography and land-scaping.

As illustrated in the above example, re-ducing the “bulk” of a building does not necessarily always mean that the square footage must be reduced. A building’s mass may be broken up in various ways: the structure may consist of different wings, the roof heights can be varied, the floor levels can be stepped to coincide with the topogra-phy, and projections can be incorporated into building walls. Breaking up the mass leads to a more interesting design and often creates a more appealing floor plan as well as interesting courtyards around the house. Generally speaking, however, a change in square footage will affect the bulk.

The Art Jury’s review of height and bulk leads to the construction of less prominent homes that blend with the Ranch’s “rare landscape features” mentioned in the Cove-nant. These less conspicuous homes main-tain the character of the community while still allowing for a diversity of design and in-dividual expression. — RSF Art Jury

Art Jury Corner

Height and Bulk A mountain lion was sighted on Aug. 6 at 2:45 p.m. in the backyard of home in the 15300 block of El Camino Real in Rancho Santa Fe, RSF Patrol Chief Matt Wellhouser said. The animal was not aggressive and was traveling north through the unfenced prop-erty. Fish and Game was notified, Well-houser said.

The Ranch is home to many species of animals, including coyotes, bobcat and mountain lions. These animals are native to the area and can be attracted around homes by leaving pet food out, the presence of small pets, etc. State Fish and Game warn people to not leave food or pets outside and keep a close eye on small children — espe-cially during early morning or late afternoon times. In addition, do not jog, bike or hike alone; do not approach a coyote, bobcat, or mountain lion.

Sometimes the attraction of smaller wild animals attracts the bigger animals, ac-cording to Wellhouser.

These animals are most active at dawn, dusk and at night.

Often deer are attracted to the area be-cause of food sources, same with opossums, raccoons, and other prey. These animals are often prey for larger animals.

In the past, neighboring communities have also had sightings, Wellhouser said. Mountain lions usually avoid humans; they are quiet, solitary and elusive. They can have a range of 200 miles.

If you see a mountain lion or experi-ence an attack, contact the numbers below. Fish and game would like to know of sight-ings to track the activity, Wellhouser said:

•San Diego County Wildlife Services 1-800-486-0010

•California Fish and Game- San Diego office 858-467-4201

•http://www.keepmewild.org/•http://www.co.san-diego.ca.us/awm/

wildlife_services.html

Mountain lion spotted in RSF

A youth fencing coach already accused of having a sexual relationship with a teenage female student was charged Aug. 2 with victim-izing a different girl 10 years ago.

Vijay Prasad, 51, was the after-school fencing coach at La Jolla Country Day School and also coached fencing through the recreation department at the University of California at San Diego. He was taken

into custody when prosecu-tor Elizabeth McClutchey told a judge of the new charges.

Prasad’s bail was raised from $200,000 to $300,000 on his old case, and bail was set at $150,000 on the new case.

McClutchey said the new charges against Prasad involve alleged illegal sex acts with an underage fe-male in 2002.

Prasad was charged in

February with 13 counts, including sodomy of a per-son under 16 by a person over 21 and committing a lewd act on a child 14 or 15 years of age. Those crimes allegedly occurred between 2005 and 2007, Mc-Clutchey said.

The defendant faces seven years and eight months in prison if con-victed, according to the prosecutor.

New charges brought against fencing coach

Rancho Santa Fe Review August 9, 2012 3

Taylor Fritz, a graduate of R. Roger Rowe School with highest academic honors, recently won the Na-tional Clay Court Doubles Championships in Fort Lauderdale, Fla., with partner Billy Rowe from Coro-nado. The National Clay Court is one of the top three national tournaments of the year. The duo, who were seeded 12th, swept the field of 64 teams. In the semi-finals they beat the #2-seeded team of Alex Phillips and Abhin Sharma, both from Georgia, 6-3, 6-3. In the finals they beat the #1-seeded team of Anudeep Kodall from North Carolina and Johnathan Small from Michigan, 7-6, 4-6, 6-3.

In singles, Taylor lost in the quarterfinals to the eventual winner of the tournament, Evan Zhu from Maryland.

This week Taylor is competing in San Antonio, Texas, in the National Hardcourt Championships where he is seeded third in singles and first in doubles. He is currently ranked #1 in Southern California and #7 in the nation.

Taylor, who recently received the prestigious Bob Carrothers Sportsmanship Award (see www.BarnesTennisCenter.com), will be attending Torrey Pines High School in Sep-tember as a freshman. He will be competing for a top spot on the boys varsity tennis team.

Taylor Fritz

RSF’s Taylor Fritz seeks back-to-back gold balls

The Rancho Santa Fe School District and Education Foundation will host the an-nual Newcomers’ Welcome BBQ and Orientation on Fri-day, Aug. 24, to introduce all new families to the R. Roger Rowe School. The event will be held at the RSF School, Performing Arts Center as follows: 10:30 a.m. -12:30 p.m. (10:30 welcome, 11 a.m. tour, 11:45 a.m. BBQ).

This is an ideal opportunity for new-comers to walk the wonderful campus, get an overview of the school, learn about the school and its history and, most important-ly, meet the school administration and staff along with making new friends. The deli-cious BBQ is a perfect way to finish the event and top off a great summer.

Parents will be welcomed by the district superintendent and introduced to the teach-ing staff. Parents will be provided informa-

tion about specific Foundation programs for the upcoming year, understand the benefits of contributing early, and encouraged to participate in activities throughout the year. On the orientation tour, new students can become familiar with the school campus be-fore the first day of school.

A staff member from the Rancho Santa Fe Community Center will direct games and activities for the kids. This year’s event is sponsored by Wells Fargo, The Private Bank. Thanks also to the Education Foundation volunteers and the Ranch Hands, a group of parent and child volunteers that will con-duct campus tours and provide dessert and drinks. Newcomers’ events are organized by parent volunteers and made possible by do-nations through the RSF Education Founda-tion.

Questions? Contact: Daniele Pollin (Newcomers chair) at [email protected], 619-871-5267.

Save the date: RSF School Newcomers’ ‘Welcome BBQ and Orientation’

TPHS football program’s 17th Annual Summer Dinner/Auction and Golf Tournament is Aug. 20Torrey Pines High School’s football program will host its

17th Annual Summer Dinner/Auction and Golf Tournament on Monday, Aug. 20, at Fairbanks Ranch Country Club.

This year’s event will feature Paul Rudy, of KUSI TV and the award-winning Prep Pigskin Report, as the live auction-eer and Jeff Detrow from the “Jeff n Jer Radio Program” as the Master of Ceremonies. Head football coach Scott Ashby and his coaching staff will be on hand to give attendees a peek into the upcoming season, one for which the Falcons

have high hopes with a balanced roster of returning seniors and rising juniors.

For those interested in playing golf, the tournament will be a scramble format with a shotgun start at noon and registration opening at 11 a.m.

The annual event represents the Falcons’ most impor-tant fundraising event each year and helps the program to pay for the costs of running a high school football program. At a public high school, the program is entirely funded by

voluntary donations from its families and the generosity of sponsors and donors in the community. So, whether you are interested in playing golf, being a sponsor, or just attend-ing the evening’s festivities, all Torrey Pines Falcon Football supporters are invited.

To register, please visit the program’s website at www.tphsfootball.com, or contact Chris Jaczko at [email protected] for further information.

[email protected]

DRE# CA 00804683

My Expertise… Your Peace of Mind

www.SherryShriver.com

Visit www.forsaleranchosantafe.com to get weekly updates on community events!

Living a Mediterranean Lifestyle!

FAIRBANKS RANCH - This beautifully designed 5BR estate exudes warmth, romance, style and privacy! The fi rst fl oor master suite, wonderful in scale, opens to its outstanding backyard terrace and pool. Incredible tropical grounds surrounds this amazing home, built for fun, entertaining and relaxation! Two fabulous pools and spas with a splashing waterside takes you to the lower property and guest house (over 2000 sq.ft), including an 8-seat theatre. So many wonderful amenities, fabulous scale, the perfect fl oor plan gives an intimacy to its interior set on a rare lot of 1.9 acres!

$3,475,000


Wells Fargo Home Mortgage is a division of Wells Fargo Bank, N.A. © 2012 Wells Fargo Bank, N.A. All rights reserved. NMLSR ID 399801. AS944687 3/12-6/12

Great newsRichard Faust has joined the Wells Fargo Home Mortgage team

I am pleased to announce that I have joined the top-notch team of local Wells Fargo Home Mortgageprofessionals. With a local market perspective, I willdeliver home financing strategies that can leverageyour currently held assets and complement yourwealth management goals.

I provide a full-service approach to your transactions,and will help simplify complex financial arrangements.You’ll also enjoy convenient access to Wells Fargo’swide range of financial services and the peace of mindthat comes from working with a longstanding andrespected bank.

Contact me today.

Richard FaustHome Mortgage Consultant245 Santa HelenaSolana Beach, CA 92075Phone: [email protected] ID 633047

I am able to providemortgage financing inall 50 states.

RSF youth qualifies for national equestrian eventThe American Morgan Horse Associa-

tion (AMHA) recently announced that Emily Lents of Rancho Santa Fe has been awarded with the AMHA Saddle Seat Silver Medal Award for her outstanding performance at the Far West Regional Horse Show. This highly competitive event was held June 20-23 in Redmond, Wash.

Lents, 17, qualified to compete for the Gold Medal at the 2012 Grand National & World Championship Morgan Horse Show to be held in Oklahoma City, Oct. 6-13. This is the second silver medal Lents has earned this show season; she won the Western Seat Medal at the Diamond Jubilee Show in May.

Excellence in equitation is valued by AMHA and is recognized through its AMHA Medal classes, held at local and regional Morgan and all-breed shows. All junior rid-ers who are AMHA members are invited to compete on a Morgan. AMHA Silver Medals are awarded in each of the six seats: Saddle,

Western, Hunter on the Flat, Hunter Over Fences, Reining, and Dressage. Those who place first or second in an AMHA Silver Medal class are qualified to participate in the 2012 Gold Medal Finals at the Grand Na-tional. The highest AMHA equitation honor, the Gold Medal, is awarded in each of the six seats.

Founded in 1909, the American Morgan Horse Association is a nonprofit organiza-tion serving more than 50,000 Morgan horse owners, breeders, exhibitors, and en-thusiasts throughout the United States. AMHA serves as a parent organization to more than 90 recognized Morgan horse clubs and national service organizations.

For more information on America’s original horse breed, contact the American Morgan Horse Association, Inc., 4066 Shel-burne Road, Suite 5, Shelburne, Vermont 05482; (802) 985-4944; www.morganhorse.com. Emily Lents, on Highover All The Rage, and her parents Dianne and Murphy Lents.


RSF resident’s ‘The Giving Tree Movement’ a ‘parent, youth and community engagement initiative’

From left, Luisa Csathy, Tami Walsh and Susie Walton

See GIVING, Page 26

BY KELLEY CARLSONLocal nonprofit The

Giving Tree Movement has established its roots, and is now ready to grow.

Founded by Rancho Santa Fe resident Luisa Csathy, the organization is a “community-centric out-reach program that empow-ers parents, educators and thought leaders to rise up, support and learn from one another in order to guide our future generation to live truly authentic and purpose-filled lives.” It aims to pro-vide a platform where par-ents and experts of various vocations come together to share ideas and gain new perspectives on how to raise children in this complex, fast-paced world through lectures and moderated par-ent focus groups, while also training youths to be men-tors to others and promote core values.

Giving Tree Movement just recently held its first few major events, but the idea for it began to blossom about a year ago, as Csathy — who has two children — reflected on pressures that face families, brought to her attention through several lo-cal events.

One of those occasions was a local showing of the documentary “Race to No-where,” which features tales of students pushed to edge, instructors who are burned out, and parents in pursuit of what’s best for their chil-dren.

“It left a lot of parents feeling unraveled,” Csathy said.

Another motivator was a book signing and ques-tion-and-answer session with Madeline Levine, au-thor of “The Price of Privi-lege.” The book’s main

theme is that teens from wealthy families have more intense psychological prob-lems than expected.

“I came home feeling like we had gotten it all wrong,” Csathy said.

But it was a moment at the Rancho Santa Fe Com-munity Center’s Anniversary Gala at The Inn at Rancho Santa Fe that ended up pro-viding that final “push” for Csathy to move into action.

She described feeling a sense of “community,” and as she and her husband, Pe-ter, walked by a beautiful tree, he said, “Look at the Giving Tree” — in reference to the children’s book by Shel Silverstein.

That night, Csathy woke up at 3 a.m. and felt the urge to read the tale, which is about a relation-ship between a boy and an unselfish tree.

“It was after I read the last page of the book where the tree had nothing left but the stump because it had given everything it had, and the last page is, ‘The tree was happy’ — this opened up the flood gates (to start the movement),” she said.

Csathy said she then began to write furiously and came up with the concept of the Giving Tree Movement: to bring people together to see the bigger picture, create a support network and open discussion.

“I was tired of the doom and gloom,” with all the news about education budget cuts and the econo-my, Csathy said.

She proceeded to set up the organization’s current Web site within three weeks, pouring her heart and soul into the project.

But once she was done,

her thoughts turned to, “OK, now what do I do with this?”

In April 2011, Csathy began talking to people about the concept, which can be described as a Young Presidents’ Organization (YPO) for families meets TEDx for parents and educa-tors. YPO is an organization that offers a peer network, mentoring and ongoing ed-ucation for business leaders under age 45; TEDx refers to independently organized events in which TEDTalks (Technology, Entertainment and Design) videos and live speakers spark deep discus-sions and connections in small groups.

Giving Tree Movement is an idea of collaboration rather than competition for children as well as parents, Csathy further explained.

Word got around, and the Giving Tree Movement “started taking on a life of its own,” she said. The next year was spent building partnerships, and Csathy be-gan connecting with influ-ential people and “thought leaders” such as Bobbi De-Porter, Janet Attwood, Sted-man Graham and represen-tatives from the David Lynch Foundation.

On March 29 of this year, the nonprofit’s “kick-off” event was held at The Inn at Rancho Santa Fe, when Csathy introduced her idea to a larger audience. Among the attendees were the heads of Kids Korps, Quantum Learning Net-work/Supercamp, Indigo Vil-lage, Teen Wisdom Inc., Xci-teSteps, Janet Attwood and her team of “The Passion Test” trainers, thought lead-


Orchestra Nova San Diego honors RSF resident at ‘Kathleen Davis Day at the Races’

Orchestra Nova, whose performances fuse beautiful music with engaging enter-tainment, will pay tribute to Kathleen Davis, a long-time supporter of the musical group and patron of the arts in San Diego, with the Kathleen Da-vis Day at the Races. The event will take place on Satur-day, August 25, in the Star Fid-dle Skyroom at the Del Mar Racetrack beginning at noon.

Led by visionary artistic director and conductor Jung-Ho Pak, Orchestra Nova is attracting new audiences of all ages throughout San Diego with its unexpected mix of live performance, art, education and multimedia. Kathleen Davis first discovered the group 12 years ago, when they were known as the San Diego Chamber Orchestra and has been a regular season subscriber ever since. She has been an active board member since 2003 and has also served on the orches-tra’s finance committee and as chair of its annual Magic of Music gala in 2008 and 2012.

“I grew up in New Jersey and enjoyed exploring all of the wonderful music and art New York had to offer with my family from a young age,” said Davis when asked about what sparked her love of classical music. Since then, she has been a symphony subscriber in all of the places she has lived and worked, including Atlanta and Minneapolis. She moved to Rancho Santa Fe in 2000 and in addition to her ongoing support of Orchestra Nova is a regular subscriber to the San Diego Symphony, San Diego Opera and a patron at the Ath-eneum library in La Jolla.

Honoring Davis with a day of horse-racing is fitting – a huge fan of the races, at one time she owned a thorough-bred horse named Nerinx who was a winner at the Del Mar racetrack.

“Kathleen has been key to our success, with her tireless commitment to helping us grow and flourish. Her support through hours and hours of volunteer support and finan-cially have truly made a difference for us and we are proud to honor her with this friend-raising event. She is the epito-me of a Nova friend,” says Beverly Lambert, Orchestra No-va’s chief executive officer.

The Kathleen Davis Day at the Races offers guests an en-tertaining afternoon of horse-racing while they enjoy a lux-urious skybox experience in Del Mar Racetrack’s Star Fiddle Skyroom — including table seating, a birds-eye view of the track, wine and champagne, a Tuscan-inspired lunch, a pri-vate betting window and more. Guests can also participate in a hat contest and an opportunity drawing for a stay in a beautiful condo villa at La Costa Resort and Spa.

Proceeds from the event will support Orchestra Nova programs, including their extensive music education pro-grams which reach 10,000 students throughout San Diego County.

Orchestra Nova recently announced its 2012-2013 sea-son after a hugely successful 2011-2012 season, which saw the launch of the Nova™ Experience, its signature approach to presenting and celebrating classical music in innovative ways through a holistic, interactive and participatory ap-proach, with activities, dialogue, art, food and drink wrapped around the musical performance itself, enabling concertgoers to have a complete sensory experience. With sold-out performances of its 2011-2012 Nova Classics at its two primary venues, Irwin M. Jacobs Qualcomm Hall and Sherwood Auditorium, the orchestra has added a third ven-ue, the California Center for the Arts Escondido, to present its 2012-2013 Nova Classics, sponsored by Jean Will.

Tickets for the Kathleen Davis Day at the Races range from $100-$200 and are available by visiting www.orchestra-nova.org or calling 858-350-0290.

Kathleen Davis

The Village Church Community Theater will hold audi-tions on Monday, Aug. 20, and Tuesday, Aug. 21, from 6- 8 p.m. for “Mandate for Murder, Taking a Stab at Politics.”

This comedy mystery by Pat Cook spoofs the election process. Roles for four males, six females. For more infor-mation and audition appointment: villagechurchcommuni-tytheater.org.

Village Church Community Theater to hold auditions for new production

The Rancho Santa Fe Education Foundation is hosting its annual Newcom-ers’ Pool Parties for new families to the Rancho Santa Fe School District to meet others and make new friends prior to the begin-ning of the school year.

Pool parties are hosted by parents of current stu-dents at private homes in Rancho Santa Fe, with re-freshments and desserts do-nated by the Ranch Hands, a group of other families currently in the school. Newcomers’ events are orga-nized by parent volunteers and made possible by dona-tions through the RSF Edu-cation Foundation.

The Newcomers Chair for 2012-13 is Daniele Pol-lin. To RSVP to one of the events below, contact Dan-iele Pollin at 619-871-5267; [email protected] (newcomers chair).

The parties will be held as follows:

• Kindergarten Wel-come Pool Party

Monday, Aug. 20, noon-3 p.m.

• 1st- 4th Grade Wel-come Pool Party

Friday, Aug. 17, noon- 3 p.m.

• 5th - 8th Grade Wel-come Pool Party

Wednesday, Aug. 15, noon- 3 p.m.

RSF Education Foundation to host annual Newcomers’ Pool Parties

Rotary in the RanchThe Rancho Santa Fe Rotary

Club has appointed Deanne Motsen-bocker as its chair of public relations for 2012-2013. Each month there will be a column to let you know what RSF Rotary is busy doing in the community and the wonderful speakers and programs they have at their weekly meetings.

Last week Rotary members heard a presentation from Maureen Stapleton, general manager of the San Diego Water Authority and learned about the challenges that San Diego faces in its water supply and the things that are being done to help.

August Rotary meetings will feature great speakers on a variety of topics. Rotary meets at noon at The Inn at Rancho Santa Fe. Anyone interested in Rotary and serving the commu-nity are welcome to attend. Guest lunch is $25.

RSF Rotary August Pro-grams

•Aug. 13: Rotary member Gary M. Mayers’ beautiful sculpture.

•Aug. 20: Walt Ekard, San Diego County Administrative Officer (CAO)

•Aug. 27: An update on the San Dieguito River Park.Watch for updates on Rotary’s upcoming benefit golf

tournament “Swing for Kids” to be held at La Costa, Friday, Oct. 26.

For more information, visit www.ranchosantaferotary.org.

Deanne Motsenbocker

Real Estate Directory

Clotfelter Homes A28

Willis Allen Real Estate, RSF

Coldwell Banker Residential Brokerage A27

Rancho Santa Fe Offi ce

Deb Weir A28


Jim Hennessy B23

Patton Properties

Kilroy Realty Corporation A5

Carmel Valley Offi ce

Linda Sansone A14-15


Mary Heon A9

Coldwell Banker Residential Brokerage

Monica Sylvester A28


Open House Directory B23

Peter & Shelley Linde B24

Prudential CA Realty

Prudential California Realty B12-B13

Rancho Santa Fe

Shawn Hethcock & Shawn Rodger A2

Willis Allen Real Estate

Sherry Shriver A3


Showcase Homes B22

Tammy Tidmore & Kelly Pottorff A28



Why

CaliforniaMoves.com | SDViewOnline.com

Del Mar 858.755.0075 | Carmel Valley 858.259.0555 | Rancho Santa Fe 858.756.4481

© 2012 Coldwell Banker Real Estate LLC. Coldwell Banker is a registered trademark licensed to Coldwell Banker Real Estate LLC. An Equal Opportunity Company. Equal

Housing Opportunity. Owned and Operated by NRT LLC. All rights reserved.

More Technology

Coldwell Banker

Your trusted source since 1906

Where home begins.

Means maximum exposure

when you list your home with us

4 proprietary web sites (coldwellbanker.com, californiamoves.com, coldwellbankerpreviews.com & sdviewonline.com) that are easily found in search engines

because we invest in online optimization and advertising

Mobile device applications for iPhone, iPad & Blackberry

that make it easy and seamless to locate and review

property information

On LOCATION - our dedicated channel on YouTube allows

home buyers to search by area and view thousands of real

estate property videos 24/7

Powerful partnerships with the world’s leading real estate

web sites to display our listings at the top of search results


Profi le Joe AllisPorsche of San Diego’s Joe Allis brings a passion for the business that began in childhood

Quick Facts

Name: Joe Allis

Distinction: Proprietor, Porsche of San Diego. Active membership in the prestigious, invitational Porsche Busi-ness Forum (a council on business-building techniques for Porsche dealers). Honored by Audi of America for out-standing achievement nine consecutive years; credited by Porsche Cars of North America and Porsche Financial Ser-vices for outstanding achievements every year since 2006. Assisted in authoring the New York state insurance regula-tion 64M for fair and equitable claims settlement practices for consumers.

Family: Married to Lisa for 27 years; Daughters Gabri-

elle, 19, is a student at the French Culinary Institute in Manhattan, and Gina, 25, is a senior buyer at Lululemon athletic.

Interests: Porsches, Porsches and, of course, Porsches. Reading: Biographies or anything Grisham Favorite films: Recently ”The Artist”; of all time: “Toy

Story.” Favorite getaway: San Diego, oh that’s right I live

here now. I’ll be more specific, Rancho Santa Fe. It’s the most beautiful place on earth. Why get away?

Philosophy: My Mom and Dad tell me their “goal” in

having a family was to make every attempt to make this world a better place. My philosophy is to fulfill their goal.

BY KATHY DAYWatch Joe Allis interact

with clients at Porsche of San Diego and you know he means it when he says he’s really in the hospitality busi-ness.

“It just happens to be on wheels,” said the newly minted Rancho Santa Fe res-ident. Allis took over the Mi-ramar Road dealership in a partnership with the Kuni Automotive Group when the Vancouver, Wash., group purchased Pioneer Centers’ three San Diego dealerships and two in Denver. The deal closed in December; in March, Allis landed in San Diego.

When he arrived, he asked a lot of questions about how the store was per-forming – which was “mar-ginal” in some areas, he said.

When he asked “where they were weakest,” the an-swer was Rancho Santa Fe.

That’s when he told his Realtor, “I have to live in Rancho Santa Fe.”

He wants to be part of the community where he can “shake hands and kiss babies,” he said with a broad smile. “It’s nice for people to know that their new neigh-bor is a business owner.”

Talk with him for even a short time and you’ll know that Allis is passionate

about cars and how his cus-tomers are treated, so much so that all of his employees, from service to sales, attend Ritz Carlton management training classes.

“They are our brand ambassadors,” he said. “You can’t give five-star service if you don’t know what it means.”

He describes himself as “the consummate maitre d,’ ” noting that his dealership “is a five-star dealership that happens to sell cars. … We cater to clients who under-stand the difference between what’s necessary and what’s valuable.”

Allis says he’s “had the heart of a car guy since I was a little kid … I knew I would do something in the auto business.”

Growing up in Queens, he would set up dealerships with his Hot Wheels and other toy cars. His sister, who would always complain about her role, would be his customer.

He built models and would “do anything that had to do with cars,” includ-ing detailing neighbors’ cars at 12. He was 16 when his father decided to retire from the restaurant business.

But they didn’t really have enough to retire on, Allis recalled, so three years later his dad started a new

venture.“The closest car parts

store was three miles away,” he said, so his father took the last of the family’s cash and went into the business, recognizing it was some-thing needed in their neigh-borhood. And his 16-year-old son went to work for him, learning all about parts inventory and customer care.

Over the next 12 years, the business grew exponen-tially even though the se-nior Allis often had many customers “who were in over their skis” and owed them money.

[My] reaction was to “go take it all back,” Allis said. “[My father’s] reaction was to tell me to go find out what they were doing wrong. … He was teaching them how to fish.”

What he didn’t know then, Allis added, was that his father was giving him “the wherewithal to be a fixed operations manager.”

Meanwhile, he said, his mom was the “eternal refer-ee,” stepping into the fray in the middle of the night when the father and son would disagree about the business.

There was a time while he attended St. John’s Uni-versity, majoring in English and minoring in theology, when the auto business took a back seat, but now, he said, “If anyone around here wants help with a dangling participle, I can help.”

But that passion for cars took over and he got a job at a “mega dealership” on Long Island that sold Mer-cedes, BMW, Rolls Royce, Bentleys and Acura.

“The place embodied what paying more to get more meant,” Allis noted, adding that at that point in his life he didn’t have a con-nection with affluent peo-ple. “My beginnings were re-ally humble.”

His first car was a 1969 Chevy Biscayne, “with noth-ing, no AC, radio, nothing, but I loved it anyway. She was my first love.”

His second was a 1979 Toyota Celica with a Frank Frazzetta mural of the “silver warrior” emblazened across it.

At that first job, he quickly made an impression on the owner who gave him his first true challenge.

Faced with an Acura lot full of the first Legends on the market, the man — an Armenian immigrant who

required people to remove their shoes before entering his office – took him into the showroom.

“All of the sales people and manager were standing around,” Allis said.

When the owner asked how many had been sold, the response was “none” and he turned to Allis and said, “Make these cars go away.”

When he asked how he expected him to accomplish that, the man just told him to make it happen.

“It was a Saturday after-noon. I went right to church and prayed for four hours,” Allis said.

Within a 10 days they had sold 70 cars and in 12 days were out of Legends.

“[The owner] said, ‘Good job,” Allis said. “I said I had nothing to do with it. I just lit every can-dle in church.”

His boss responded, “Well then you did have something to do with it.”

He also had something to do with helping a wom-an one day. Noticing that she was wandering around and that no one was paying attention to her, he offered to help. She told him she had been to two other deal-erships where she had also been ignored until he stepped up and helped her find the BMW she was shopping for.

“I am the father of daughters,” he said with a

smile. “I have been given a profound respect for wom-en.”

The respect he showed that customer has paid off in spades. She returned a few days later with her hus-band who coincidentally was the manager of Audi of America.

Telling him his wife had convinced him that Allis was “somebody special,” he gave him his business card and told him to call if he could ever be of help.

A couple of weeks later, Allis inadvertently left a door open when he was sup-posed to be responsible for closing the dealership. That led to an incident with a ser-vice manager who swore at Allis as he was trying to help a customer who had come to pick up his new car. Un-willing to put up with the situation, he quit.

And that business card led him to a general manag-er position with a new con-cept dealership known as the Audi Forum at the cor-ner of Park Avenue and Fourth in New York City, where Allis worked for the next 14 years. From there, he moved on to a dealership in Englewood, N.J., five and a half miles away from mid-town Manhattan that had essentially the same clien-tele. He began running a Porsche dealership out of the service area for their Au-dis.

For six years he ran it as

if it was his own. And then in February of this year he was approached by Kuni, who he called the “quintes-sential auto concern” about coming to San Diego.”

“Their initial candidate had backed out and they reached out to me,” Allis said, explaining that they wanted him to buy in as a partner.

But he told them, while flattered, he couldn’t accept because of family ties.

“My parents are getting on,” he said.

While he had talked to his wife Lisa about the offer, he hadn’t told his parents. But Lisa let it slip while talk-ing to her mother -in-law.

“One night my dad called and said to stop by the house,” Allis said, not-ing that he knew he was in for one of Dad’s “talks.”

“Why would you turn down a spot in paradise to sell Porsches,” his dad asked him.

When he told him it was because of family, Dad replied, “What makes you think we wouldn’t come out there too?”

Thinking it was too late, Allis figured he’d learned a lesson. But not too long after, the recruiter called and asked him if he knew anyone else who might be qualified.

“I just asked if I could throw my hat back in the ring,” he said.

In it went and here he is, although he’s still com-muting back to New York regularly while his family makes the transition west.

He knows the decision was the right one.

“I’d heard that some people are in the wrong body,” he said. “Ever since I was a little kid, I always felt I was on the wrong side of the country.”

As a youngster, he suf-fered from “awesome de-pression” in the winter, but in the summer “you couldn’t hold me down.”

He was diagnosed with seasonal affective disorder and began using full spec-trum lights and the condi-tion improved.

But when he first visit-ed San Diego six years ago, he said he knew this was the place he was going to be.

“I still pinch myself ev-ery morning.”

For more information, visit www.porscheofsandi-ego.com; 9020 Miramar Road San Diego, CA 92126; (858) 695-3000.

Joe Allis in the showroom at Porsche of San Diego.


RANCHO PACIFICA SHOWSTOPPER!

CARMEL VALLEY SHOWPLACE!

SANTA FE SUMMIT ~ RARE FIND!

DEL MAR MESA ~ GORGEOUS HOME ON VIEW LOT! CATCH A SUNSET ~ CAPTURE A WAVE~ LIVE AT THE BEACH!

DEL MAR HEIGHTS~ GREAT BUY!

Designer perfect in every detail, hardwood floors, granite countertops, plantation shutters, custom built ins - 3 bedrooms 3 baths, gated elegance at Trilogy II - One of A Kind. 2 cargarage, pool, spa.

5 Bedrooms + Offi ce ~End Of Cul De Sac~ Upgraded & Sophisticated~ Gourmet Kitchen, Custom Cabinetry, Stainless Steel Appliances, Lovely Formal Dining & Living Rooms~ Spacious Master Suite & Generous Wardrobes~ Plantation Shutters~ Custom Flooring~ Full Bed & Bath Suite On First Floor, Extra Upstairs Offi ce With Built Ins~ Super Versatile Floor Plan

Fantastic Semi Custom Home on Secluded View Lot~ 5 + bedrooms Beautifully sunlit~ Wonderful Views ~ Canyon Breezes~ Custom built ins~ marble & travertine~ Gourmet kitchen~ Super Island~ Granite~ Custom Cabinetry~ Huge Family Room & Sunny Breakfast Room~ Elegant Formal Dining ~ Office & Library + En Suite Bedrooms & Baths~ Spacious Master Bedroom with Views & Balcony~ Generous Yard & Garden ~ Plenty of room for pool! Gated Elegance.

Solana Beach and Tennis Club 2 br 2 baths, Great Location~ Upgraded Kitchen and Baths, Travertine Floors, New Appliances, , High Ceilings, Great Entertaining Areas, Steps to the Ocean, Short stroll to shopping, restaurants, galleries, boutiques… Pool, Spa, Tennis, Resort Living... A Must See

Great Location~ Custom Flooring~ Built Ins~ Gourmet Kitchen with Stainless Steel Appli-ances~ Slab Granite Countertops~ Super Island~ Window Seating~ Built in Pedestal Table in Breakfast Room~ Pool & Spa~ Versatile Floorplan ~ High Ceilings~ Spacious Secondary Bedrooms~ Custom Lighting~ Walk to Schools, Parks, New Shopping Center~ Minutes to the Beach & Del Mar Village..

$699,000

$1,275,000

Price Reduction $2,099,000 $645,000

$849,000

SUNDOWNER ESTATES~ SPECTACULAR VIEWS!

New on Market ~ Big & Beautiful 5 br 5 baths, + Office/Library + Playroom/Loft… Amazing Views, Pool, Spa, Grassy Yard, Total Privacy, Over 4700 sq feet~ Huge master suite, Spacious family room, Gourmet kitchen, Soaring Ceilings, Full bed & Bath on first level, Custom Paint, Designer Flooring, An Entertainers Dream Home. This is a rare find! $1,625,000

MARY BROUGHT THE BUYER! ANOTHER SOLD CALL MARY TODAY!

MARY SOLD THE BUYERS HOME TOO!

SOLD

!SO

LD!

IN ESCROW!

IN ESCROW!

NEW LIS

TING!

Open House Sunday 1-

4

Rancho Pacifi ca priced at $3,995,000- $4,495,000 Summit Ocean View $1,495,000

Del Mar Off ered at $1,675,000 Whitewater Ocean Views Del Mar $1,525,000

Top 1% Nationally

Relocation Specialist

Executive Sales Director

#1 Area Agent

2004-2012

(619)888-Sold

Thinking about buying or selling in 2012?

Call Mary Heon - Big on marketing… Big on action… Big on results!

Thank you to all my clients, I appreciate your business and your friendship.

SOLD

!SO

LD!

Magnificent AW Properties Signature Estate, 5 Star custom home, perfect for the most discriminating. This trophy property offers 5 bedroom suites, 3 family rooms, library, theatre, wine room, balconies and patios with unobstructed ocean views. Gourmet kitchen with honed marble and granite surfaces. Pool, Spa, Built-In BBQ, State of the arthome theatre system, custom home electronics and lighting, Technology at it’s very best!

NEW LIS

TING!

$6,200,000


W e are a Southern California team of FinancialAdvisors helping clients design a plan for a secure future.

Meet the Carlson-Ginsberg Team

Call TodayCOMPLIMENTARY 1 Hour Initial Consultation.

1-800-345-8312 / 760-931-9191

1921 Palomar Oaks Way Suite 102, Carlsbad CA 92008

Klindt GinsbergFinancial Advisor /Partner

Linda Smith Financial Advisor

Linda WrightSales Assistant

Rocky Carlson Certified Financial Planner/Partner

CROWELL, WEEDON & CO. THE Independent Investment Team

SERVING SOUTHERN CALIFORNIA FOR OVER 80 YEARS

Member: FINRA/SIPC

Affordable La Jolla Luxury–Seniors Only$225,000—among $400-500k condos

Two bdrm, two bath, patio, dining area. Indoor heated pool, housekeeping, valet covered parking, spa, tennis, gated entry. Elegant dining room. All utilities,telephone, HiDef TV included. Close to I-5 frwy, UTC shopping, restaurants.

More info: http://sandiego.craigslist.org/nsd/reb/3176248603.html

Please call Bruce 818.292.7291 to see.

Former Neurosciences venue now under auspices of Scripps Research InstituteBY PAT SHERMAN

The Scripps Research In-stitute (TSRI) is opening its 352-seat, acoustically superi-or performance auditorium — formerly under the stew-ardship of the Neurosciences Institute (NSI) — to com-mercial, corporate and non-profit groups for the upcom-ing season, Oct. 1, 2012 through Sept. 30, 3013.

Though TSRI owns the space, now renamed the Au-ditorium at TSRI, the Neuro-sciences Institute began leas-ing and operating the facili-ty near UC San Diego in 1996, offering nonprofit per-forming arts and education groups regular, free access to the world-renowned concert venue.

NSI’s lease on two adja-cent research buildings owned by Scripps also ex-pires Sept. 30. The organiza-tion’s research director, Dr. Einar Gall, said his organiza-tion would release informa-tion about its plans in the coming weeks.

TSRI announced earlier this year that it does not have funds to allow arts or-ganizations to continue us-ing the auditorium for free. Moving forward, the rental rate for businesses and spe-cial events is $3,000 per eve-ning.

Rental for qualified nonprofit groups, including performing arts organiza-tions and educational groups that focus on science or aesthetic matters, is

$1,500 per evening, plus any ancillary charges. These in-clude the use of audio visual or lighting technicians, as well as caterers, which must be procured through TSRI’s list of approved vendors, who are familiar with the space and its equipment, Scripps Research Institute spokeswoman Stacy Rosen-berg said.

Several nonprofit arts organizations have already booked space for the coming season, including the La Jol-la Music Society, the Mainly Mozart Festival and the Ath-enaeum Music & Arts Li-brary, Rosenberg said.

Though some nonprofit groups who previously used the space wrote TSRI saying they won’t be able to afford the $1,500 rental fee, Rosen-berg said, “I think people understand the position Scripps Research Institute is in, in terms of being a non-profit as well, why as a bio-medical research institute we could not put money into this. … We needed fi-nancial participation from users; we just couldn’t give it away.”

Christopher Beach, president and artistic direc-tor of the La Jolla Music So-ciety, said his organization

will continue presenting its Discovery Series in the audi-torium. The series brings the winners of classical music competitions from around the world to La Jolla.

“That theater is incred-ibly important to us; I’m de-lighted that we’ll still be there,” Beach said, noting that he feels the $1,500 non-profit rent is an “appropriate market rate.”

“I can’t very well object, having been the beneficiary of so many years of (the Neuroscience Institute’s) lar-gesse,” he said. “It’d be nice to get it for free forever, but everyone has financial chal-lenges.”

Rosenberg said that in the future TSRI hopes to in-vite some of the now ex-cluded nonprofit groups back for free use, possibly through an endowment from someone “who under-stands what a beautiful facil-ity this is and the important role that the auditorium plays for the performing arts.”

“We don’t want to ac-tively fundraise, because it conflicts with our mission as a biomedical research insti-tute,” Rosenberg said. “We have so many generous sup-porters of the performing arts in our community and we would just love it if one day we’re able to restore the (free-use) program.”

The auditorium is cur-rently undergoing a renova-tion, courtesy a local philan-

For more information about renting the au-ditorium at TSRI, visit

Booking info

Mainly Mozart chamber musicians Steven Copes, Peter Wiley and Anna Polonsky performed last year in the auditorium formerly offered for free to the community by the Neurosciences Institute. PHOTO/KEN JACQUES

thropist’s $65,000 grant.The work includes adding handrails to

the steps, replacing carpeting, repairing seats, adding lights and other safety features.

“We’re really pleased about being able to offer a safer, more comfortable environ-ment for the people who will be attending concerts here,” Rosenberg said.

Located on the Torrey Pines Mesa at 10640 John Jay Hopkins Drive, the auditori-um offers superior acoustics, theater seating, and elegant, contemporary architecture. On-site event parking, a reception area and din-ing patio are available adjacent the auditori-um.

Go to RSFReview.com/Contests and send us your best racetrack/horse photo. The winner will receive a $40 gift card to Tapenade Restau-rant. Take a look at this photo (left) from Can-dice Rolfsmeyer.

Enter ‘Best Racetrack/horse photo’ Web contest


‘Cool as ever’ — longtime partners are thriving ‘Ad Men’ at agency MeadsDurketBY CATHERINE KOLONKO

Anyone who has lived in San Diego County for a while knows that the jingle “Where the Turf meets the Surf at ol’ Del Mar” indicates summertime horse racing is about to begin.

The television advertisements feature the catchy tune that harkens back to earlier days when actor-singer Bing Crosby held court at the Del Mar Racetrack. To keep the campaign fresh but still consistent with its history, this year features a pretty blonde who recently posed nude in Vanity Fair Magazine.

Yes and it’s even racier than you might think. In the TV commercial the model – fully clothed – sits atop a carousel horse, but in real life she is successful horse jockey Chantal Sutherland. (She raced opening day this year at Del Mar, riding filly Miss Califor-nia to victory in the first race of the 75th an-niversary season.)

The commercial is part of an overall campaign dubbed “cool as ever” and con-ceived by MeadsDurket, an advertisement agency run by partners Gary Meads and Tony Durket, both 56. The pair have been working together for 24 years and were in-troduced to each other by their wives. (Dur-ket’s wife, Linda, is the executive director at the RSF Community Center.)

“We do different things and I think that’s one reason we have lasted so long,” Meads said of his partnership with Durket.

Both Meads and Durket worked at Phil-lips-Ramsey, a large San Diego ad agency owned by McCann-Erickson, before buying remaining assets of Phillips-Ramsey and forming their own company in 2004.

Meads is the front man of the operation and runs the account and business side of the agency. Durket is the creative director, which includes managing artists, writers, and other creative staff. Durket started his career as a writer and outside of work, en-joys writing screenplays.

Durket and Meads became friends through business and their common love of advertising. Durket said his partnership with Meads is extremely important because their business is built around ideas.

“He knows a good idea and that’s a very intuitive thing,” Durket said of his partner. “There’s a lot of people that just don’t. They don’t appreciate and they don’t see the val-ue of it. I really respect the fact that Gary

does and knows how to nurture it and knows how to develop it…

“We both believe in the transforming power of idea. You know, all the companies we work with started as ideas.”

Eight years ago, the duo adopted “Where the Turf meets the Surf” for the Del Mar race track ad campaign, said Meads. Bing Crosby wrote the song with John Burke and James Monaco in 1938, one year after Del Mar opened.

“We took the original recording and re-mixed it with a variety of genres (rock, reg-gae, jazz, etc.) but always led by Bing Crosby singing,” Meads explained in an email.

The genesis of this year’s campaign grew out of a theme of the classic pin-up girl, explained Meads.

“Then we thought, ‘Well, who would be the perfect pin-up (model) and Chantal im-mediately came to mind because not only is she a beautiful woman but she’s also an ath-lete and she’s running at Del Mar,” he said. “It just seemed to make a lot of sense and we presented the idea to her and she loved it.”

Tony Durket, left, and Gary Meads at the MeadsDurket offices. COURTESY

See AD, page 22


www.corum.ch

DJ Johnson shows a smooth follow through

Bobby Leonard rips off a strong forehand

DJ Johnson and Dean Curtiss

DJ Johnson, Irene Thompson, Axel Bouillin, Bobby Leonard, Coach Derek Miller and Jeff Kelleher

Members of the Ran-cho Santa Fe Tennis Club enjoyed some competitive play and a casual cocktail hour recently. Coach Derek Miller arranged mixed dou-bles and men’s singles play to round out the event. The first of a possible ongoing monthly Twilight Mixer event, members can look forward to more sunset ten-nis play through to Octo-ber.

RSF Tennis Club Twilight Mixer

Village Church Preschool remodel ahead of schedule

RSF residents Jere and Joyce Oren recently toured the Village Church Pre-school, surveying the prog-ress of the remodel for which they generously do-nated $500,000. The excite-ment can be “felt” as the job is ahead of schedule because of Miles Construction Com-pany running an efficient project, and the move-in date is just around the cor-ner.

(Above and right) Don McNeil, who has overseen the project, and Pastor Scott Mitchell recently toured the Preschool with the Orens, as well as Brad and Dave Alla-band of Miles Construction.

Mr. and Mrs. Oren

have displayed a deep love and passion for children and are the driving force behind this amazing project. Sincere grati-tude is felt for the Oren family as Village Church Preschool looks like a brand new school; yet it is 50 years “young!” Numerous children and families will benefit from this ex-traordinarily generous donation from the Orens.

Join the RSF Republican Women, Fed. (and men) for an event featuring author and RSF resident Karna Bodman. Bodman is also a former television anchor, former deputy press secretary under President Ronald Reagan and former senior director of the Nation-al Security Council.

The event will be held on Sunday, Aug. 19, at 3 p.m., at The Pantry Restaurant & Courtyard, 6024-C Paseo Delicias, RSF.

Enjoy light foods and drink while listening to Bodman talk about her new political thriller, “Castle Bravo.” Cost is $25 per person. This will be another fun summer gathering. Please make checks payable to RSFRWF by Aug. 16. Send to PO Box 1195, RSF, 92067. Re-ceipt of your check ensures your reservation. Questions: Contact Sharon, [email protected] or 858-756-3814.

Red, White & Blue Party: RSF Republican Women to host event featuring author Karna Bodman


BY JULIE SARNOLooking back over more

than 40 years in the Thor-oughbred business, Rollin and Bonnie Baugh say their favorite part has been the many friends they have made. To the Rancho Santa Fe couple, thoroughbred rac-ing is more than just a busi-ness, it has been a way of life.

“Our first race horse was Year of Beginning,” re-called Bonnie. “We bought her in 1968, the year we were married. She won her first race by eight lengths. The jockey was Danny Velasquez. We saw Danny (now a trainer) the other day at Del Mar. Danny said to us, ‘Do you remember Year of Beginning? Those were such good times.’”

Baugh remembers his first trip to Del Mar. He grew up in Pasadena, California. When he was 11 or 12, his father brought him to stay at The Inn at Rancho Santa Fe:

“Each day we would get up and my brother, father and I played golf. Then we went back to The Inn, and ate club sandwiches by the pool before going to the rac-es. That, in my view of life, is as good as it can be. The hook was completely set in

me.”The couple run Baugh

International, a bloodstock agency that buys and sells horses. They compare a bloodstock agent to a stock broker or real estate agent. A stock broker facilitates the buying and selling of stocks. A bloodstock agent buys and sells Thoroughbreds, known in England as “horses of the blood.”

Through the years, Baugh has earned respect and recognition from his racing peers. Locally, he is a longtime member of the board of directors of the Del Mar Thoroughbred Club — he was appointed 20 years ago. Nationally, he is a member of The Jockey Club. Also, he is a former trustee of the Thoroughbred Own-ers and Breeders’ Associa-tion.

Rollin grew up a bicycle ride away from Santa Anita. His father took him there at age 12. Rollin was captivated and found a way to sneak in. Occasionally, his father went on Thursdays with friends. When Rollin en-countered the group one af-ternoon and inquired as to which horse he should bet on, one of his father’s friends quipped, “Juvenile Delinquent.”

Shortly after Baugh graduated from college, his father passed away. The fam-ily business was sold and Baugh wanted to pursue his interest in racing. He went to Jim Stewart, who man-aged Hollywood Park, and asked how to land a job in the sport.

“At that time, there was no structured way to get in,” said Baugh, referring to the college majors currently of-fered, notably, the Race Track Industry Program at the University of Arizona. “If you did not have family in the sport, or connections,

it was very difficult.”So Baugh went to work

for Ampex in Redwood City, which produced tapes and video cassette recorders. Af-ter three and a half years, Baugh had worked his way up to International Advertis-ing Manager, but he left the company to find a job in racing. He lived at JRK Ranch in San Luis Obispo, took courses at Cal Poly Po-mona and attended horse sales. He saw an ad for a po-sition in publishing and ad-vertising with the Thor-oughbred of California, now known as the California

Thoroughbred, published by the California Thorough-bred Breeders Association. Baugh went for an interview and met Colonel Keester who was running the CTBA at the time, Cecilia DeMille Harper and Joe Harper, her son. The latter is now presi-dent and chief executive of-ficer of Del Mar Thorough-bred Club.

Baugh had experience in advertising, but he want-ed to learn more about pro-duction, advertising art and design. In 1964, he enrolled in a course at Pasadena City College. He made it a point to arrive early and take a seat next to the prettiest girl in the class. After three weeks, Baugh worked up the courage to ask her out. Her name was Bonnie and she also grew up in Pasadena. The couple began dating and, four years later, they were married. They have one daughter, Kristy, who lives in Sonoma and helps Baugh International with re-search.

In 1963, Baugh had met Jim Buell, an established California horseman and Thoroughbred breeder at the CTBA Fasig-Tipton auction at Pomona. Baugh had out-bid Buell on a horse, a mare by champion Nashua. Buell

also is a member of Del Mar Thoroughbred Club’s board of directors.

“I paid $1,600 for her, my hard-earned money which I had saved while working for Ampex,” re-called Baugh. “Jim came up to me after and said he was interested in the mare. The mare never got in foal. That was a great education. I learned the business is not easy and Jim introduced me to a whole bunch of people in Kentucky.”

After Baugh worked for the CTBA for three and a half years, Col. Keester de-cided to retire. Baugh was asked to head the organiza-tion. After some soul search-ing, Baugh turned down the offer and opened his blood-stock business in October of 1968, just before his mar-riage to Bonnie. The couple have worked together in the firm ever since.

Over the years, the em-phasis of Baugh Internation-al has changed. In the be-ginning, the emphasis was more on research. Then they began to handle major dis-persals selling horses for the Peco Ranch. In 1971, they handled the Fletcher Jones dispersal, which yielded a

Rollin and Bonnie Baugh at their Rancho Santa Fe home. Their dog is Kerry, a Cairn terrier.

A life devoted to the Thoroughbred business has been a life fulfilled for RSF couple

See LIFE, Page 22

Meadow View Farm

Heather Manion & Owner | (858) 756-3007 • (858) 353-3350 | [email protected] | Lic#’s 00798625, 01024451

• Little Piece of Kentucky in Rancho Santa Fe

• Only High, Flat, 5 Acre Lot in the Covenant

• Full 3 Stall Barn w/ Apartment & Caretaker Suite

• Capability of 6 Paddocks, Including Riding Ring

• Irrigation Well

• Swimming Pool, Putting Green, Gazebo

• Views of the San Dieguito River Valley

$5,200,000

Rancho Santa Fe Review August 9, 2012 1514 August 9, 2012 Rancho Santa Fe Review

LINDA SANSONE& A S S O C I A T E S

ABOUT LINDA SANSONEWith a master’s in accounting, a CPA, and CFO experience for a prestigious architectural firm, Linda is a rarity in the real estate industry. She represented one of the largest residential sales in all of San Diego County. She is a Rancho Santa Fe resident with nearly 16 years experience representing residential buyers/sellers.

CA DRE # 01219378

(858) 775-6356 LindaSansone.com

Experience an exceptional level of luxury and style at this magnificent custom estate in The Bridges in RSF. A chic designer-appointed residence with a sophisticated European ambiance amid 5 bedrooms, 5.5 baths including a guest casita. Located along the golf course, with an amazing indoor/outdoor flow for everyday living and grand enter taining.

Off ered at $3,395,000

Majestic Sunsets, awe inspiring Pacific Ocean views…….rarely does a single story home of this size, style and quality become available on such a coveted Covenant lot. Superbly

located on the Westside of the Covenant, this proper ty has unobstructed ocean and sunset views, on a quiet and private cul-de-sac, within minutes to the RSF Village.

Off ered at $5,500,000

Rancho Pacifi ca$9,350,000

RSF-The Covenant$5,495,000


RSF-The Bridges$8,495,000

RSF-Horseman’s Lane$2,995,000


RSF-The Groves$2,249,000





“Chic European Ambiance”-The Bridges “Sparkling Attitude”-RSF Covenant

Rancho Santa Fe Real Estate: 2012 January-July Performance Summary Overall, Rancho Santa Fe real estate (defined for the purpose of this analysis as all attached and detached residential properties listed with the San Diego Multiple Listing Service for the 92067 and 92091 zip codes) looks stronger this year than last year. Comparing January through July 2011 to the same time period this year, shows that sales have increased 4% while inventory has decreased 20%. For those first seven months of 2011, 138 properties were sold whereas 144 properties in 2012. Average daily inventory was 303 properties in 2011 versus 241 in 2012. The result of this demand/supply change was an 11% increase in median value from $1,850,000 to $2,051,000.

Most of the inventory decline came from properties with an original listing price less than $3,000,000, while most of the valuation increase came from the middle price market, i.e. properties with an original listing price between $3,000,000 and $5,000,000. However, what was common across the overall Rancho Santa Fe market was that sellers have been pricing their original listing prices closer to their final closing prices than they did in 2011. This, combined with overall lower inventory levels, have contributed to creating a more robust market.

Original Listing Price: less than $3 million This price group had the largest decline in inventory and new listings than any other price group. The average daily inventory for the first seven months of 2011 was 161 properties available for sale versus 113 properties for the same period this year. A reduction in new listings accounted for the majority of this 30% inventory decline. During this same time period, new listings fell from 233 properties in 2011 to 187 properties in 2012, resulting in a 20% decline in new market supply. The demand for this price group has remained essentially flat. Sales for January through July 2011 were 94 properties compared to 95 properties in 2012. Nevertheless, despite flat demand, one would expect to see the median value for the price group to have increased, given the significant reduction in supply; yet, this was not the case. Median value actually declined 4.5%. Tougher underwriting guidelines have constrained borrowing, limiting the number of eligible borrowers, softening the market and holding back new inventory. Possibly as potential buyers see more economic certainty, more will step forward and consequently strengthen valuations in this price group.

Original Listing Price: $3 million - $5 million This price group was the “rock star” of all the price groups when comparing January through July of 2012 to the same period last year. Sales increased more than any other group in absolute and percentage terms. 24 properties sold during the first seven months of 2011 versus 32 properties in 2012. This represents a 33% increase in year-over-year sales. However, not only did sales increase more than any other price group, but so did median value. Median value increased nearly 13% as a result of this significant increase in demand on a price group that also experienced a 15% reduction in supply. Average daily inventory declined from 83 properties in 2011 to 71 properties in 2012. This mix between more demand and less supply created stronger valuation within this group. It also reduced the marketing times by 24%. Average marketing time for properties sold during the first seven months of 2011 was 377 days, while it was 286 days for those properties sold in 2012 for the same time period. It will be interesting to see if the strength of this price group attracts more sellers during the remainder of 2012.

Original Listing Price: $5 million or more Of all the price groups, this one has been the most challenged. It is the only price group to have a sales decline when comparing January through July of 2012 to the same time period in 2011. Sales declined 15% from 20 properties in 2011 to 17 properties in 2012. Not only did fewer properties sell, but they sat on the market, on average, over 200 days longer. Average marketing time for this price group rose 50%, from 403 days in 2011 to 605 days in 2012. The remaining statistics (Inventory, New Listings, Median Sold Price, etc.)have remained essentially flat after taking into account statistical noise. To be fair to this price group, much of its inactivity comes from a political environment wrestling with monumental economic-changing decisions here in the United States and more recently the European Union. Consequently, equity markets have been severely held back, anticipating resolutions that would create greater forward clarity. I’m afraid until then, this price group may be in somewhat of a limbo.



Jack Wheaton (piano), Rob Morgan (vocals), Dana Wheaton (bass guitar)

Jack and Jeanne Wheaton

Marie Addario, Jo Reeder

Rob Morgan, Jeanne Wheaton

Mary Kashing, Dana Wheaton

Trisha Van Gorder, Pat Wood

Art and Lisa Smith

Rod Schaefer, Alicia Previn

Lois Schaefer, Kathy Robinson

Jeanne Wheaton, Marianne Kalina

Jeff and Marlena Brown

Larry Van Gorder, John Kalina

Friends and family gathered to celebrate RSF Big band conduc-tor Dr. Jack Wheaton’s 80th

birthday Aug. 5.Wheaton is a retired professor

of music, USC; Past-president of the American Federation of Musicians; composer of film scores; author; and director of the Gershwin seg-ment for the 1984 Olympics Open-ing Ceremony.

Wheaton received greetings at his birthday celebration from for-mer students, including Bobby Mc-Ferrin, and Pancho Sanchez. PHOTOS/JON CLARK

RSF celebrates Jack Wheaton

Betty Lowe, Kay Hansen

Alan Cone, Dom Addario, Vearl Smith Maryann and Gary Schneider


Your Exclusive Rancho Santa Fe Anti-Aging Specialist

18029 Calle Ambiente, Suite 507 Rancho Santa Fe, CA

What is Plasma (PRP) Face Lift?Ingredients from your own blood regenerate skin and rejuvenate collagen with enriched platelets, stem cells and growth factors.

These platelets release special growth factors that actually heal and regenerated new cells over a period of time.

Call Us At 858-756-5678 or visit www.pacifi ccielo.com

Anti-Aging Rejuvenation ProceduresLiposculpturePlasma (PRP) FaceliftPlasma (PRP) Breast LiftFat TransferLoose SkinCrow's FeetAging HandsNon Surgical Tummy Tuck

Skin Therapy & ContouringCellulite TreatmentBody ContouringSkin Tightening

Wrinkle TreatmentsBotoxDermal FillersRadio Frequency Treatments

Platelet Rich PlasmaPRP Injection

Before

After

Local Girl Scouts seeking donations for care packages to help the homelessBY KAREN BILLING

As part of their Girl Scout Senior Award project, three teenagers are tackling the is-sue of homelessness in San Diego. Dionne Rasquinha, Jaime Wisnia and Katherine Lauerman of Girl Scout Troop 1156 are spending numerous volunteer hours at local charities and are seeking donations to put together 150 care packages to hand out to those in need.

All three will be freshmen in high school in the fall: Dionne at Canyon Crest Academy, Jaime and Katherine at Torrey Pines High. The girls have been visiting lo-cal dentists, hotels and grocery stores to ask for donations for their care packages.

Dr. Christopher Hydo and Dr. William Rawlings, who have offices in Encinitas and Solana Beach, donated 144 tubes of tooth-paste. Dr. Thomas Kujawski’s dental prac-tice also donated 45 toothpaste tubes, 15 toothbrushes and 30 flosses.

“People are really willing to donate, which is awesome,” said Katherine.

They are also hoping that the commu-nity will help them out with donations. Items needed for their care packages include shampoo, conditioner, lotion, band aids, in-dividual pocket-size hand wipes, bottled wa-ter, granola bars, toothbrushes, hand sani-tizer, socks, sunblock, soap, pocket-size Kleenex, chapstick or Vaseline and small notepads.

Collections for donations will be held on Monday, Aug. 13, and Saturday, Aug. 18, from 10 a.m. to 12 p.m. in the parking lot in front of Solana Highlands School (3520 Long Run Drive, Carmel Valley, 92130).

In picking their service project, Kather-ine and Jaime had first intended to try and do a bookmobile for seniors, but they ran into too many roadblocks for it to work out. Dionne had a fulfilling experience volun-teering packing food for the homeless at her church, St. Therese of Carmel, so the girls decided to join forces and do their project serving the homeless.

“We see homelessness in San Diego so much and it looks pretty tough,” said Kath-erine.

“I found out that in San Diego, if we don’t help it will cost us a lot more money than if we do help,” said Jaime, referencing the costs to the entire community for the

homeless accessing public services such as healthcare and police.

According to the Regional Task Force on the Homeless, San Diego County’s homeless population is now at approxi-mately 9,800, representing an 8.6 percent increase from 2011.

The Silver Award requires 50 hours of logged volunteer time. Places the girls have volunteered at so far include Bread of Life Rescue Mission; St. Vincent de Paul Village; TACO (Third Avenue Charitable Organiza-tion) run by First Lutheran Church of San Diego; making sandwiches and care packag-es at Solana Beach Presbyterian; and serving at Friends and Family Community Connec-tion (FFCC).

“I really liked working at FFCC because it’s almost like a store,” Katherine said of the organization that lets people browse among donated clothing items and food.

“I like St. Vincent de Paul,” said Di-onne. “Before I didn’t think that a lot of people would be there to volunteer but there were and it was inspiring that so many people are willing to help out the community.”

As the Silver Award is also about com-pleting a project that will be an ongoing process, the girls hope to prepare write-ups of all the local homeless charities to encour-age and inspire others to volunteer their time. Jaime said a lot of their fellow high school students need community service hours, and they hope it will be a helpful re-source.

Katherine, Dionne and Jaime have all been Girl Scouts in the same troop since they were kindergartners and they enjoy the experience and plan to stick with it.

“For me it’s really the environment, all the girls in our troop are good children,” said Jaime. “We’re down to five or six girls from 12, but it’s nice to have known them for a long time and we’re all very good friends.”

The troop still meets and goes on camping trips, which Katherine said is the best part. They don’t sell cookies anymore, but have the opportunity to do a lot of meaningful community service.

“I like that we’re able to see what’s hap-pening around us,” Dionne said.

Jaime Wisnia, Katherine Lauerman and Dionne Rasquinha are collecting donations to build care packages for the homeless as part of their Girl Scout Silver Award project.Photo/Karen Billing


We Are Buying...Immediate Cash Paid

Diamonds Estate Jewelry

Antique and Period JewelryGemstone JewelryDesigner Jewelry

Fine Watches and Gold Coins

858.459.1716Two stores in the Village of La Jolla1230 & 1237 Prospect St.www.hmoradi.comWe Buy, Sell & Trade

EXPERT ADVICE

Encinitas real estate news: how to edge out multiple bidders when buying a San Diego coastal home

Patricia Kramer & Patricia Martin, Kramer & Martin Real Estate

San Diego real estate trends show high-end home prices on the rise, inventory on the decline

John R. Lefferdink

Spring in to summer with outdoor design, furniture and floral ideas

Sara Wardrip, European Antiques & Design

Look to these local authorities for professional guidance

on daily living at

ranchosantafereview.com/columns

San Diego real estate investments: tips for earning retirement income with rental properties

Vicki Johnson, Real Estate

What is liposculpture surgery? Exploring the latest liposuction alternatives.

Dario Moscoso, Pacific Cielo Surgery Center

BY MARSHA SUTTONSan Dieguito Union High

School District’s plan – and the school board’s initial approval – to place cellular antennas at Canyon Crest Academy stunned many in the CCA community, some of whom were suspicious of the timing and the lack of notice.

If not for a front-page story in this newspaper on July 5 that trig-gered protests from many quarters, Sprint/Nextel’s agreement with SDUHSD to erect three arrays of four antennas each on top of classroom buildings at CCA would have been a done deal at the school board’s July 26 meeting. It was that close.

It’s an uncharacteristic misstep for a school district that is generally regarded, justifiably so, as open and transparent, communicative and approachable.

In two fundamental ways, the district and school board members failed the community. First, by not informing stakeholders of the plan. Second, by treating this project as just another ordinary business deal, without regard for the safety of students and employees in close daily proximity to radiation emissions of undetermined consequence to hu-man health.

The lack of notification is most baffling. If it was not in-tentional deception, then incompetence is the only other explanation. Neither is admirable.

Eric Dill, SDUHSD’s associate superintendent of busi-ness services, insisted this was no deliberate attempt to sneak it past the community.

“I want to dispense with the notion that we were trying to hide or push something through during the summer be-cause nobody would be around,” Dill said. “We’ve heard that accusation a couple of times in the last weeks, and nothing could be further from the truth.”

Dill said all procedures were followed properly, includ-ing hosting a public meeting that was requested by the Car-mel Valley Planning Board, which first reviewed the project on April 26.

“From what I understand, this public meeting wasn’t even a requirement of moving this forward,” Dill said. “We enter into lots of business arrangements where we don’t go

out and notify the entire world.”John Addleman, SDUHSD’s director of planning and fi-

nancial management, said a notice was placed in the May 23 issue of the North County Times, calling a public meet-ing at Canyon Crest Academy for June 1.

Dill said the district chose the North County Times to reach a wider audience than just Carmel Valley. But since the overwhelming majority of students attending Canyon Crest Academy live in the southern portion of the school district where the North County Times is not widely read, the obscure notice did not serve to alert the community.

The Carmel Valley Planning Board, in a letter to the dis-trict objecting to the project, called the North County Times “a newspaper with little circulation among the CCA com-munity.”

“The North County Times is the place where we put all those kinds of public notifications,” said SDUHSD superin-tendent Ken Noah last week. “But when I learned that there had not been information provided [to the Carmel Valley area], I think that was an error on our part. We should have.”

Nevertheless, the June 1 meeting took place, led by Sprint representative Becky Siskowski and SDUHSD’s Addle-man, and attended by a grand total of three audience mem-bers, all CCA students.

Besides parents, teachers and other staff members also were unaware of the project. One CCA teacher told the Car-mel Valley Planning Board that he never knew about the is-sue or the June 1 meeting.

CCA’s principal Brian Kohn never mentioned the proj-ect to his staff, perhaps because he thought the issue was “still in the discussion phase.”

“I knew they were talking about it and that the project was out there,” he said. But he did not know in advance, he said, that the board was to approve a resolution of intent on June 21 to grant Sprint the CCA easement for the project. Nor did he know in advance that the board was to give Sprint final approval at its July 26 meeting.

Although he was not told of the district’s past months’ progress on the matter, Kohn was reluctant to comment “because it’s hard to know where they were [in the pro-cess],” he said.

Normally, those at the district office guiding the project “would probably at a certain point come to me and say, ‘Here’s what we’d like you to do and help us with the com-

munication piece,’” he said. Except they didn’t. Nor were teachers informed by their union leaders, who

also didn’t know in advance. Bob Croft, president of the San Dieguito Faculty Associ-

ation, SDUHSD’s teachers union, said by email, “I have full confidence in Supt. Noah and our board that they would thoroughly discuss, review all relevant research, and seek the appropriate feedback before proceeding with any such op-tion.”

Except they didn’t do that either.Croft was diplomatic in his guarded statement but his

confidence was misplaced, since district officials admitted they didn’t let him know, contending that notification to teachers for a simple “business decision” was not necessary.

Ron Tackett, head of SDUHSD’s classified employees’ union, California School Employees Association, also was never contacted by the district to inform him of the plan to erect cell towers at CCA.

“I’m surprised that I wasn’t notified,” said Tackett, whose association consists of non-certificated employees (non-teachers). “I would think with a sensitive issue like that, that the right thing would have been to notify all the stakeholders.”

Tackett distinguished between a regular business deci-sion and one that has the potential to affect the health of staff and students.

Tackett said if he’d been made aware of the potential deal he would have notified his members so they could act on the information if they chose. “But the notification part, that certainly didn’t happen,” he said.

Health and safety concernsIn 2005, the Journal of the American Academy of Pedi-

atrics confirmed that children are especially sensitive to all electromagnetic fields because their developing nervous sys-tems are fragile, their brain tissues more conductive and their smaller skeletons more easily penetrated by the waves.

The official position by the Federal Communications Commission is that evidence is inconclusive that cell tower radiation has negative health and safety effects. “Inconclu-sive” is the operative word. This is vastly different than say-ing there is conclusive evidence of no negative health ef-fects.

“Prudent avoidance” is generally advised by experts un-

Education Matters/Opinion/CommentaryBringing down the towers: Cell antenna misstep causes district to backtrack on project

Marsha Sutton

See TOWERS, page 24


Presentation:

Preferred SecuritiesExamining the Features & Benefi ts

Presented by:Tom Pearse Vice PresidentFirst Trust

Kerry TazakineVice PresidentFirst Trust

Hosted by:Autumn M. BurackerBranch ManagerMorgan Stanley Smith Barney6037 La Flecha Rancho Santa Fe, CA 92067858-613-8151 Offi ce

Date & Time: Wednesday August 22, 2012 / 1:00 PM

Place: Rancho Santa Fe Golf Club5827 Via de la CumbreRancho Santa Fe, CA 92067

RSVP: [email protected] / 858-613-8151

Lunch will be served. Guests are welcome.

Preferred Securities: Income in a low Interest Rate environmentWith the markets as they are, this can be a confusing time for many investors. We understand that you may have more questions than answers. Join us for an informative seminar where we’ll show you how to navigate these challenging markets and make sense of your investment options.

Thank You!Morgan Stanley Smith Barney wishes to extend our gratitude to all the Residents of Rancho Santa Fe who supported our 1st Annual Shred-It-Day event. Due to your community efforts we disposed of more than one-half ton of paper that will be recycled and raised a considerable amount of Food Donations for Feed America. We especially thank those who helped sponsor the event:

Robin Chappelow & the Youth of Kids Korps • Stumps Village Market • Thyme in the Ranch

Rancho Santa Fe Review • Rancho Santa Fe Merchant’s Association • Rancho Santa Fe Patrol

Mutual fund, exchange-traded products, UITs and variable annuities (“investments”) are subject to market risk, including the possible loss of principal. Variable annuities are suitable for long-term investment purposes. Variable annuities are long-term investments designed for retirement purposes and may be subject to market fl uctuations, investment risk, and possible loss of principal. All guarantees are based on the claims-paying ability of the issuer. Taxable distributions (and certain deemed distributions) are subject to ordinary income tax and, if taken prior to age 59 1/2, may be subject to a 10% federal income tax penalty. Morgan Stanley Smith Barney and its Financial Advisors do not provide tax or legal advice. Individuals should consult their personal tax and legal advisors before making any tax or legal related decisions.

These investments are sold by prospectus only. The prospectus contains the investment objectives, risks, fees, charges and expenses, and other information regarding these investments which should be carefully considered before investing. Prospectuses are available through your Financial Advisor. Read the prospectus carefully before you invest or send money.

The presentation will contain the current opinions of the speaker, which are subject to change without notice. It does not represent a recommendation of any particular strategy or investment product. This presentation is for educational purposes and should not be considered investment advice.© 2012 Investment and services offered through Morgan Stanley Smith Barney LLC. Member SIPC. CRC 535285 | 2011-PS-2445 | Exp 2/2013


BY TIM PICKWELL Choices. Torrey Pines High School Senior Jacob Alsadek

had the luxury of more than a dozen. He visited Cal, Vanderbilt, Boise State, Colorado, Stanford, UCLA and oth-ers. He agonized for weeks over which school, coach and football program was the best fit.

And, then, after choosing to orally commit and accept a full-ride, Division I scholarship offer to play Pac 12 football at the University of Arizona, the biggest (6’ 7”, 332 lbs.) of-fensive line prospect in America (according to ESPN.com) could be forgiven if he put his size 16 custom-made football cleats up on the couch and relaxed for awhile.

Instead, under the watchful eye of a personal trainer, RSF’s Alsadek finds himself each day sweating and pounding the stairs at San Elijo State Beach with some Falcon team-mates. Alsadek, 17, is not resting on his laurels, and is not cutting back on this football regimen.

“I’m actually working out even harder now since I ac-cepted the offer,” said Alsadek. It’s [head] coach [Rich] Ro-driguez’s first year at Arizona, and he’s building a program. They told me that I have a chance to compete for a starting spot.”

Media relations for the University of Arizona said that NCAA rules prevented them from commenting on any high school recruits until after signing day in February 2013. But, several recruiting websites, including ESPN.com, Scout.com and Arizonascout.com, noted Alsadek’s commitment to the university. Arizona has commitments from 23 players, and Alsadek was partly motivated to make the move because they had only two open recruiting slots left. “They are bringing in a great recruiting class,” said Jacob, “and I want-ed to be a part of it.”

The astonishingly strong high school student can bench press 360 pounds, squat 475 pounds, and run the 40-yard dash in around 5.5 seconds. And, yet, he is still raw, having played only three seasons.

Jacob and his family moved to Rancho Santa Fe when he was in the 5th grade. Jacob attended Rancho Santa Fe Middle School before moving on to Torrey Pines. As a fifth grader, Jacob was too large to play Pop Warner football (which has a 165-pound upper weight limit). His freshman season at Torrey Pines was the first time he put on pads.

Falcon Head Coach Scott Ashby immediately saw the potential. “Jacob is exactly what you want in a football player,” says Ashby. “He has great feet, and moves very well. He is a very hard worker, and has an incredible inner drive. He is a great representation of Torrey Pines High School.” After his one season of freshman football, Alsadek started on the varsity offensive line as a sophomore.

Continuity in the Torrey Pines program has also been helpful for Jacob. “I’ve had one line coach, Josh Mihalenic, the whole time. It has been nice.” Mihalenic was also the

line coach when 6’ 1” 310-pound Daniel Murray (Torrey Pines, Class of 2010) earned a Division I scholarship to the University of Cincinnati.

“Jacob has been a pleasure to coach,” says Mihalenic. “He has realized the importance of working hard not only on the field or in the weight room, but studying video of himself and his opponents. He constantly is asking me to watch video with him and then when we are at practice to watch and see if he is doing what he wants to work on. His passion for what he is doing has made it easy to help him accomplish his goals.”

College scouts started visiting the Torrey Pines campus after Jacob’s freshman season. Dozens have come through Coach Ashby’s office the past three years to assess the young man. Ashby has phoned college coaches to discuss Jacob’s talents, while Jacob’s parents, Sophia and Louay, have taken him on recruiting visits or to college football camps. De-spite it all, earlier this year Jacob felt he wasn’t getting any traction. He had one scholarship offer. He had a great re-cruiting visit at Boise State, but head coach Chris Peterson told him, the problem is that “we’re a passing team, and your high school is a running team.” Boise State had 20 minutes of highlight videos of Jacob pancake blocking de-fensive lineman. Peterson told Jacob, “we don’t have much video of you pass blocking.” The colleges weren’t sure if the young player had the tools to back-pedal into blind-side pass protection.

At this point, some resources from the Torrey Pines Football Program came into play. Personal trainer Tommy Moring was introduced to the Torrey Pines football program

last season when Coach Ashby brought him in to assist with weight training. Jacob credits Moring with “changing my whole mentality, and approach to what I do.” Ed Stansbury, a former UCLA and NFL fullback, runs Next Level Sports. Stansbury had previously been a speed coach for the Fal-cons, and he works with a number of players, including for-mer Falcon lineman Murray. Conditioned by Moring, Jacob worked with Stansbury to put together a 5-minute Youtube “agility video.” The silent film shows the enormous young man skipping, hopping, moving laterally, jumping, and ba-sically dancing his way around cones and pylons simulating the lateral movement and skills needed to pass block at the Division I level.

“When coaches are looking at game film,” Stansbury explains, “they can see size and some technique. But, now many college coaches are taking things a step further. They want to see conditioning, work ethic, training, footwork, agility. There are so many different things that they are looking for that they can’t see in just a game film. That’s why we put the agility video together for Jacob.”

Alsadek credits the video with helping resolve doubts that college scouts were having about his mobility. After the video was posted, the offers started to flow in. Alsadek took nine formal and informal recruiting visits. “It came down to Colorado, Kansas State, Arizona State, Vanderbilt and Ari-zona,” he said. “Arizona was close to home. Coach Rodri-guez has a good resume. It felt like family when I visited. Everyone was real close.”

Alsadek has some unfinished business before he gets to Tucson: his senior football season. Of the Falcons, he says, “We’re putting in a lot of hard work. We’re hungry for a championship.”

Falcon’s Senior Lineman Jacob Alsadek (78), one of the biggest (6’ 7”, 330 lbs.) recruits in the country, has accepted an offer to play football at the University of Arizona. Photo/Anna Scipione.

In-demand TPHS football player working harder than ever to achieve his goals

Hard work in the weight room helped Torrey Pines Senior Offensive Lineman Jacob Alsadek land an offer to play football at the University of Arizona. Photo/Susie Talman.

Ice Cream Social at

RSF Library

The RSF Library cele-brated the conclu-sion of another

successful 2012 Summer Reading Program with an Ice Cream Social on Aug. 3.

The event included a juggler and a big raffle for all the participants of the reading program. PHOTOS/

JON CLARK

Ryan SchneiderIsabella Tone, Andrew Aarons Cooper VincikGeorgie Jarvis Kate Schneider


Ten-year ovarian cancer survivor lives life to the fullest — and educates others about the diseaseBY KATHY DAY

Some people facing a cancer diagnosis go into a deep funk. Others, like local resident Naomi Whitacre, tackle it head on – and then some.

Today, 10 years after finding out that she had ovarian cancer and nearly three years after learning she carried the BRCA1 gene, which has been tied to he-reditary breast and ovarian cancer, she said she does three things: She’s a human resources consultant, a vol-unteer for ovarian cancer and she lives “life joyously with friends.”

A self-described flower child who went to Wood-stock and put herself through college as a go-go girl, today she does yoga, spins, hikes, takes classes at the Bar Method in Solana Beach and loves to enter-tain at her “Round Table” dinners where friends “talk about anything and every-thing in life.”

She uses her own expe-rience — and boundless en-ergy — to inform others about ovarian cancer. And she’s not just focused on as-sisting other survivors, but helps medical students, nurses and nurse practitio-ners understand what pa-tients need. She also advo-cates for genetic testing and individualized treatments through the Clearity Foun-dation.

Oh, and in her “spare” time, she recently went on a three-week mission to as-sist AIDS-related orphans in Kenya.

Listen to the story about her cancer diagnosis and you’ll identify with her special appreciation for life.

“Fortunately, the can-cer was accidentally discov-ered,” she said on a recent afternoon sitting in her sun-bathed home.

She had been working out on the beach, but when she got home, she walked in the door with a 103-de-gree fever. Immediately she called her doctor, Lawrence Schlitt of Scripps Health. “I think he saved my life,” she said.

And her own decision eight years later to have ge-netic screening done to see if she had the BRCA1 gene likely saved her sisters’ lives, she added.

When she learned she had the gene, Whitacre im-mediately had a double mastectomy. After sharing the news with her sisters, her middle sister had her ovaries removed; when her baby sister went in to have her ovaries removed, they found high-grade fallopian cancer.

Soon, all three sisters are heading for Paris to cel-ebrate Whitacre’s 65th

Doing the splits is no problem for Naomi Whitacre, a local ovarian cancer survivor-turned advocate.

birthday and their own lives.

Needless to say, she’s become an advocate for ge-netic testing.

Early testing, knowing your body and demanding answers from doctors have become her watchwords.

“Put yourself first in-stead of taking care of ev-eryone else,” she said.

When she fell ill after that workout on the beach that day 10 years ago, her doctor said he suspected ap-pendicitis and told her to get to the hospital immedi-ately, but she replied that she was too busy. Set to leave for Europe and teach-ing classes in human re-sources at UCSD, she just couldn’t be bothered, she said.

“He said no, go now,” she said. “I was reluctant and annoyed” but headed for Scripps anyway.

An MRI of her abdo-men to check for appendi-citis revealed a cantaloupe-sized tumor that had formed around a fibrotic ovarian cyst. Three days lat-er Dr. Conlay Lacy and Dr. Bridgette Duggan removed the growth, which turned out to be stage 2C ovarian cancer.

That was followed by extensive intravenous che-motherapy and a “second-look” surgery to check to see if any microcells re-mained in her system.

Whitacre said 16,000 of the 22,000 women diag-nosed each year with ovari-an cancer die, but if detect-ed early the survival rate is 90 percent to 95 percent.

The problem, she not-ed, is that there is no early diagnostic test – and a PAP smear doesn’t test for it. In-stead, research has shown that a group of symptoms

can indicate the possible presence of the cancer. They include bloating, pelvic or abdominal pain, change in bowel movements, short-term weight loss or gain, and a feeling of being full af-ter eating only a little.

“Acute onset of three or more of those over one month is highly indicative of the presence of ovarian cancer,” Whitacre said, ac-knowledging that when she looked back at her own case, she had all of the indicators.

Many women ignore the signs, she added, be-cause they are “classic menopause realities.”

To reach a diagnosis – there are 30 variations of ovarian cancer — doctors utilize a rectal-vaginal exam, a transvaginal ultrasound or a sonogram or a CT scan fol-lowed by exploratory sur-gery in many cases.

Today the Clearity Foundation, founded by a physician diagnosed with ovarian cancer in 2008, is “on a quest to apply the knowledge of the genetic signature of ovarian cancers to improve treatment op-tions for patients,” accord-ing to its website.

Whitacre put their work in perspective: “For those that are not as fortunate, which are most women di-agnosed with ovarian can-cer, we need to be able to prioritize the next chemo choice from the various op-tions. There are multiple chemotherapy options and now clinical trial choices. We should do better than guessing for next-in-line treatment.”

Adding that “molecular profiling is now common on many cancers,” she empha-sized that “Clearity has brought this to ovarian can-cer at no charge to the pa-

tient.”In addition to spreading

the word about Clearity, Whitacre facilitates a group of survivors who speak to third-year medical students at UCSD, as well as nurses and nurse practitioners in training to help them con-nect the disease with the

person.“We are the first pa-

tients they will talk to in their educational pro-cess,” she said. “They are interested in our stories and how we found out, as well has how to tell us (patients that they have cancer) and how to treat us,” she said.

Eighty medical schools are involved in the program through the Ovarian Cancer National Alliance.

Whitacre, who lived in New York and devel-oped drug education programs for the New York City schools, moved to this area 36 years ago when her son – now a “wonderfully, eth-ical, kind and brilliant quantum physicist” – was born. After arriving here, she tried to find similar work but instead took a position as a tem-porary receptionist in a personnel department. She rose to become se-nior vice president of human resources, retiring in 2005.

But “retired” she’s not. At 63, she’s a fireball who can still do the splits and just wants women to pay attention to their health.

“When you think something is wrong, it probably is,” she said.

For more information: www.clearityfoundation.org or www.ovariancancer.org.

At UCSD Medical Center where Whitacre and colleagues presented the Survivors Teaching Students: Savings Women’s Lives program to third year medical students. Above, clockwise from left, survivor Cindy Breed, Coronado Councilwoman Barbara Denny, Whitacre, and survivors Kathryn van der Broek and Kathleen Murray.


ASAP URGENT CARE

We get it.It’s about time & money.

Walk-in without an appt.See our doctor.

Get 30% off.Walk out in 30-40 min.*

*(average)Hard to believe?

Come see for yourself.

Medical Caredoesn’t get

much simpler.

Dr. Matt Kurlan,emergency physician,

sees every patient.

519 Encinitas Blvd. #106 Encinitas, CA (760) 230-2727

www.asapUC.com

Just 1/4 mi. East of I-5. Open weekends.

lam.eal

JAGUAR SAN DIEGO4525 Convoy · San Diego, CA 92111

888.355.5246 · www.jaguarsandiego.com

SAN DIEGOSAN DIEGO

1. On above average approved 730+ credit through Jaguar Financial. Based on MSRP $53,875. $4999 + $795 acquisition fee due at signing. 42 Months/10,000 Miles a year, 0.30c excess mileage charge. Offer expires 8/31/12 prior rental Vin #S34699 · 2. On above average approved 730+ credit through Jaguar Financial. Based on MSRP $75,075. $4999 + $795 acquisition fee due at signing. 42 Months/10,000 Miles a year, 0.30c excess mileage charge. Offer expires 8/31/12 prior rental Vin #V28929

BALBOA AVE

CO

NVO

Y S

T

36 mos lease for

mo +tax

2012 JAGUAR XF42 mos lease for

mo +tax

$499$6992012 JAGUAR XJ

1

2

Complimentary Oil Filter Change with Multi Point Inspection

$0Valued at $89.99

*add $15 for synthetic oil. No cash value. Not valid with any other special or offers.Must present at time of write up.

Exp. 8/31/12. For Jaguar vehicles 1900 and later.

SAVE YOUR TIRESComplimentary Alignment Check with

Multi Point Inspection. Discounted price of $129 will be applied if a

4-wheel alignment is needed.

$0Valued at $59.95

No cash value. Not valid with any other special or offers. Must present at time of write up. Discount available if adjustments are needed. For Jaguar

vehicles 1900 and later. Exp. 8/31/12.

world record price for a mare in training at that time, $725,000 for Typecast, one of the great race mares of her day and a champion. (Jones was the founder of Computer Sciences in El Se-gundo, not the car dealer of the same name.)

In addition to sales management all over the world, Baugh International has helped individuals and groups buy racehorses. Baugh has syndicated a number of horses for stal-lion duty, doing a lot busi-ness particularly in Japan. Baugh International has sold several prominent racehors-es for stallion duty in Japan, beginning with Forty Niner and including Kentucky Derby winners Silver Charm

(1997) and Charismatic (1999).

“One summer, we were invited to spend the sum-mer in Deauville, France,” recalled Bonnie. Deauville is a track by the sea which also conducts a summer race meet. “Bill McDonald intro-duced us to a wealthy finan-cier, Alan Clore. We handled his dispersal in 1982. We sold a yearling for him, named Rainbow Quest. He won the Prix de l’Arc de Tri-omphe in 1985, a premier race in France.”

By embarking on a ca-reer in racing, the Baughs have enjoyed their own sort of “The Road Not Taken,” a poem by Robert Frost. The poem ends with the line, “I took the one less traveled by, And that has made all the difference.”

LIFEcontinued from page 13

When they first asked her to star in the TV spot where she also appears in jockey-style fashion, they were unaware of the Vanity Fair shoot, Meads said. The magazine photograph circu-lated throughout social me-dia and raised Sutherland’s celebrity profile so even though the timing was coin-cidental, it helped the cam-paign, he said.

When MeadsDurket takes on a new client they “dive in deep” to learn about company culture, val-ues and what message the client wants to present to the public, Meads said. All these things add ingredients to the main recipe that Meads and Durket develop. It’s building the brand, an advertising buzz word that Meads agrees seems ubiqui-tous these days but he says means a number of things to different people.

“For design studios of-ten times it just means a logo. For us, it’s really more the essence of who the com-pany is and how they speak. It can come down to the way that the automated phone message is produced or the uniforms or the envi-ronment is designed. All of

those things to us speak brand.”

Meads said it’s impor-tant to get the client on board with a campaign be-cause they must take the lead on internal changes.

“We take it to a pretty deep level. Often times, I would say that 50 percent of the recommendations that we ultimately make to a cli-ent we don’t execute be-cause a number of them are internal” and they have to do it the way they operate, Meads said.

How a company can tell when it’s time to seek outside help varies among clients, but one thing is al-most certain, said Meads, it doesn’t happen when a company is doing great.

“Usually there’s a prob-lem,” he said. “It’s like going to the doctor. Usually there’s a slippage in business, there’s a change in philoso-phy, there’s a change in per-sonnel. Something triggers the contact of a company like ours,” Meads said.

Typically a client be-lieves strongly in its product but can’t figure out the best way to express its value to the market. The client needs a new way to talk about what the company does or what it sells — that’s where Meads and Durket offer their expertise.

Solutions can be as sim-ple as looking at past com-munications and realizing that more consistency is needed to present an under-standable message to the public and potential cus-tomers. Other times it’s re-acting to the new kid on the block who has changed the competition in the market, Meads said.

“It’s absolutely honest and it comes from the cli-ent,” Meads said. “We’re not fabricating a philosophy on a client. We’re trying to un-cover and understand what they are already doing really, really well and then articu-late that.”

What MeadsDurket pro-vides “goes way beyond ad-vertising,” explained Durket, with a central creative idea that drives all communica-tion for a company. To bring the brand alive Meads and Durket will collaborate with other companies who have various expertise, for exam-ple, in digital graphics or an-imation or videography.

“One of our strengths has always been to pull to-gether the best resources to execute our ideas,” Durket said.

That’s why they chose photographer Michael Elins to work on the pin-up art done for the this year’s Del

Mar Racetrack.“We basically sought

out the number one pin-up artist (photographer), I would say, in the world and asked if he would be inter-ested,” Durket said. “Usually if it’s a really good idea, they’re interested…We couldn’t have picked a bet-ter person.”

The duo created famil-iar advertising campaigns in San Diego for clients that in-clude utility company SDG&E, Pick Up Stix Restau-rants, California Coast Cred-it Union and local auto deal-ers Honda and Jaguar Lan-drover in Carlsbad. Their vi-sion for their own future is to be successful but not so much so that they lose touch with what they enjoy most.

“We like being a little smaller where Tony and I can both be intimately in-volved with our clients,” Meads said. “So we don’t want to get too big. But on the other hand, we are al-ways looking to grow and expand and find new inter-esting and creative opportu-nities.”

To see an example of the Del Mar Racetrack cam-paign and other works by MeadsDurket go to http://www.meadsdurket.com/.

ADcontinued from page 11

Bunky is a 3-year-old male Chihuahua mix who weighs almost 14 lbs. He is playful and energetic, enjoys a rousing game of fetch, and showing you how much fun he can have with his toys. Meet this pint sized super star by asking for ID#A1471189 Tag#C142. He can be adopted for $69. Bunky is at the Central County Shelter, 5480 Gaines Street, San Diego. Visit www.sddac.com; 619-767-2611 for more information.

County Pet of the Week


Led by Coach Malcolm Tovey, the RSF Attack B96 Green Soccer Team participated in the San Diego Surf Cup on the weekend of July 28-30. The team won their bracket after the needed clutch victory of 2-0 against HSC Bulls from Hawaii.

In the semi-finals, RSF Attack dominated against Davis SC Legacy with a score of 5-1. The team advanced to the finals facing CZ Elite, a team from Los Angeles. It was a well matched soccer game. Each member of the RSF B96 Green participated at their best. The fi-nal game was tied 0-0 until the last minutes of the game when CZ elite scored. Being in the finals of the Surf Cup showed the consistent efforts of the RSF B96 Green team. Coach Mal-colm Tovey dedicated the team’s accomplishment in memory of Sedef Esener, who inspired the team to evolve with the strength it has now.

L-R: Collin Scott, Ryan Brent, Eren Esener, Chaz Laforett, Matt Coughlin, Coach Malcolm Tovey, Jesus Vargas, Ricardo Gonzalez, Andres (Oscar) Pedro, Aron Herrera, Saul Resendiz, Omar Garmadia, Austin Ronningen, Chris Alleyne, Andrew Sinow, Austin Lee, Robert Olea-Estevez, Connor Link. Not in picture (Cristian Marsella, Alex Portillo)

RSF Attack B96 Green team competes in close final at San Diego Surf Cup 2012

Cool Creatures, Crafts and Cooking, My First Lab, and Theatre Camp the week of Aug. 13-17!

Robb Daly, one of our favorite, multi-talented instructors is back by popular de-mand. His “Cool Creatures, Crafts, and Cooking Camp” will have kids enjoying the best of everything as they interact with amazing animals, create cool crafts and pre-pare yummy food creations. Robb ends the week with a pizza party for the kids and par-ents are invited too!

Madd Science is offering “My First Lab” Camp for Pre-K and Kindergarten aged chil-dren. This is a great introduction to science and children will explore their sense of sight, sound, smell, taste and touch. Camp-ers will also explore the science of the sea, become mini paleontologists and explore the planets, moons and stars!

North Coast Repertory Theatre camp at the RSFCC! Children will develop, ex-plore, and communicate ideas and feelings through imagination and creative play while creating a drama based on a short story or fairy tale. Included are theatre and improvi-sational games, fun competitions, and a dai-ly music workshop. A final performance is presented for parents on the last day of camp, Aug. 17.

Our own “Camp Rancho!” offers “Around the World in 5 Days Week!” This camp runs Monday through Friday, Aug. 13-

17. We’ll be taking campers to Old Town, Little Italy, Inflatable World, the beach, and we’ll even tour the San Diego Airport. It will be another great week, so do not miss out! Your child may sign up for one day at a time or for the whole week. Spots fill up fast, so be sure to register early.

Ages: 6-129 a.m. - 3 p.m.Full Week $250Daily - $60Field Trip Day- $85Extended care offered 8-9 a.m., and 3-5

p.m., at $15/hr.For more information, please call us at

858-756-2461 or visit our website at www.rs-fcc.org

Upcoming events at the RSF Community Center

Community coordinators wanted for student exchange programWorld Experience, a nonprofit teenage student exchange program, is seeking commu-

nity coordinators to find host families and schools in the U.S. for exchange students. Pay-ments are made for home interviews, reference checks, orientations, and supervision of stu-dents and families. Coordinators can earn up to $800. Must be willing and able to pass a criminal background check and DOS (Department of State) certified. Training seminars and on line instructions are provided. Call Julie 1-800-633-6653; www.worldexperience.org


Tent SaleThursday, August 16 - Saturday, August 18

AT OUR CARMEL VALLEY/DEL MAR LOCATION

THURS-SAT: 10AM - 6PM

12750 CARMEL COUNTRY RD.#113 • SAN DIEGO, CA 92130 • T 858.509.5948

der such circumstances and is a risk management princi-ple stating that efforts to minimize potential risks should be taken when the magnitude of the risks is un-known. The principle was proposed in 1989 in the context of electromagnetic radiation safety.

Despite this, at the June 21 school board meeting a resolution passed 5-0, with little discussion by board members according to Dill, of the intent to grant Sprint an easement to erect and operate three sets of four an-tennas each “encapsulated within the exterior wall sys-tems” at Canyon Crest Academy.

The June 21 approved resolution was a first read-ing. The second and final reading was originally scheduled for the following month, at the board’s July 26 meeting, which would have sealed the deal.

This nearly happened, and likely would have, had it not been for the efforts of a few members of the com-munity, notably Laura Cop-ic, CCA parent and member of the Carmel Valley Plan-ning Board, who was alarmed enough to bring the issue front and center.

On June 28, the second time the issue came before the Carmel Valley Planning Board, the project was voted on and unanimously op-posed. [see sidebar]

Despite this, the City of San Diego approved the project on July 2.

“Our review of the proj-ect is for compliance with the regulations of the Mu-nicipal Code, and based on the project’s compliance with these regulations, the project was approved,” said Alex Hempton, associate planner for the City of San Diego’s Development Servic-es Department, in an email.

Hempton referenced the Telecommunications Act of 1996 which prohibits cit-ies from denying a wireless communication project based on health-related is-sues. (The travesty of this clause in such a far-reaching piece of legislation cannot be overstated.)

The city’s approval grants Sprint a permit to “construct, operate and maintain a Wireless Com-munication Facility (WCF) consisting of 12 panel an-tennas mounted on an exist-ing school building behind radio-frequency transparent screening with equipment located adjacent to the building,” according to the city’s permit for the project.

The plan for the 12 an-tennas shows four antennas on the north side of the “F” building which houses class-rooms, and eight antennas on the “G” building – four on the west side and four on the south side. The F and G buildings surround the stu-dents’ food court. Plans call for an equipment box in-stalled next to the G build-ing.

Dill said the walls on both buildings extend above the roof line and the anten-nas would be mounted on top of the roofs but behind the parapet walls, so Sprint “won’t have to worry about putting up a fake tree, hav-ing the big ugly tower, those sorts of things.”

The focus on aesthetics stems from the Telecom Act which allows government agencies to object to the placement of cell towers based on visual but not health impacts. Hence, such deep, heartfelt concern by providers for aesthetics.

All this for only $2,800 per month, or $33,600 per year – about the price of half a teacher. With an automat-ic increase of 3 percent an-nually, Dill said the revenue would come to about $625,000, but over 15 years.

Growing oppositionCarmel Valley resident

and CCA parent Richard Kahn, in a letter to Noah dated July 13, objected to the proposed deal, saying, “It looks like a sneak attack from the public perspective. This behavior is not what would be expected from the San Dieguito School District who has in the past had a reputation of being highly respectful of the community and their sentiments.”

Kahn, a professional in the field of customer protec-tion and safety from prod-ucts that emit various forms of radiation, said that FCC standards in the United States are “lenient compared to other countries where standards are up to 10,000 times stricter.”

Citing growing opposi-tion in the community, Kahn wrote, “We cannot un-derstand the school district’s decision to push forward their project in defiance of unanimous opposition by [the] CV Planning Board.”

Noah, according to Kahn, never replied to his letter until weeks later, when, unbelievably, Noah wrote, “I am baffled by your reference to ‘growing oppo-sition.’ My question is, ‘To what?’”

After recognizing at last that there was indeed “growing opposition” to the project as news spread, Noah backed off from the plan to present the final res-olution to the school board at its July 26 meeting. It was tentatively scheduled to come back to the school board at its Aug. 16 meeting, but that too was delayed, this time indefinitely.

Noah, who expressed surprise at the reaction of the community, said, “My preference at this point, and what I’m directing, is I want it off the agenda for the time being.”

The next step, he said, would be “to have a conver-

sation with the board about whether or not pursuing an opportunity to put cell ar-rays or cell towers on cam-puses is something we want to pursue.” This discussion, he said, would be general in nature and not specific to any one school site.

If yes, conditions for such projects and reviews of studies and scientific evi-dence examining health and safety risks would be dis-cussed. If the board rejects the idea completely, “then that would come off the ta-ble for future consideration for a revenue enhancement for the district,” Noah said.

Gosh, wouldn’t if have been nice for board mem-bers to have had this con-versation before voting unanimously to proceed with the CCA/Sprint proj-ect?

Although the revenue from this project was al-ready listed in a board report Noah gave to trustees in June, it has now been re-moved.

What’s frightening about this backpedaling is that it indicates that there was no discussion around health and safety consider-ations prior to this near-deal, given that the project has been in the works for two years and that the mon-ey was already being count-ed.

Nevertheless, the matter will not be brought before the board again in the im-mediate future. Not exactly a mea culpa, but at least the district appeared to be em-bracing the precautionary principle of “prudent avoid-ance” regarding radiation emissions near children, and has promised to provide bet-ter notification to the com-munity next time.

Congratulations to all those who brought this proj-ect down. Score one for community activism.

Marsha Sutton can be reached at [email protected].

TOWERScontinued from page 18

BY MARSHA SUTTONAt the Carmel Valley Planning Board’s July 26 meeting, the

board voted to submit a letter to the San Dieguito Union High School District explaining its unanimous opposition to the pro-posed installation of 12 cellular antennas at Canyon Crest Acade-my and urging SDUHSD superintendent Ken Noah and school board members to “consider the community’s concerns before en-tering into this agreement and any future agreements for wireless communication facilities.”

In the letter, the planning board cited a lack of due diligence in notifying the community of the project, noting that a May 23 notice in the North County Times was inadequate.

“We don’t feel the school’s duty to notify impacted parents, teachers and students was fulfilled,” the letter reads.

The planning board also recommended that the district in-stall antennas “away from classroom buildings and well-trafficked parts of the school where students and teachers might encounter long-term low-level exposure.”

Although cities and community planning boards cannot by law oppose such projects based on health and safety factors, “the school district is not prohibited from using good judgment in the prudent placement of these facilities on their own property,” read the letter.

The letter referred to resolutions passed by the Los Angeles Unified School District that acknowledge “considerable debate and uncertainty within the scientific community as to the potential health effects to individuals, especially children, from exposure to extremely low frequency electromagnetic and radio-frequency ra-diation ...”

Noah said the letter opposing the project from the Carmel Valley Planning Board carried “some weight” but “my concern is that the Carmel Valley Planning Board stepped out of its statutory lines of authority in terms of making the recommendation. They are supposed to rule on certain criteria, and they went to what they perceived to be a safety issue.”

Carmel Valley Planning Board member Laura Copic, a leading opponent of the project, said the representative for Sprint was asked to consider placing the towers away from classroom build-ings, on the far corners of the athletic fields. At Torrey Pines High School, for example, a cellular tower exists but is located by the tennis courts, well away from all classrooms.

Copic was told that it was the school district that did not want to consider other locations. But Eric Dill, SDUHSD’s associate superintendent of business services, said it was Sprint that chose the classroom buildings, after rejecting the fields and the parking lot.

The field area was eliminated, Dill said, because there is no power or existing buildings or stadium lights upon which to mount the towers, so towers would need to be constructed, cam-ouflaged and powered. The parking lot was also rejected for height limitations and lack of sufficient power.

“So they settled on their ideal location of being on top of the buildings,” Dill said. Primary reasons were the access to existing power and a building design that hides the equipment from view behind roof parapets.

“That’s really a matter of aesthetics,” Dill said. “Those are things that the planning boards generally don’t want. They don’t want to see them.”

Dill said the school district has been in discussions with Sprint for about two years on this project. “They’ve been looking at Canyon Crest Academy and where potential sites could be and where they would be most beneficial for the coverage that’s need-ed in that area,” he said. Although neither the Solana Beach School District nor the Del Mar Union School District have wire-less equipment on their school sites, Dill said other school districts have accepted cell towers and antennas, including Poway.

“We’re not breaking any new ground here,” he said.

CV Planning Board’s letter opposing Sprint project at high school


Matthew Malvey, AllianceBernstein manager, will speak at the next “Coffee and Conversation event” on Thursday, Aug. 16, from 8-9 a.m. at the RSF Golf Club.

Malvey will talk about the municipal market and why having an ac-tive manager is prudent in today’s environment. High-yield munis are is-sued by state or local governments to fund specific public projects, such as airports, highways and hospitals. Payments to bondholders come from revenues of private companies associated with these projects — not from a municipality’s general tax revenue. On average, high-yield municipal bonds have offered 3.4 percent more yield over investment-grade municipals over the past five years. Learn how a diversi-fied municipal bond portfolio can generate high after-tax income and total return for inves-tors. A broad universe of high-yield and investment-grade municipal bonds may enhance income and help manage risk.

Malvey has been with Bernstein 15 years. He was based out of New York City where he worked with the Global Fixed Income team as a Managed Solutions consultant. Alliance-Bernstein manages over $200 billion in global fixed income assets worldwide. Malvey holds a bachelor’s degree in business management from the State University of New York at Stonybrook and holds the CIMA and CRPC designations.

To attend “Coffee and Conversation,” contact Deana Carter at (858) 756-1566 or [email protected]. The Rancho Santa Fe Country Club is located at 5827 Via De La Cumbre in Rancho Santa Fe.

• Guest speaker topic: “Tapping a Broad and Deep Universe to Seek Tax-Efficient High-Income”

Next ‘Coffee and Conversation’ event to be held Aug. 16 at RSF Golf Club

Edward A. Dennis is Distinguished Professor of Chemistry and Biochemistry, and of Pharmacology in the School of Medicine at UCSD. He received his BA from Yale University in 1963, a Ph.D. from Harvard University in 1967, a Doctorate in Medicine (honor-ary) from Goethe University in Frankfurt in 2008, and he served as a Research Fellow at Harvard Medical School 1967-69.

At UCSD, Dr. Dennis has served as Chair of the Department of Chemistry and Biochemistry, Chair of the Faculty Academic Senate, and on the Board of Overseers. He has also been a Visiting Professor at several universities and is an adjunct professor at The Scripps Re-search Institute.

He has authored 350 research publications, patented 15 inven-tions, and edited 13 books. Dr. Dennis was named an inaugural Fellow of the American Association for the Advancement of Science (AAAS) in 1984, and was the recipient of the American Society of Biochemistry and Molecular Biology’s Avanti Award in Lipid Enzymology in 2000, the European Federation for Lipid Science and Technology’s Eu-ropean Lipid Science Award in 2007, and Yale University’s Yale Medal in 2008.

Who or what inspires you?I’m inspired by the creativity, curiosity, and inventiveness of the many outstanding ed-

ucational/research institutions of La Jolla. If you hosted a dinner party for eight, whom (living or deceased) would you invite?It would be a potluck six-course dinner, hosted by my wife and I with six memorable

chefs, both past and present, each bringing their favorite dish. The list of chefs includes Ju-lia Child, Pierre Troisgros, Tetsuya Wakuda, Alex Atala, Eric Pras and Thomas Keller.

Tell us about what you are reading. ”The Entrepreneurial University,” a recently published book about the leadership of

Dick Atkinson, former Chancellor of UCSD and president of the University of California. What would be your dream vacation?A flying tour of the greatest vineyards of the world starting in California and progress-

ing south to Argentina and Chile, west to New Zealand, across Australia, on to South Africa, then to Germany, and finally, France.

What are your five favorite plays of all time?My favorite stage productions are “A Walk in the Woods,” “Jersey Boys,” “I Am My

Own Wife,” “Memphis,” and “Blood and Gifts” — all created at the La Jolla Playhouse! What is your most-prized possession?My wife (who is a partner and NOT a possession!) What is your motto or philosophy of life?Keep actively involved in the communities in your life.

Edward Dennis takes scholarly approach to long career in science

Edward Dennis

760.753.62561425 Encinitas Boulevard

Encinitas, CA 92024www.cookvw.comwwwwwwwwwwwwwww www.w.w.w.w.cocococococococ okokokokokokoko vwvwvwvwvwvwvwvw cc.c.c.c.c.comomomomomomomm

All prices exclude government fees and taxes, any fi nance charges, any dealer document processing charge, any electronic fi ling charge, and any emission testing charge. No money down, 0% APR for 66 months,

with approved credit. Subject to prior sale.

Offer expires 8/26/12

Drive Yours Today at

3 years or 36,000 miles ofNO-CHARGE Scheduled Maintenance

on Every 2012 Volkswagen(Terms and conditions available. See Dealer for Details

Whichever occurs fi rst. Some restrictions.)

45th AnniversaryCelebration Sale

ENCINITAS1435 Encinitas Blvd. 760.753.6256

$450 DISCOUNT* Valid only when used toward the purchase of any Volkswagen from dealer stock. Prior sales excluded. Not valid for parts or service. Valid at participating dealer only. NON-NEGOTIABLE, ONE VOUCHER PER PURCHASE OR LEASE, EXPIRES 8/26/12 . DON’T SHOW YOUR VOUCHER TO YOUR SALES PERSON UNTIL AFTER YOU’VE MADE YOUR BEST DEAL!

2012 EOSKomfort, Automatic

2012 BEETLE TURBO

2012 JETTA S

One at this

Price One at

thisPrice

One at this

Price

MSRP ....................................... $34,910FACTORY TO DEALER INCENTIVE ....... - $1,000HERMAN COOK DISCOUNT ...............$1,50045TH ANNIVERSARY COUPON .......... - $450

NET COST .................$31,960One at this price #011285

MSRP ....................................... $25,995FACTORY TO DEALER INCENTIVE ....... - $1,000HERMAN COOK DISCOUNT ...............$1,00045TH ANNIVERSARY COUPON .......... - $450


MSRP ...................................... $17,750FACTORY TO DEALER INCENTIVE ....... - $1,000HERMAN COOK DISCOUNT ............. $1,00045TH ANNIVERSARY COUPON ........ - $450


Automatic

Manual Transmission 66 MONTHS0% APRON ALL 2012 GAS MODELS

Not in conjunction with VW Rebate

Augu

st 18th - August 26th

MON-FRI-8-8 • SAT 9-9 • SUN • 10-

5

9DAYSONLY

V O L K S W A G E N


MainStreet Communications, L.L.C.Publishers of Rancho Santa Fe Review

Gold Ink Award Winner, California Newspa-pers Publishers’ Association Award Winner, Independent Free Papers of America Award

Winner, Society of Professional Journalists Award Winner

Rancho Santa Fe Review

3702 Via de la Valle Suite 202WDel Mar, CA 92014858-756-1403

www.rsfreview.com

MainStreet Communications, L.L.C.Publishers of Rancho Santa Fe Review

Gold Ink Award Winner, California Newspa-pers Publishers’ Association Award Winner, Independent Free Papers of America Award

Winner, Society of Professional Journalists Award Winner

Rancho Santa Fe Review

3702 Via de la Valle Suite 202WDel Mar, CA 92014858-756-1403

www.rsfreview.com

PHYLLIS PFEIFFERPublisher

LORINE WRIGHTExecutive [email protected]

KAREN BILLINGSenior News Writer

CLAIRE HARLINAssociate Editor

MARSHA SUTTONSenior Education ReporterDON PARKS Vice President of AdvertisingANNA MITCHELL, SARAH MINIHANE, COLLEEN GRAY, ASHLEY GOODIN, CHRISTINA RAINE, KALI STANGER, MICHAEL RATIGAN, KATHY VACA, ASHLEY O’DONNELL

AdvertisingDARA ELSTEIN

Business ManagerBEAU BROWN

Art DirectorJENNIFER MIKAELI

Lead Graphic ArtistSCOTT REEDER Page DesignerJoe Tash, Catherine Kolonko, Suzanne Evans Frank La Rosa, Keith Kanner, Arthur Lightbourn, Ruth Godley, Diana Wisdom, M’Lissa Trent, Ph.D., and Hanalei Vierra, Ph.D., Kelley Carlson, Gideon Rubin

Contributors

OBITUARIES: 858.218.7237 or inmemory@myclassifi edmarketplace.com

LETTERS POLICYTopical letters to the editor are encouraged and we make an effort to print them all. Letters are limited to 200 words or less and submissions are limited to one every twoweeks per author. Submissions must include a full name, address, e-mail address (if available) and a telephone number for verifi cation purposes. We do not publish anonymous letters. Contact the editor for more information about submitting a guest editorial piece, called Community View, at 400 words maximum. We reserve the right to edit for taste, clarity, length and to avoid libel. E-mailed submissions are preferred to [email protected]. Letters may also be mailed or delivered to565 Pearl St., Ste. 300, La Jolla, or faxed to (858) 459-5250. LETTERSPOLICY

dining area.Chatfield said the ren-

ovations will begin in ear-nest after Labor Day, and the goal is to complete the work by Memorial Day 2013.

“The bones are there,” said Gordon MacMitchell, the hotel’s new general manager. “It’s a very unique and special product now, and it will be a whole new ball game 10 months from now.”

Association board members said they are pleased to see the invest-ment the new owners are making to upgrade The Inn, and looking forward to seeing the completed work.

“Many of us can’t wait until you upgrade those rooms to put our in-laws in there,” said board president Roxana Foxx.

According to the staff report, the work approved in concept by the Associa-tion board includes:

•Front lawn, which faces the Village: Alteration to plantings; creation of ad-ditional seating areas; addi-tion of hardscape; and slight leveling of a lawn for functions.

•Interior garden courts: Landscaping and hardscape are proposed to be renovat-ed in several interior court-

yards for the purposes of improving the appearance; screening guest spaces; cre-ating locations where wed-dings could be held and improving pedestrian circu-lation; creation of a chef’s garden for classes and al-fresco dining; tie-ups for trail riders.

•Azalea court (off La Gracia): Adding enhanced paving; adding trellises to facades; landscaping.

•Pool area: Slightly en-large the Jacuzzi; enhanc-ing an arched entry; remov-al of locker area.

Among the goals of the exterior renovations, said Chatfield, is to create places where guests can relax in an outdoor setting, includ-ing the addition of lawn furniture and outdoor seat-ing. Future plans could in-clude afternoon barbecues in which guests arrive via horseback on the Cove-nant’s trail system.

“We think that could really set us apart as a ho-tel,” he said.

In response to ques-tions from the board, John Kratzer, JMI president and CEO and a Rancho Santa Fe resident, said efforts are un-derway to aggressively mar-ket The Inn to potential customers. The new owners have also hired an expert in social media marketing to get the word out, said Mac-Mitchell, the general man-ager.

Part of the marketing effort will be promoting Rancho Santa Fe as a desir-able destination, Kratzer said. “Our greatest amenity is the geographic position-ing of the hotel in the com-munity,” he said.

Before launching the renovation effort, said Chatfield, JMI set up a team to focus on The Inn’s “branding,” and came up with the following key pil-lars, or elements to be em-phasized: comfortable, so-phisticated, romance, inti-mate, at the heart of the community, essence of Rancho Santa Fe.

As the renovation pro-gresses, Chatfield said, the efforts will be judged against those pillars.

JMI purchased The Inn in partnership with Siguler Guff, a New York-based real estate investment firm. JMI was founded by John Moores, owner of the San Diego Padres and a well-known businessman and philanthropist. The com-pany is now owned by Moores and Kratzer, accord-ing to JMI’s website, with offices in San Diego and Austin, Texas.

Among the company’s major projects was develop-ment of downtown San Di-ego’s ballpark district around Petco Park.

and July. Philpott said chopped-

up parts of the Ford GT, as well as one of the intact Porsches, were found in the back area of a business in

North County.About two-and-a-half

weeks later, almost all of the rest of the Ford GT was found at a storage facility about a block away from the other business, the prosecu-tor said.

Information was devel-oped that led investigators

to a second stolen Porsche, Philpott said.

Philpott said the theft of such a unique and expen-sive car — only 4,038 were manufactured in 2005 and 2006 — is rare.

``There’s not a whole large market out there for vehicles as rare as a Ford GT

like this one,’’ the prosecu-tor said outside court. ``They’re not that easy to turn around and sell and you can’t really drive around the streets in them so that type of thing is something that we don’t see very of-ten.’’

The defendants are also

charged with being in pos-session of stolen property, other than the vehicles.

A readiness conference was set for Aug. 15 and a preliminary hearing for Aug. 23.

reported.Of the reported burglar-

ies, 11, or just under half, involved forced entry, in which the burglars pried open a door or window, or picked a lock. In the rest of the cases, he said, the in-truders simply came in through an open door or window.

Some residents may have grown complacent be-cause of the relatively low crime rate in the Ranch, he said.

“Harden your target. Lock your house and turn the alarm on. That’s going to drive them somewhere else,” he said.

Wellhouser also urged residents to call the Patrol or San Diego Sheriff’s Depart-ment if they see anyone who doesn’t belong in the neighborhood.

Sheriff’s Detective Sgt. Clayton Lisk, who is as-signed to the department’s Encinitas station, said bur-glars often walk around resi-dential neighborhoods and knock on doors to find out if anyone is home. If they determine the home is un-occupied, they break in, he said.

“We just need to get out there and talk to these peo-ple and find out what they’re doing,” Lisk said.

“Call us, call us, call us. Don’t wait until the next day, call us right away,” Lisk said.

In most cases, Lisk said,

police have no suspect infor-mation to work with be-cause the homeowners were out at the time of the break-in. That’s what makes it im-portant, he said, for resi-dents who do witness suspi-cious activity to call police.

Wellhouser said it ap-pears many of the Rancho Santa Fe burglaries are relat-ed, based on such factors as the method used to break in the homes — when forced entry has occurred — and the type of items stolen, such as jewelry and elec-tronics.

In one case, he said, four people were arrested when they spent the night in a vacant house after bur-glarizing the property.

Those four suspects were later linked to other burglaries in Escondido and San Marcos, said Lisk.

In another high-profile case, a rare Ford GT, valued at $250,000 was stolen dur-ing a burglary at a Rancho Santa Fe home. Last week, police arrested two suspects in the theft.

Wellhouser said resi-dents should also keep good records of their property, in-cluding serial numbers and photos. That can help them get their property back if it is stolen, and also links po-tential suspects to specific burglaries.

Residents who see a sus-picious person or vehicle can call the Rancho Santa Fe Patrol at 858-756-4372, or the Sheriff’s Department’s non-emergency number, 858-5765-5200.

INNcontinued from page 1

THEFTcontinued from page 1

CRIMEcontinued from page 1

ers, educators, Roger Rowe Superintendent Lindy Del-aney and Principal Kim Pinkerton, as well as parents representing all of the Ran-cho Santa Fe schools.

The event proved to be successful, and another one was held the following month at The Inn at RSF featuring a speech by Attwood, a New York Times best-selling author. She took invitees through a process created to help people dis-cover their passions and life

purpose, a key component of Giving Tree Movement’s platform.

Most recently, on July 18, the first moderated par-ent focus group was held, with Indigo Village founder and President Susie Walton and Teen Wisdom founder Tami Walsh, and moderated by Csathy at her home.

Still in its “beta” phase, there are plans for the Giv-ing Tree Movement to branch out. Csathy ex-plained that the grassroots organization is taking a building block approach of step-by-step ideas and activi-ties, with the goal of bring-

ing families together to fo-cus on their internal struc-ture and success, as well as on community enrichment through leadership and mentorship opportunities.

“What we’re doing within the four walls of the home is absolutely critical to the success of families and our children,” Csathy said.

There will continue to be lectures, along with “trust circle” forums in which individuals can dis-cuss issues in a confidential environment.

“Parents will have an

opportunity to talk, open up, and have a venue where they feel supported and find solutions,” Csathy said.

She is also organizing “Family Success Bootcamp” Summits in which thought leaders, youth organizations and inspirational speakers will come together in panel discussions that will address the struggles that parents face in raising children and provide solutions for fami-lies to make a difference in their homes and in their lives.

Csathy hopes that peo-ple go home and not only

talk to one another about what they’ve learned from these events and implement the ideas, but also to start talking with other families about them.

Eventually, she plans to roll out the program throughout San Diego County, with an ultimate goal of going national.

For more information about Giving Tree Move-ment, go to www.giving-treemovement.org or e-mail [email protected].

GIVINGcontinued from page 5


©2012 Coldwell Banker Real Estate LLC. Coldwell Banker® and Coldwell Banker Previews International® are registered trademarks licensed to Coldwell Banker Real Estate LLC. An Equal Opportunity Company. Equal Housing Opportunity. Owned And Operated By NRT LLC. Broker does not guarantee the accuracy of square footage, lot size or other information concerning the condition or features of property provided by seller or obtained from public records or other sources, and the buyer is advised to independently verify the accuracy of that information through personal inspection and with appropriate professionals. If your property is currently listed for sale, this is not intended as a solicitation. We are happy to work and cooperate with other brokers fully.

To view more Coldwell Banker listings go to www.CaliforniaMoves.com/RanchoSantaFe

Coldwell Banker Residential BrokerageWHERE HOME BEGINS | ESTABLISHED 1906 | NO. 1 IN CALIFORNIA

Encinitas | $1,100,000High-style 2,600 appx sf corner offi ce space in North Coast business park. Private bath & kitchen. Close to I-5, generous open spaces & parking.120012549 858.756.6900

Rancho Santa Fe | $2,395,000Custom Mediterranean 5 br, 6 ba, 4-car garage on 2.15 appx acres. Panoramic ocean & mountain views. Chef’s kitchen, wine cellar, infi nity pool/spa.120011209 858.756.4481

Solana Beach | $1,695,000Oceanfront, 180 degrees of whitewater. Newer remodel including Seawall, mahogany gates, doors, rails. Brazilian deck, ocean front master br/living rm.

110048729 858.756.6900

Rancho Santa Fe | $3,495,000Incredible west side Covenant location in gated enclave amongst acres of protected land. 6 br, 5.5 ba, 8,300 appx sf home w/pool and outdoor living.120038818 858.756.6900

Cardiff By The Sea | $2,295,000Gated property on appx 1 acre. Main house, designer perfect 1 br, 1 ba carriage house with ocean view, cottage with kitchen. Gardens & mature trees.120038670 858.756.4481

Solana Beach | $1,195,000Whitewater ocean views from fabulous remodeled 2 br, 2.5 ba condo. Huge balcony w/ BBQ area overlooking Del Mar beach. Back yard spa and patio.

110043917 858.756.6900

Rancho Santa Fe | $2,250,000Westside Covenant 5 br, 5.5 ba close to RSF Village & country club on 2.23 appx acres. Pool and spa, courtyards, patios, gardens, 3-car garage.120038437 858.756.4481

Encinitas | $1,925,000Knightsbridge 5 br, 4.5 ba, 5,012 appx sf estate w/offi ce & 1 br/ba down. Appx 2 acre lot w/pano views, pool, spa, blt-in BBQ, lush lawns & lower lot.120034752 760.436.0143

Like us on Facebook www.facebook.com/cbrsf | Follow us on Twitter www.twitter.com/realestatersf

FEATURED PROPERTY5530 Las Palomas | $1,295,000Rancho Santa Fe Covenant

Single level 3 br, 3 ba west-side Covenant home. Cozy brick steps lead to the timeless ranch house complete with golf course views. French doors and large bay windows, wainscot, built-ins and window seats. Harwood fl oors, vaulted beam ceilings, spacious rooms, brickpatio, lovely low maintenance grounds. Close to village/RSF School.

FEATURED AGENTPari Ziatabari

858.442.9940 | [email protected]

A resident of Rancho Santa Fe since 1989, Pari’s dedication in puttingher client’s needs and wishes fi rst has earned her awards of distinction within the real estate community for the last 23 years. Nothing falls short in her capability to make every transaction successful with the highest of client service.


“East meets West” in Rancho Santa FeStunning family compound in Tuscan Estates offering 5 bedroom main home,handsome wood panled library, billiard room, 1 bedroom guest villa with separate living room, organic vegetable gardens and orchard, inviting pool and spa with numerous water features, on over 2.5 sunbathed acres. Exotic and imported furnishings from around the world compliment this wonderful single story gated estate, which offers over approx 9500 square feet of living. Enjoy the access and convenience of west side Rancho Santa Fe living and feeling like you have stepped into a Balinese paradise!!!. Truly a One-of-a-kind treasure!

$28,000/monthMonica Sylvester

[email protected]

CA DRE #01313543

Peaceful Alcala OasisExceptional home in Rancho Santa Fe’s coveted community of Alcala. Beautiful fi nishes create a light & bright interior accented by gorgeous cherry wood fl oors and exquisite light fi xtures. Romantic & spacious backyard/patio along with master bdrm balcony face outside the complex to feel more like a detached home. Perfectly situated for peace and privacy, this is a very special opportunity!

Offered at $715,000

Ultimate Location. Ultimate Living. Ultimate Covenant.Remodeled in 2002, this 7,600 SF home features 5BD/5.5 BA and a 1BD/1BA guest house and pool/spa. Floor to ceiling walls of glass give views of the over 2 acre landscaped site from virtually every room in the house. Built for entertaining, this home can accommodate 200+ guests. Coveted west-side location within the Covenant; with a long circular drive and almost fl at usable acreage, this home makes a statement in every way.

Offered at $4,295,000

Deb Weir619-540-5487

[email protected] DRE #00825339

Availab

le for Le

ase

Tammy Tidmore and Kelly Pottorff858.756.0990

www.RSF.com CA DRE#’s 01441091, 01125260

Cutter & ChacoC l o t f e l t e r

858-342-3050clotfelterhomes.com

DRE #01247852 • DRE #01304520

First Time On The MarketRelive the romance of Alta California on this stunning & timeless 4.2 acre Monterey Colonial estate. Enjoy commanding faraway views over the Covenant & the perfect indoor outdoor fl ow to charming patios, several guesthouses, a resort pool, & an organic garden & orchard dripping with a bounty of fruits & veggies. This incredibly private gated estate is landscaped with such an array of specimen trees that it would certainly make Kate Sessions blush.Two separate detached 6 & 8 car garages Horse infrastructure. A idyllic lily pond. WELL WATER.

See it all at: www.rancho-del-lago-homes.com

Offered at $4,299,000

From Contemporary To Traditional & Everything in BetweenCall us today to craft your custom home from start to finish.

Weir Brothers Custom Homes • 16906 Via De Santa Fe, Rancho Santa Fe 619.992.6581 • www.weirbrothersconstruction.com

~Society~Section B August 9, 2012

Dan Greco, Gordon Larson, Bill Morrison

RSF Garden Club members spend the evening at the North Coast Rep.

Dick and Karna Bodman

Gilda Hill, Kelly Dunham

Ken Wood, Jeannie Botsford

Laurie Loesch, Higgi HuggenbergerTina and Michael Rappaport Shirley and Steve CorlessJohn and Dawnelle Tanner

Margaret Miller, Betty Harris

RSF Garden Club members met Aug. 2 at the North Coast Rep Theatre in Solana Beach for a

catered al fresco dinner outside on the patio. Members then went in-side for the musical production of “Dames At Sea.” PHOTOS/JON CLARK

RSF Garden Club visits North Coast Rep

Janet Christ, Nan Werner, Margaret Cavallin

Leslie Zwail and Toni Tschann from North Coast Rep

Bill Schlosser, Lenny Glass, Laverne Schlosser

B2 August 9, 2012 Rancho Santa Fe Review

FASHION SHOW AND LUNCHEON

Produced by: Leonard Simpson’s Fashion Forward™

Honorary Chair: Sally B. ThorntonHonoring: Raffaella & John Belanich and St. Madeleine Sophie’s Auxiliary

For tickets and more information, please call 619-442-5129 ext 332 or visit: www.HauteWithHeart.org

35th Annual

SPONSORS:

“Let the Sunshine In”

Haute with Hear t

August 18, 2012 10:00 am to 2:00 pmHilton San Diego Bayfront

Proceeds will benefit:

Q&A: It’s all about people and connections for engineer Karen BraileanKaren Brailean is CEO of

Barc, Inc., an Internet compa-ny enabling discovery and in-teraction. Its first product al-lows you to chat and post with everyone browsing the same website or Wi-Fi net-work.

Previously, Brailean was the CEO of Perseus Wireless, and was marketing vice presi-dent of mobile video products for Alcatel, and for Packet-Video. She also held engineer-ing and marketing positions with Motorola, Hughes Air-craft, and Eastman Kodak. She has eight mobile communica-tions patents.

Brailean received a bach-elor of science in electrical en-gineering from Purdue Uni-versity; an MSEE from Univer-sity of Southern California; and an MBA from the Univer-sity of Chicago.

She served as board chair for the La Jolla Music Society, 2007–2009; as founding member/board chair of San Diego Social Venture Partners, 2003–2005; and as a member of the San Diego Grantmaker’s Homelessness Working Group, helping to bring $13 million to aid the homeless in San Diego.

Brailean was a 2004-2006 season sponsor of Moxie The-

atre; a member of the Society of Women Engineers; of Glob-al Importune; of International Electrical and Electronic En-gineers; of Eta Kappa Nu, and is a life member of the Society of Women Engineers.

Who inspires you?My mother, who has fun every day and finds the time

and energy to help people, too.

If you hosted a dinner party for eight, who (living or deceased) would you invite?

• Hedy Lamarr escaped an overbearing husband to be-come a major contract star of MGM’s Golden Age in the 1920s. Not just a pretty face, Hedy also invented a complex algorithm for computer communications that is used in most communications today, including technology from Qualcomm;

• Angela Merkel, Chancellor of Germany, arguably the most influential person in the world right now, making de-cisions about the future of the European Union;

• Susan B. Anthony, who fought for women’s right to vote using grace and tenacity. She died a few years before we gained that right;

• Sheryl Sandberg, CEO and member of the board of di-rectors of Facebook. She’s credited with making Facebook profitable;

• My husband, he is great company and has an amaz-ing memory. He would remember everything everyone said.

• Franz Liszt, an 1800s pianist/composer who was wild-ly popular. Women would fight for his silk handkerchiefs, which they kept as souvenirs of his concerts. He donated much of his fortune to charity;

• Albert Einstein, he developed the theory of relativity, and wouldn’t it be amazing to hear his thoughts on physics, given what we now know? and …

• Jesus Christ, I don’t think he needs an explanation.

Tell us about what you are reading. My reading taste is quite eclectic. Here are two exam-

ples. I am in the middle of reading “Robopocalypse,” by Daniel Wilson, a scary but oh-so-compelling science fiction thriller. On the other end of the spectrum, I recently fin-ished, “Michelangelo and the Pope’s Ceiling” by Ross King, it’s about the painting of the Sistine chapel.

What would be your dream vacation? We are taking it in October to celebrate our 25th anni-

versary. We are going back to Italy, my favorite place to visit.

What apps do you like?My five favorite apps are:1) Barc. If you read my bio, you know I work at Barc, so

I better love it, and I really do. Chat with everyone who is browsing the same website. It is a useful and fun tool.

2) Twonky. Full disclosure, this is my husband’s compa-ny’s product. But, again, I would love it even if I weren’t married to it. Enter a topic and Twonky finds all of the relat-ed videos for you. Simply click to display it on your TV. I’m watching interesting video about the Olympics from Twonky now.

3) Facebook. Of course.4) Twitter. Tweeting more and more these days.5) LinkedIn. It’s great for connecting with business

friends and colleagues.

What is your most-prized possession?That would be my family and friends, and my two

dogs, Rollo and Maxwell.

What is your motto or philosophy of life? Every day, each of us has the opportunity to choose our

disposition. I choose to be happy.

Karen Brailean with Rollo and Maxwell.

Rancho Santa Fe Review August 9, 2012 B3

La J

olla

Cul

tura

l Par

tner

s

CHECK OUT WHAT’S HAPPENINGGreen Flash Concert SeriesThe Dunwellsand The Heartless BastardsAugust 15: 5:30-9 p.m., Ages 21+ only

Enjoy live music, great food and drinks for purchase, and amazing sunset views from the aquarium's Tide-Pool Plaza. We welcome co-headliners The Dunwells and The Heartless Bastards.

RSVP: 858-534-4109 or online at aquarium.ucsd.edu

Pre-sale: $27 per person Walk-up: $32 per person

La Jolla Music SocietySummerFestNow – August 24

Tuesday nights of the Festival explore the music of influential Romantic composer Franz Schubert. Three concerts highlighting the breadth of his artistic genius featuring works for solo piano, chamber music and his celebrated lieder.

Tickets: $65, $45

(858) 459-3728 www.LJMS.org

Flicks on the BricksUnder the Tuscan SunTONIGHT—Thursday, Aug. 9 at 7:30 p.m. Paired with vino toscano

Join us on the Athenaeum’s outdoor patio for screenings of classic cinemas and delightful summer wine pairings. Lecturer and wine connoisseur Barbara Baxter will be speaking about her stay at Bramasole, the location of ‘Under the Tuscan Sun’. One fortunate guest will go home with a copy of “In Tuscany” signed by author Frances Mayes.

TICKETS: $17 member/$22 nonmember Online: ljathenaeum.org/specialevents Telephone: (858) 454-5872

Monte Carlo On ScreenSATURDAY, SEPTEMBER 8 COCKTAIL RECEPTION > 6:30 PM DINNER > 8 PM AFTER PARTY > 9:30 PM

Roll out the red carpet for Monte Carlo On Screen, the Museum’s 36th annual gala. This year we’re celebrating the incredible legacy of contemporary art and the silver screen. Get your tickets at www.mcasd.org/montecarlo.

Monte Carlo committee members include Nancy Browar, Valerie Cooper, David Copley, Joan Jacobs, Gail Knox, Laurie Mitchell, Colette Carson Royston, Iris Strauss, and Sheryl White.

700 Prospect Street 858 454 3541 www.mcasd.org

‘Iliad’ adaptation unfolds a tale of love and destructionBY DIANA SAENGER

The overwhelming suc-cess in numerous theaters of Robert Fagles’ translation of “An Iliad,” adapted by Denis O’Hare and Lisa Peterson, has brought the play to the La Jolla Playhouse. The reen-actment of Homer’s classic poem about the Trojan War is retold through The Poet whose stories are backed by the tones (and often odd sounds) of The Musician.

Lisa Peterson (Play-house’s “Surf Report” and “Be Aggressive”) also directs the play, a co-production with the Berkeley Repertory Theatre. The script centers on the gods and goddesses of its time who attempt to circumvent battle with love and a huge Trojan horse.

From Agamemnon to Achilles and the Trojan hero Hector, Henry Woronicz (“The Winter’s Tale,” Broad-way’s “Julius Caesar,”) im-merses himself in many characters as The Poet, to tell the story of a lifetime with love, anger, surprise and deep passion.

Brian Ellingsen, who plays The Musician, has gar-nered huge acclaim for his sensitive and on-the-mark talent on the double bass (an upright instrument also called a string bass).

The creative team in-cludes set designer Rachel Hauck, costumer Marina Draghici, lighting designer Scott Zielinski and Mark

Bennett providing the origi-nal music and sound design. The team received critical acclaim for its work on “An Iliad” at the New York The-

atre Workshop earlier this year.

“Sound design” may be a vague term for some the-atre patrons, but Bennett confirms it’s a major compo-nent of this production. “Music and theater have been married for thousands of years. Over my 25 years in this field, it’s been excit-ing to see the world of the-ater and audiences begin to appreciate the contributions of sound designers,” he said.

Bennett has composed scores and sound for the American premieres of plays by Edward Albee, Arthur Miller, Tom Stoppard, Athol Fugard, Tony Kushner and Caryl Churchill. His Broad-way projects include “The Coast of Utopia,” “The Lion In Winter,” “A View From The Bridge,” and Playhouse’s “Most Wanted.”

He has received numer-ous Obie, Bessie, Ovation, Robbie, and Garland awards along with 10 Drama Desk and two Lucille Lortel award nominations. But his work, he said, even on the same play, starts anew with each new venue.

“There are always a cer-tain amount of changes,” Bennett said. “I feel the coat a performer puts on and wears is his own journey. It

affects the way he responds in subtle ways to phrasing and where the music starts. In this piece, it’s a dance be-tween the actor and the mu-sician, and what keeps it in-teresting for me. The beauty of it is that an entire world is created from one solo bass player and one actor and what each can bounce off the other.”

A sound designer has a number of jobs; most very technical. He is responsible that all of the equipment is hooked up correctly, tuned and balanced, and that the prerecorded sound effects are layered correctly to ac-company the storyteller.

“Sound designers func-tion with a dual mind,” Ben-nett said. “The technical mind is about the equip-ment and the cueing of it. The artistic side is how to combine the sounds and in-stall them in the right mo-ment to deliver the content. Composition is pushing the notes on a page and work-ing with the musician to create the melodies and tex-tures of the musical under-pinnings. So in this piece, the music and sound wind up very hand and glove.”

Bennett, who worked on the music in the Play-house’s 2010 “Midsummer Night’s Dream,” said work-ing with the 21 piece cham-ber orchestra for that show was a pivotal moment in his career. Now he’s equally ex-cited about working with an actor/musician. Brian Elling-sen has garnered much ac-claim for his “sensitive” tal-ents on the double bass.

Brian Ellingsen plays the Musician. PHOTO/JOAN MARCUS

What: “An Iliad” When: Matinees, eve-nings, Aug. 11-Sept. 9 Where: La Jolla Play-house, Mandell Weiss Theatre, UCSD campus Tickets: From $26Phone: (858) 550-1010Website: lajollaplay-house.org

If you go

Music and sound designer Mark Bennett will add his award-winning talents to ‘An Iliad.’ PHOTO/TERRI RIPPEE


Del Mar home to the state’s most Earth-friendly house

Local resident leads construction crew in building ‘timeless’ dwellingBY CLAIRE HARLIN

When Del Mar resident Laura Parker finished build-ing her first energy-efficient home, she had no idea that its LEED rating would add up to being the highest in the state.

“We were platinum go-ing into it, and being the highest wasn’t our goal real-ly,” said Parker, owner of construction company Del Mar Restoration. “The goal was just to try to do every-thing right and the rating was a byproduct of doing everything the best we could.”

The nearly $3 million, 2,600-square-foot home is located on 11th Street in Del Mar and was built by an all-local team. Not only are the 10 guys that make up Park-er’s construction crew all from the area, but even the architectural firm, Bokal & Sneed, is located on 9th Street in the heart of the Del Mar Village.

The owner of the home, local bakery owner Jim O’Brien, hired Del Mar Res-toration to build the home when he met Parker on the site of a different job. He gave her free reign over the project before putting the house on the market.

The home has energy-efficient features such as a ventilation system that re-freshes the air every three hours, solar-heated water and radiant floor heating. Water from the home runs off into the yard, and even the driveway is made of per-vious concrete that absorbs water into the ground.

The home has a garage door that opens up the liv-ing room to the outside, and Parker rummaged through

salvage shops to find a lot of the building ma-terials to add to the home’s character. For instance, there is a sliding barn door in the home, as well as antique pitchforks and shovels used as stair railings.

“I’ve always want-ed to do a modern house, I’ve always wanted to do a barn and I’ve always want-ed to do a LEED home,” Parker said.

Not only does Parker strive to have a business that “gives back,” she said, but she wants to add time-less structures to Del Mar — in other words, homes that won’t go out of style.

“The whole prem-ise is restoration in-stead of construction,” she said. “Everything we build, we want it to look like it has been here 100 years. I see so much value in a com-munity’s character, and we want every-thing we build to be a showpiece that we can drive by years from now and it looks as good as it does today.”

Parker worked for more than a decade in marketing before making the switch to construction. When she up-graded the first Del Mar home she bought in 1997, she got a taste of the city’s stringent design review pro-cess, enticing her to get on the Design Review Board herself.

“I won’t disparage it, but I wanted to make it bet-ter,” she said.

Also in remodeling her home she learned a lot about construction and she realized she loved it.

“I was fascinated by the process of building a house and I realized I could do this,” she said. “So I got my

license and I already knew a lot about how to run a busi-ness.”

Finishing her LEED home in Del Mar was a great feat for Parker, but it’s not the pinnacle of her career. Two weeks ago, she began construction on a LEED-cer-tified horse farm in Rancho Santa Fe. The property near Lago Lindo is on 4-and-a-half acres and will be the first LEED home in Rancho Santa Fe.

For more information on the 11th Street LEED house, visit www.greendel-marhome.com, and for more information on Del Mar Restoration, visit www.delmarrestoration.com.

Del Mar’s Laura Parker at home

A look inside the Parker residence


Helen Woodward Center Surf Dog ClinicsHelen Woodward Animal Center Surf Dog clinics help prepare pups for the Surf Dog

Surf-a-thon. Taught by Kahuna Bob’s Surf School and pet expert Rob Kuty, from San Diego Pet Training, the classes and cost $45 per dog (one adult per dog), including the required life vests and surf boards. Each clinic is limited to 25 dogs per class and runs an hour in length. Registration is now open for all the Doggie Surf Clinics, scheduled Saturdays at 10 a.m. and 11 a.m. on Aug. 11, 18 and 25. For more information or to register, visit www.surfdog.kin-tera.org or call 858-756-4117 x 356.

Local couple to open Savory Spice Shop in Encinitas

Savory Spice Shop recently announced plans to open a new location in The Lum-beryard Shopping Center in Encinitas at 937 South Coast Highway 101, Suite C-110. Owner/operators and North County resi-dents Jason and Stephanie Birn said they are thrilled to be joining the Encinitas commu-nity and to be bringing their passion for food and spices with them.

Savory Spice Shop offers more than 400 fresh ground herbs and spices, 140 hand-blended seasonings, organic selections and gift sets. The product is ground and blended weekly to ensure superior freshness. Cus-tomers are encouraged to sample products and have packaged only the amounts they need, starting as little as half an ounce.

Jason and Stephanie Birn will be the first to introduce the brand to San Diego County. Savory Spice Shop opened its first store in 2004 in Denver, Colo., and then be-gan franchising its concept in 2009. Today there are more than 20 franchise locations and four company-owned stores nation-wide.

Savory Spice Shop Encinitas plans to open its doors towards the end of this month. The shop will be located south of Encinitas Boulevard in the Lumberyard Shopping Center at 937 South Coast High-way 101, Suite C-110 in Encinitas.

Please visit www.facebook.com/Sa-vorySpiceShopEncinitas for more details re-garding the store’s opening.

Include Me Out tops at $300,000 Clement L. Hirsch StakesA very determined Include

Me Out held off a rally from Star Billing to win the $300,000 Clement L. Hirsch Stakes (Grade I) at Del Mar on Aug. 4 by a neck. The 4-year-old filly and her jockey, Joe Talamo, traveled 1 1/16 miles on the Polytrack in 1:41.96. Amani, a Chilean-bred champion who was making her first start in America, was 1 1/2 lengths back in third. Include Me Out is trained by Ron Ellis and owned by Jay Em Ess Stable. Photo by Kelley Carlson

Upcoming regional concerts• Sat., Aug. 11 and 25, Zel’s Del Mar, 8-10 p.m. , Robin Henkel and Kellie Rucker

play award-winning blues and jazz (guitar/vocals and harmonica, respectively), 1247 Cami-no Del Mar, Del Mar (858) 755-0076. Free, but purchase suggested — all ages

• The Grand Del Mar’s “Summer Concerts At The Grand” eight-concert series runs every Sunday through Sept. 2 with doors opening at 6 p.m. and show times beginning at 7 p.m. Tickets are on sale now and can be purchased online at www.GrandSummerConcerts.com or by calling 800-820-9884.

• The City of Solana Beach and the Belly Up Tavern summer “Concerts at the Cove” events are held every Thursday from 6-7:45 p.m. For more information, contact the Parks and Recreation Department at 858-720-2453.

• The Del Mar racing season’s concert schedule can be found at www.delmarscene.com or www.dmtc.com.


BY KELLEY CARLSON

I t appears Del Mar racetrack visitors are finding that the venue’s Blue Moon Celebrity Grill’s patio views and unique

menu are a winning combination.Even though the season is not quite half

over, it has already been noted that the restaurant’s popularity has increased since last year (when it was simply known as Celebrity Grill) and that it’s gaining a following of “regulars,” according to manager Cristina Burns.

Yet the establishment, which added Blue Moon to its name due to its new sponsorship, is not widely advertised. It’s not mentioned on the track’s website, nor is it featured in the racing program handed out at the gates.

“This is a secret gem of a restaurant,” Burns said.

One of the attractions is the view from the covered outdoor patio. Guests can study the horses being saddled in the paddock below and catch glimpses of the ocean just a short distance away, while enjoying sit-down food and beverage service.

In the main dining room you’ll find a

glowing neon “Blue Moon” and stars ... Hollywood stars, that is. Original photos of celebrities who frequented the track when it was first opened by Bing Crosby and Pat O’Brien in 1937 grace the walls. A full-service bar on the west end of the establishment serves six draft beers, which naturally includes Blue Moon brands; wine and Champagne; and signature cocktails such as the Del Margarita and Red Bull-fecta.

Even after the horses leave the paddock

for the track, racing fans won’t miss out on the action. Nine TVs around the Blue Moon provide live simulcasts, and bettors have the opportunity to place wagers.

It doesn’t matter where one sits, “you get the same fabulous service, outside or in,” Burns emphasized.

And while most of the track’s public restaurants provide the same menu, Blue Moon Celebrity Grill’s offerings are different.

There are four “starters” to choose from, including the Crunchy Tempura Green Beans with cusabi-ranch dip. Burns refers to these fried snacks as the equivalent of “healthy mozzarella sticks. They are hands-down amazing,” she said.

Several “cold bites” are available, like The “Wedge” Steakhouse-Style Salad — baby iceberg lettuce, applewood smoked bacon, crumbled gorgonzola, tomatoes and Bermuda onions tossed together, with a side of Black Pepper Buttermilk Ranch dressing. All-Natural Brandt Beef Flat Iron Steak dusted with truffle salt can be added for a few extra dollars. The salad pairs nicely with a Blue Moon Belgian White.

The “warm bites” portion of the menu consists of sliders, flatbreads and sandwiches. One favorite is the Chicken Parmesan Sliders, with two small crispy chicken breasts topped with smoked mozzarella, marinara and basil pesto on brioche buns.

For dessert, there is Del Mar’s Signature Carrot Cake with caramel sauce and Sky High Frozen Mocha Mud Pie with chocolate sauce.

An important note about dining at Blue Moon Celebrity Grill: Customers must have paid Clubhouse admission to gain access to the third-floor eatery. Also, because seating at the Blue Moon is often in high demand (especially when the horses are in the paddock) guests are asked to stay for a maximum of 45 minutes.

“Because the restaurant is open to the general admission public, we need to turn the tables over to service all our guests,” explained Sue Walls, director of catering and dining services for Premiere Food Services and Carriage Trade Catering at the Del Mar Fairgrounds. Those who would like a table for the day may make arrangements through the Del Mar box office for a fee.

MenuOn T

he

See more restaurant profiles at www.delmartimes.net

Dining at the track? Blue Moon Celebrity Grill is a good bet!

Brandt Beef Sliders with tomatoes, Bermuda onions and smoked tomato jam on brioche buns.

Blue Moon Celebrity Grill■ 3rd floor Clubhouse, Del Mar racetrack, 2260 Jimmy Durante Blvd., Del Mar■ (858) 755-6345, Ext. 1644 ■ dmtc.com

■ The Vibe: Casual, relaxed, trendy

■ Signature Dishes: Brandt Beef Sliders, Brandt Hot Corned Beef on Rye, Chicken Parmesan Sliders

■ Open Since: 2011 ■ Reservations: No

■ Patio Seating: Yes ■ Take Out: Yes

■ Happy Hour: No

■ Hours: Noon to 5 p.m. Wednesdays, Thursdays, Saturdays and Sundays; 2-5 p.m. Fridays; bar service through the eighth race; open racing season only, to Sept. 5

The patio overlooks the paddock and also provides an ocean view. PHOTOS BY KELLEY CARLSONA mural decorates the front of Blue Moon Celebrity Grill.

On The Menu RecipeEach week you’ll find a recipe from the featured restaurant at delmartimes.net. Just click ‘Get The Recipe’ at the bottom of the story. This week:

■ Blue Moon Celebrity Grill’s BBQ Chips

Blue Moon’s full bar includes six draft beers, wine, Champagne and the racetrack’s signature cocktails.

Chicken Parmesan Sliders consist of two small, crispy chicken breasts topped with smoked mozzarella, marinara and basil pesto on brioche buns.

The ‘Wedge’ Steakhouse-Style Salad with a side of olive bread.

Santa Barbara Smokehouse Oak Roasted Salmon Flatbread with arugula, pickled Bermuda onions, capers and a lemon-dill vinaigrette.


VOTE ONLINE Online Voting Starts Fri. - July 27th and ends Mon. - August 20th

for the Best of North Coast… and be automatically entered to win.

858-756-3726www.rsfvillage.com

858-756-4047ranchosantafejewelers.com

858.350.9770RoyalDanceAcademy.com

760-479-1818somerfordplaceencinitas.com

760-479-1500www.rsfsoccer.com

Solana Beach & RSFStudioSavvySalonAndSpa.com

858.756.7874sushiintheranch.com

858.759.4100martinkatz.com

858-756-5558MooresLG.com

858.243.3928Patrick T Larkin

760-753-6256www.cookvw.com

Now 3 Locations!Self Serve Frozen Yogurt

858-345-4127SRGseniorliving.com

858-259-9111jerseymikes.com

Jason Katz858-245-5289

858-755-2277thefishmarket.com

858-481-8088delmarpizza.net

858-794-8000passionfi nejewelry.com

Thank You to All Our Sponsors

VOTE FOR THE BEST OF NORTH COAST

Restaurant • Bak ery • C offee • Y ogurt • Ban k • Clothing Store

Health Club • Spa • D entist • Spo rts League • P et Store

Kids Store • P rivate School • A uto Service and more…

2012Readers’ Choice

“Best of”

®

PPPPPassion Fine Jewelry

David Allen858-397-5978

S H O P R A N C H O S A N T A F E

SOMERFORD PLACEALZHEIMER’S ASSISTED LIVING

FIVESTAR SENIOR LIVING™

Look for our GrandRe-Opening Mid-August

s a l o n s e r v i c e s

To enter go to: delmartimes.netOne winner will be chosen every week. Winner will be notifi ed via email or by phone.

This weeks prize: 4 Tickets to SEA LIFE™ Carlsbad Aquarium!Located at LEGOLAND® California Resort.

lawrance.com

bankHome Mortgage


7820 Balboa Avenue | San Diego, CA 92111 | 858.362.6001 | sandiegoeuropean.com

AUTOMOTIVE SERVICE SPECIALS

San Diego European Motorcars, LTD

LOTUS SERVICE OFFER

Oil And Filter Changewith

Multi Point InspectionValued at $49.95**add $15 for synthetic oil.

No cash value. Not valid with any other special or offers.

Must present at time of write up. *Expires 8/31/12.

Lotus vehicles 2000 and later.

ASTON MARTINSERVICE OFFER

GIFT CERTIFICATE$150.00

Towards any Service or Repair

No cash value. Excludes oil & filter changes, alignments andtire sales. Not valid with any other special or

offers. Must present at time of write up Aston Martin vehicles only.

*Expires 8/31/12.

858.481.0032Samuraijapaneserestaurant.com979 Lomas Santa Fe Dr. Solana Beach, CA 92075

www.twitter.com/samurai92075

www.facebook.com/samurairestaurant

Be part of Samurai History & Sign Your Name on a Lantern at our Sushi Bar.

Our sushi bar is one of the largest in San Diego. Come

and meet head sushi chef of 33 years, Makoto Ishihara!

The last authentic Japanese sushi bar.

BY CLAIRE HARLINThe packed little cheese

shop in the Flower Hill Promenade that used to be a quick stop for savory samples and cheese to-go finally let its seams bust last month and moved into a new space. The step up in size will now allow them to serve lunch, beer and wine, giving guests plenty of seating to mingle and munch.

Owner Gina Frieze said a major reason she embarked on the move is because her customers were asking when she was going to bring to Del Mar the well-attended cheese classes she holds at her flag-ship shop in downtown San Diego. Sure enough, the Academy of Cheese — “AOC” as she calls it — will find its place in Del Mar starting this month. There will be a kids’ cheese party on Aug. 13 at 2 p.m. at the shop, as well as a mozzarella and ricotta cheese-making course on Aug. 16 and a “Getting to Know Cheese” course on Aug. 23. There will be three to four classes each month at various times, some of which will incorporate pairing and products from other Flower Hill vendors.

Venissimo started about a decade ago as a small Mission Hills cheese shop with 50 types of cheese and it’s grown to hundreds of varieties at Frieze’s four shops in San Di-ego and Long Beach. The Del Mar shop was the second in the chain, opening in 2007 at the former site of Aniata Cheese Co., which

specializes in importing cheese and is still a partner of Venissimo.

“This all came to be because I love cheese,” said Frieze, who did marketing for companies for more than a decade before finding her passion with cheese.

It all started on a wine tasting tour near Sacramento, where she used to reside.

“The light bulb went off and I said, ‘I want to do a cheese shop,’” she said. “I also wanted to live somewhere with perfect weather and there were no cheese shops here in San Diego.”

She spent about a year writing her busi-ness plan, which she modeled after the tra-ditional European cheese shops that were few and far between in the Unites States at that time. Frieze’s mother is from Austria, and she remembers going to the European

Flower Hill cheese shop expands to add seating, classes

From left: Andy McNamara, Rebecca Gould, Gina Freize and Cat Charpentier in the new Venissimo cheese shop. PHOTO/CLAIRE HARLIN

delis as a child.“Every two years we would get to visit

and those are such warm memories,” she said.

The opening of Frieze’s first store didn’t come without a challenge. After pitching her idea to the owner of the space she found in Mission Hills, she got turned down. Not only did the landlord think a shop selling only cheese wouldn’t survive, but he didn’t wanted to split the rather large space into two smaller units as Frieze asked.

“On top of everything, it was my very first business, and they just said ‘no,’” Frieze said. “It took six months and I was faxing them letters telling them what I could do.”

Finally, Frieze showed up with a cheese tray when the owner was on site, and he was sold on the idea.

The shop opened in 2004, and there was no looking back for Frieze.

“My first cheese order was like $2,500 and I was panicking because cheese goes

bad,” she said. “I am so thankful for every-one who kept coming back.”

Much of Venissimo’s success has been its business model that stresses “heavy sam-pling,” Frieze said.

“Our whole thing is we want people to be able to try anything they buy,” she said. “We want it to be an adventure, like going to Europe without being in Europe.”

Each cheese available to buy is labeled with the pronunciation, animal it comes from and pairing ideas. More recently, the shop added a designation for organic and raw (as opposed to pasteurized) to each cheese option.

Since the move, the cheese boards of-fered at the shop have been popular, Frieze said.

“Peope can either mix and match the boards or let us choose,” she said.

For more information on the shop and to sign up for classes, visit www.venissimo.com.

Spotlight on David Steinberg La Jolla Playhouse will host comedian

David Steinberg as he develops a new one-man show, “David Steinberg: Still Disguised as a Normal Person,” that looks back and forward at his life in show business. Alan Zweibel, who helped develop “700 Sundays with Billy Crystal” at the Playhouse and on Broadway, will be involved in the process. The workshop production can be seen at 7:30 p.m. Aug. 16-25 in the Playhouse’s Shank Theatre. Tickets: $20. (858) 550-1010. lajollaplayhouse.org

Titanic Tales ToldSpecial events will be offered Tuesdays

in August to mark the final weeks of “Titan-ic: The Artifact Exhibition,” closing Sept. 9 at The San Diego Natural History Museum in Balboa Park. At 6 p.m. Aug. 14, professor Douglas Bartlett of Scripps Institute of Oceanography will share his experience as chief scientist on James Cameron’s recent historical expedition to the Mariana Trench, the deepest point on Earth. At 6 p.m. Tues-day, Aug. 21 author Guadalupe Loaeza will

A variety of regional events offered

See EVENTS, page B18


Jewels. Like No Other.

At Martin Katz we carry an extensive selection of Diamonds, Rubies, Emeralds,

Sapphires and our Martin Katz one of a kind “Signature Collection.”

With more than 30 years experience we can help you redesign an existing piece

and we are always interested in purchasing estate jewelry and family heirlooms.

Hours: Tuesday-Friday: 10-5, Saturday: 10-3 or by appointment

6016 La Granada Rancho Santa Fe

858.759.4100

Renovated Prepkitchen Del Mar set to reopen in early SeptemberBY CLAIRE HARLIN

Prepkitchen owner Ar-turo Kassel said he will never forget the morning of Oct. 2 when he got a call from his corporate chef telling him his Del Mar restaurant was on fire.

“I was in a state of shock when it happened,” he said. “I know what some-one must feel like after com-ing back to their home after a flood or tornado or fire. In some sense the restaurant is an extension of our home and it’s very personal for us.”

The restaurant has been boarded up and vacant since then, but Kassel, the CEO of parent company Whisknla-dle Hospitality, announced recently that construction on the 40-year-old building is wrapping up and the com-munity can expect an open-ing the first week of Septem-ber. Not only that, the res-taurant’s owners have made the most of their misfor-tune, taking the opportunity to totally revamp the interi-or. The 1,650-square-foot restaurant is amid a $750,000 renovation.

“With the previous de-sign, I think I didn’t do a great job in terms of func-

tionality,” Kassel said. “The kitchen was too small to ser-vice the volume we were serving. Now we have a kitchen that can handle the volume.”

As far as the interior goes, Kassel said the change is going to be “night and day.” He said the style will resemble that of the Prep-kitchen in Little Italy, which was nominated for the high-ly-coveted Orchid interior design awards.

“We are pretty confi-dent we will get the Or-chid,” he said. “The space is really magical, something we are proud of.”

The new design utilizes

a lot of unique reclaimed materials to “create more of an experience,” Kassel said.

The construction com-pany and designers hunted through salvage shops to find materials such as doors from an old French farm-house.

“A lot of the design ele-ments have their own sto-ry,” he said. “The space has a lot of character. It’s homey and warm. When you walk in you say, ‘Wow, this is great.’ You don’t know why but when you walk in you feel good.”

Kassel said insurance paid for most of the renova-

Prepkitchen Del Mar

BY DR. KEITH KANNER

It’s about that time of the sum-mer when parents have to remind their kids that school will be starting again in about a month or you will likely be in for a rocky start of the new school year. Why? A con-dition called Sum-mer Learning Loss occurs each summer when kids do not exercise their brains by engaging in some sort of academic endeavor for the summer months, causing “shock” once they return to the classroom in the fall. Homework battles; resistance to get up in the morning; bad moods ; and depressed grades for the first reporting period of the new school year are all symptoms of Sum-mer Learning Loss ( SLL ).

The good news is that it’s not too late to get your kids to re-stimulate their neurons now before it’s too late. The bad news is that you, the parent, have to be the one who brings up the issue and your kids will not be happy with the news, or you. But, that’s our job as parents – looking ahead for our kids and also realizing that a little bit now will pay off a lot later and sometimes we have to take the hit, but it’s worth it in the long run.

More good news. All you really have to do is get them to read. Reading is the sin-

gle best preventative measure to avoid com-ing down with SLL. Sure, doing some re-view of last year’s curriculum or jumping ahead to some concepts for the upcoming year might even be better, but reading a book is the equivalent of a treadmill for a child’s mind. And, why not read together? Make reading a family affair – make the trip to the library or a bookstore and everyone gets a book to read. Take it to the next step and take 5 minutes at the end of the reading period and share what you learned with the rest of the family. If you do this subtly, your kids won’t even know that you have intro-duced school to them.

The statistics of the positive effects of summer learning on fall school performance are impressive. It is also not surprising that the statistics on the level of self-esteem for kids who feel and are prepared for the new school year are also equally so. And, how about the statistics on lower parental stress when kids adapt to school sooner rather than later? I know you all know the answer to that one too. So, what are you waiting for? Crack that book.

Dr. Keith Kanner is host/anchor - Your Family Matters - WSRADIO; contributor to LifeChanger, Extra TV; a syndicated columnist; author of “Your Family Matters — Solutions to Common Parental Dilemmas” (in press); board certified & licensed clinical child, adolescent, & adult psychologist & psychoanalyst; Assistant clinical professor of psychiatry, University of California, San Diego School of Medicine; Na-tional Board Member - KidsKorps USA; and a father of three great kids.

Your Family Matters: Getting back into school

Dr. Keith Kanner

See PREPKITCHEN, page B14


Longtime local dentist Dr. Curtis Chan opens new office in Del MarBY KELLEY CARLSON

Dr. Curtis Chan, a longtime dentist in the Carmel Val-ley/Del Mar area, has something new to smile about.

After being in a temporary location for the last year, Chan’s office has found a home at 12835 Pointe Del Mar Way, Suite C, in Del Mar (92014).

The celebrating began Aug. 6 with the start of Patient Appreciation Week. People can drop in for tours of the facil-ity and receive a gift. Those visitors who are patients of re-cord will also receive a raffle ticket for a drawing to be held during the grand opening celebration, set from 5 to 9 p.m. on Aug. 9. Among the prizes will be an iPod, spa packages and family health care baskets.

Although Chan is based in a new office, he is not a newcomer to the field. He grew up among health care pro-fessionals — his father was a physician and his uncle was an orthodontist. And of the five boys in Chan’s family, four be-came dentists.

“I wanted to help and serve in the health care indus-try,” Chan said.

He graduated from Loma Linda University, School of Dentistry in 1986. Shortly after relocating to the Del Mar area, Chan opened up a dental practice. When North City West — which is now Carmel Valley — began to be devel-oped, he said he realized the need for quality dental services for the growing planned community. So in 1990, Chan relo-cated his office and opened up a new facility on Carmel Country Road, where he spent the next 20 years. However, after he failed to reach a new long-term lease agreement with the landlord, Chan found himself uncertain of the fu-ture.

“It was a little unsettling to pick up the business (and move) ... we didn’t know what would happen,” he said.

In August 2011, Chan temporarily moved his office to

Sorrento Valley. He noted that his patients, who are very loyal, followed him.

Around the start of the new year, an opportunity arose to relocate to an office on Pointe Del Mar Way in Del Mar.

“We saw the potential to build a brand-new facility and jumped on the idea,” Chan said. “It’s in a perfect location, has a beautiful view ... we could now really embrace new technology.”

Chan and his team of four moved into the site a couple of weeks ago, and they are ready to continue providing the services that have drawn thousands of patients over the years.

As a general and cosmetic dentist, Chan said he pro-vides all the treatment modalities one would expect to have at a state-of-the-art dental facility. He offers teeth whitening, cosmetic dental bonding and tooth replacement treatment. In addition, he utilizes his experience and up-to-date tech-niques in treating those with TMJ problems and helping pa-

tients experience bite optimization. Chan noted that his new facility is equipped with an ultra-clean water purifica-tion system so patients can be assured that they are treated with the ultimate dental delivery systems. Furthermore, he uses the latest in dental technology, including digital X-rays, intra-oral digital cameras and computer imaging. Chan and his dental team continue to keep up their skills through continuing education and dental conferences.

“We help people achieve lifetime smiles,” Chan said.He added that his office provides the best in patient

comfort, as well. There are headsets that play music, and special personal video display glasses that allow people to watch their choice of movies from a library of 100 DVDs while having their dental treatment done.

Along with building quality, long-term relationships with patients, Chan also values and maintains a strong pres-ence in the local community through service. Each year, he holds a Great Candy Buyback program, in which he pays $1 for each pound of Halloween candy brought into his office, up to $5. The candy is donated to Operation Gratitude in Los Angeles, which sends care packages to military service men and women overseas who are in harm’s way. Also, Chan helped build a dental clinic for orphans at Grace Chil-dren’s Home in Tijuana.

Meanwhile, he is looking forward to seeing all of his re-turning dental patients and welcoming fresh faces.

“We’re open to anyone who would like quality dental care,” Chan said.

The office is open from 8 a.m. to 5 p.m. Monday and Tuesday, and is closed one hour for lunch; hours are from 7 a.m. to 3 p.m. Wednesday and Thursday.

For more information, call (858) 481-9090 or go to www.curtischandds.com.

Dr. Curtis Chan at his new location.

SPOTLIGHT on LOCAL BUSINESS

at FLOWER HILL PROMENADE

For a list of our stores, please visit us at FlowerHill.com

We’re getting a new look and you can too!Come in and enjoy month long savings

throughout the shops.

facebook.com/flowerhillpromenade

LOCATED OFF I-5 AT

2720 VIA DE LA VALLE,

DEL MAR

renovation


TESTIMONIAL.

www.RSFReview.com

ADVERTISING THAT WORKS…

Call today to make your advertising work for you.

858.756.1403

“At Rande Turner Properties, we have utilized the Carmel Valley News, the Solana Beach Sun and the Del Mar Times to quickly build a positive brand image and build our business. The three publications allow us to successfully reach our targeted clientele at a cost that has resulted in a high ROI.

The staff is a pleasure to work with, always exceeding expectations. They gladly help design and build our advertisements offering suggestions on how to make them even more effective. We would highly recommend using the publications to reach the local markets in North San Diego.”

- Rande Turner

Wink Optometry & Eyewear

Sparkle, twinkle, wink.

Have you had your annual eye check up?

Give us a wink for more information.

AUGUSTSPECIAL

Schedule an Eye Exam & receive 30% Off

your 1st frame & lens purchase*

BY KARIN OLSENCollege-bound Winston School graduate, The Head-

master’s Award recipient and drama standout Lukasz Augus-tine expected the worst when he first started attending the school for students with learning differences seven years ago. A self-described shy, and self-conscious 11-year-old, Augustine’s low self-esteem was compounded by an audito-ry processing disorder that made learning difficult.

Feeling like an outcast at his previous schools, he said he was nervous and crying at the very idea of going to Win-ston as he couldn’t imagine how this new school would be different. “I had some friends, but not many and it was hard for me because the way I learned was different. It was difficult for me to get what teachers were saying,” he re-members.

The first three or four months at the Winston School in Del Mar were a revelation. “I started to lighten up at the school and it was a great experience. I felt I could do the work and I get it. Once I got it, it came to me very easily. It felt great to finally get the work that the teachers handed to me.”

Once he started doing well in school, Augustine still had one hurdle to overcome – shyness. In spite of or per-haps because of this, he said he felt he needed to move with the drama crowd but was skeptical. “After a couple of weeks I realized it was something I really enjoyed. Drama taught me no matter how foolish you look it’s more about being yourself and not about what other people think.”

His first role was the police officer in the school’s pro-duction “And Then There Were None.” “I felt really good afterwards. It was different and it also helped me under-stand how to do a production and learn lines. It was fairly easy, not a cakewalk. I couldn’t get enough of it so I kept doing it.”

English also became one of Augustine’s favorite sub-jects. A testimony to the power of good teachers, he said “I

never really got what the subject was about until I met Mr. K (Jeff Kozlowski) and Mrs. (Mary) Sterling-Torretti.” He said he became more interested in literature after reading some of the classics and found the beauty of writing to be eye-opening.

“I like the deep meaning behind some poetry and how poets expressed themselves. Shakespeare was an incredible poet and playwright. He had so much wit within his plays and there’s really a deep meaning behind them.” Musically inclined with a talent for playing guitar, violin and piano, Augustine has also extended his love for writing to lyrics.

After three years in the Winston School’s storied arts programs, Augustine is inspired to study theater or music at Linfield College. “They are both pretty hard majors. I also have to think about what I’m going to do after college so I will have some stability when I get out.”

Crowning his seven years at Winston, headmaster Mike Peterson recently awarded Augustine with The Headmaster’s

The transformation of Lukasz Augustine — Winston School Headmaster’s Award recipient

Lukasz Augustine

Award at the school’s graduation ceremony. The award is the highest honor given each year to the upper school stu-dent who best exemplifies the values of The Winston School. In his introduction, Peterson began by describing the recipient as “a young person whose keen intellect, cre-ativity and love of learning are obvious to all who know him.”

In front of the packed room, Peterson went on to say, “He participates in activities with enthusiasm and a sense of community spirit that is unique among his peers. At Win-ston he has done everything from star on stage to paint the school buildings. He is helpful to others, always remember-ing that his own path to success has held unanticipated challenges which he has met by drawing on all his own re-sources and the willing help of others. He is gentle in spirit, but never timid; impatient about seeing himself succeed but extraordinarily persistent. He is always striving to learn, to grow and to move forward in his life, but never at the ex-pense of his own integrity.”

When Peterson announced Augustine’s name, the audi-ence cheered but wasn’t surprised. Many share Peterson’s sentiments about the shy boy who not so long ago enrolled in Winston thinking he “wasn’t good at anything.”

Looking back on the last seven years, Augustine is mel-ancholy at the prospect of leaving Winston. “The school is great, the teachers are great — everything about the school is great. I’m really going to be upset when I have to leave it’s not going to be easy. Winston really has helped me be a better individual and really helped me grow up.”

His advice for everyone from students finding their way to seasoned students of life, “Be yourself. Don’t be afraid to express yourself, put yourself out there and take a chance.”

For more information, visit www.thewinstonschool.com or call 858-259-8155.

Rancho Santa Fe Review August 9, 2012 B13B12 August 9, 2012 Rancho Santa Fe Review

Lisa Harden & Danielle Wright 858-922-2222 & 858-922-2345

Larry Springer & Sid McClue858-229-8101 619-857-9064

Kramer & MartinLou 858-735-9032 Pat 858-945-4595

K. Ann Brizolis858-756-6355

Ashley Roberts619-559-0571

Christie Horn858-775-9817

Dan Conway858-243-5278

Deanne Motsenbocker858-444-6687

Debbie Bulkeley858-243-6717

Katie Hawkes858-922-2226

Dora Josepher619-942-1873

Julie Feld619-417-3638

Julie Howe858-361-2012

Andrea Gilbert858-945-1312

Kathy Hewitt858-442-7824

Gwyn Carter Rice858-775-7423

Lisa Stennes619-933-9909

Lucy Kelts858-756-0593

Maria Weiss858-248-0863

Marianne Amerine619-518-6043

Th e Michael Taylor Group858-756-5120

Peggy Foos858-354-7503

Polly Rogers858-774-2505

Robyn Raskind858-229-9131

Susane Roberts858-361-9988

Leader in Home Sales1999 · 2000 · 2001 · 2002 · 2003 · 2004 · 2005 · 2006 · 2007 · 2008 · 2009 · 2010 · 2011 • 2012

Via Mil Cumbres, Solana Beach $1,795,000

31 Acres, Rancho Santa Fe $8,900,000

Carlsbad Oceanfront $11,500,000

St. Francis Court, Solana Beach $749,000

St. Francis Court, Solana Beach $899,000

Dollimore, Encinitas $3,495,000-$3,795,000

Corte Jardin Del Mar, Carmel Valley $900,000-975,000

Corte Jardin Del Mar, Carmel Valley $849,000-$899,876

Wendy Tait & Gayle Lane 858-382-7612 & 619-339-3795

John Leff erdink619-813-8221

Elaine & Michael GallagherGallagher & Gallagher 858-259-3100

PRUDENTIAL CALIFORNIA REALTY

HomeServices of America Company, a Berkshire Hathaway affi liate | For the best properties in town visit us at www.prudentialcal.com*All reports presented are based on data supplied by the CARETS, Sandicor MLS, or their MLSs. Neither the Associations nor their MLSs guarantee or are in anyway responsible for its accuracy. Data maintained by the Associations or their MLSs may not reflect all real estate activities in the market. Information deemed reliable but not guaranteed. Top Broker - Market Share Report (July 10, 2012) - Copyright © Trendgraphix, Inc. An independently owned and operated broker member of BRER Affiliates Inc. Prudential, the Prudential logo and the Rock symbol are registered service marks of Prudential Financial, Inc. and its related entities, registered in many jurisdictions worldwide. Used under license with no other affiliation of Prudential. Equal Housing Opportunity.


Expert care for yourVintage Jaguar

AUTOMOTIVE SERVICE SPECIALS

25% OFF JAGUAR SERVICELimited time offer for work performed on

1990-2000 model year Jaguars. No cash value. Excludes Tires. Labor charge for labor performed in

workshop only. Not valid with any other special or offers.Must present coupon at time of write up. Exp. 8/31/12.

10%OFFJAGUAR PARTS

Limited time offer on parts installed in our workshop for

1990-2000 model year Jaguars.

No cash value. Excludes Tires. Not valid with any other special or offers. Must present coupon at time of write up. Exp. 8/31/12.

JAGUAR SAN DIEGO4525 Convoy · San Diego, CA 92111

888.355.5246 · www.jaguarsandiego.comBALBOA AVE

CO

NVO

Y S

T

“I realized acting on center stage is as great as kicking off in center circle.”


“““““IIII rrrrreeeeeeaaaaaalllllllliiiiiiizzzzzeeeeedddddddd ““III rrreeeeaaaallllliiiiizzzzeeeedddddd aaaaaaaaaaacccccccttttttttiiiiiiiiiinnnnnngggggggg ooooooooonnnnnnn cccccccceeeeeeeeennnnnntttttttttteeeeeeeerrrrrrrrr ssssssssssttttttttttaaaaaaaaggggggggeeeeeeeeee aaaaaaaaccccccttttttiiiiiinnnnggggg oooooonnnn ccccceeeeeennnnnttttttteeeeeerrrrr ssssssttttttaaaaaaggggggeeeeeeiiiiiiisssss aaaaaaaassssssss ggggggggrrrrreeeeeeaaaaaatttttttt aaaaaaaasssssss iiiiisss aaaaasssss gggggrrrreeeeaaaatttt aaaaasssss kkkkkkkkkkkiiiiiiiiiicccccckkkkkkkkkkkiiiiiiiiiinnnnnngggggggg ooooooooofffffffffffffffffffff iiiiiiiinnnnnnnn ccccccccceeeeeeeeennnnnnttttttttteeeeeeeerrrrrrrrr ccccccccciiiiiirrrrrrcccccllllllllleeeeeeeeee...””””kkkkkkkiiiiiiicccckkkkkkiiiiiiinnnnggggg ooooooffffffffffffff iiiiinnnnn ccccceeeeeennnnntttttteeeeeerrrrrr ccccciiiirrrrrccccllllllleeeeee..””


Defining moments happen here. Defining moments change lives. The power of defining moments shared within a community of supportive teachers and eager students has created an educational culture unique to Pacific Ridge School. Young people discover their passions and define their place in the world.

Consider a life-changing education for your middle or high schooler: ENGAGED IN THE CLASSROOM

ENGAGED IN THE WORLD

St. James Gift Shop hosts 12th Artisans Market Aug. 11-12

A scene from the 2011 Artisans Market. PHOTO/DAVID

FAST

What: Artisans Market

When: 10 a.m. to 4 p.m. Saturday, Aug. 11 and Sunday, Aug. 12

Where: Outside St. James Gift Shop, on the front lawn of St. James-by-the-Sea Church743 Prospect St., La Jolla

Perks: Ballet Folklorico at noon Saturday; Mariachi band at 11:15 a.m. Sunday

Contact: (858) 456-1105

If you go

St. James Gift Shop manager Karen Fast with some of the shop’s treasures. PHOTO/LONNIE

HEWITT

La Jolla event has ‘branched out’ from Latin America, coordinator says

tion, but it wasn’t “dollar for dollar.” The owners made the decision to invest more re-sources into the project than what was cov-ered.

He said the fire started because a clean-ing crew left the gas on under a pot of cook-ing oil in the middle of the night.

“On top of that, the fire suppression failed due to human error on the part of the installer,” he said, but did not offer further details because a lawsuit brought forth by

the insurance company is still pending.“We could have taken the insurance

money and walked away,” he said. “But not opening back up was never an option.”

For more information on the restau-rant, which has locations in La Jolla and Lit-tle Italy in addition to Del Mar, visit www.prepkitchen.com. Prepkitchen Del Mar is lo-cated at 1201 Camino Del Mar, Del Mar, 92014; 858-792-7737.

PREPKITCHEN continued from page B9

BY LONNIE BURSTEIN HEWITTAt any time of year, St. James

Gift Shop offers an array of unex-pected treasures from around the world. But this weekend is really the moment for heading their way. It’s time for their annual Artisans Market, where you can find arts and crafts from Mexico, Guatema-la, Ecuador, Peru, and Africa — jewelry, pottery, textiles and more.

“We run the Market to coin-cide with SummerFest, so we draw some of the crowd from the muse-um across the street,” said gift shop manager Karen Fast, who has been in charge of the event and the shop for the past dozen years.

“At first, we mainly did the art of Latin America, but then we branched out,” she said. “We’re a nonprofit, we operate as an out-reach center, and we really want to help artists all over the world show and sell their work. We want them to do what they do best, and we want them to stretch themselves, so we encourage them to come up with new ideas every year.”

Among this year’s featured artists is Oralia Lopez, a potter from Mata Ortiz, a small Mexican town south-west of El Paso that became famous for its red, white, and black ceramics in the 1980s. Now Lopez is earning kudos for her finely executed geometric designs. “She’s so young, you wouldn’t believe she could be so talent-ed!” Fast said.

Also keep an eye out for Esau Andrade, from Baja Calif., another young up-and-comer who will be show-ing some of his watercolors. And, from a more-distant part of the globe, you’ll find representatives of several African women’s co-ops that specialize in jewelry-mak-ing.

“Some of their pieces are recycled paper, some is acrylic, but it’s all very, very contemporary,” Fast said. “They have a huge following; they were even in Vogue Magazine!”

She is always in search of new talent, and five of the 12 artisans at this year’s market will be there for the

first time. Most of the others have been coming for all 12 years.

“They’ve become like family,” Fast said. “We keep in touch during the year, and try to help them out when they need it. We have a special dinner for the art-ists and volunteers; I make molé. They all look forward to it, and so do I. I love the camaraderie.”

Besides the arts and crafts at the market, there will be tacos from Tacos & Gorditas, as well as Mexican music and dance. It is, as Fast says, a fun event. But if for some reason you can’t make it this weekend, you can always drop by the Gift Store, to check out their eclectic collection, and chat with Karen Fast or one of her four employees.

“We’re not just an ordi-nary retail business,” she said. “We encourage every-one to come and visit, hang out with us, tell us their sto-ries. We’re great listeners!”


Herbal and Nutritional PharmacyCelebrating 15 years. Come see our new beautiful location in Carmel Valley.

San Diego's Destination for Holistic Therapies since 1996

12250 El Camino Real, Suite 108, San Diego, CA 92130

858.755.0288 • www.arcanaempothecary.comHours: Monday – Friday 9 am – 5 pm

Dr. James Mattioda, Ph.D., R.Ph., DiHom

Call for a Complimentary Supplement Consultation.

Green Tea ExtractBefore green tea became a beverage it was used for medicinal purposes

by herbalists and traditional physicians in China. Green tea is a powerful

antioxidant that is benefi cial for many facets of general health. Several studies

have shown it benefi ts in prevention of disease. These benefi ts are due to the

natural polyphenol compounds. Our Arcana Pharmacy brand extract contains

90% polyphenols, 2 capsules are equivalent to 4 cups of the tea. It does not

contain any artifi cial colors or preservatives and is gluten free.

60 Vegetarian Capsules $16.95

• Nutritional Supplements and Medical Grade Herbs

• Homeopathic Remedies

• Highest Quality Vitamins and Minerals

• Large Selection of Flower Essences

• Aura Soma Color Therapy

Solana Beach company addresses growing need for in-home senior careBY CLAIRE HARLIN

When Josh Allen was a kid, his single mom started her own in-home senior res-idential care facility, open-ing the doors of their San Marcos home to five pa-tients.

“It was like growing up with five grandmas,” said Allen, who has followed in his mother’s footsteps as he now leads a senior care com-pany. He works with Solana Beach-based Senior Resource Group (SRG), which owns Del Mar senior community La Vida Del Mar in addition to 17 other similar facilities across the United States.

But more recently, the company has been tapping into an area of care that there’s a growing need for — home care. Allen is the di-rector of a new SRG venture called InTouch At Home. In-Touch At Home provides such services as personal care, chores and errands, medication reminders, transportation, memory support and more.

“As the baby boomer popula-tion ages and gets in their late 70s and 80s, we know they are not all go-ing to move into senior living com-munities. They will try to stay at home as long as they can,” he said.

Since InTouch At Home started last year, it has grown to operate in four cities — San Diego, Los Angeles, Portland and San Francisco — and the need continues to increase, he said.

Having been in the in-dustry his entire life, Allen, a registered nurse, has had the opportunity to watch the se-nior care industry evolve.

“It’s gone from mom and pop to professionally-managed companies,” he said. “To be perfectly hon-est, I believe this is a really good career. Our population is aging and the demand for

senior care services is going to explode over the next 30 years.”

He said he loves having the opportunity to provide care for a generation that “has had profound impacts on society,” he said.

“You saw the demand for baby food and diapers when they were young, then you saw the car industry ex-plode when they got older, and now we are seeing a need for healthcare.”

For more information, visit www.intouch-at-home.com or call (855) 448-8900.

Justine Ortiz cares for an InTouch at Home client.

BY TERRIE LITWIN, RSF SENIOR CENTER, EXECUTIVE DIRECTOR

Understanding Your Diabetes & Cardio-vascular Disease Medications: Wednesday, Aug. 22, 10 a.m. Learn from a certified geri-atric pharmacist about what you can do to manage your diabetes, blood pressure and cholesterol medications. Understand how to assist a loved one who is having difficulty safely managing their medications at home. Bring your medications with you, and speak with a pharmacist about your specific medi-cation-related questions! Reservations are not required.

Summer Lecture Series with Richard Lederer – Reservations are not required!

•Wednesday, Sept. 5, 2 p.m. – Confes-sions of a Word Lover

•Wednesday, Sept. 12, 2 p.m. — An Af-ternoon of Language & Laughter

•Wednesday, Sept. 19, 2 p.m. – Conan the Grammarian

Classical Music Appreciation: Sept. 17 at 2 p.m.: Instructor Randy Malin leads a class featuring classical music composers and the music that has endured through the ages. Classical music fans and individuals who are less familiar but want to learn more, will find this class informative and enter-taining.

Balance & Fall Prevention Exercise Class: Monday mornings at 10:45 a.m.: Li-censed physical therapist Jim Prussack pro-vides practical and useful exercise tech-niques to improve balance, strengthen mus-cles, and help prevent falls. A $5 charge for each class is paid to the instructor.

Oil Painting Class: Bring your favorite photos to life with oil paints – from portraits to landscapes! This class is appropriate for all artists, from beginner to advanced and is taught by local artist Lynne Zimet — Thurs-

day mornings from 9:30 a.m. to 11:30 a.m.

Watercolor Class: RSF Art Guild member and local artist Pat Beck will show students how to create beautiful works of art using watercolor paints. This class is for both beginning and expe-rienced artists. Next series begins Friday, Sept. 7, at 10 a.m.

Rancho San Café – French Discussion Group: A wonderful opportunity for those with intermediate and advanced French lan-guage skills to enjoy a cup of coffee while conversing in French. Conversations are fa-cilitated by Philippe Faurie. The discussion group meets the first and third Thursday of the month at 10:30 a.m.

Free Blood Pressure Checks: This ser-vice provided by San Diego Medical Services, is offered the last Thursday of every month from 9:30 a.m. to 10:30 a.m. Walk-ins are welcome.

Acting Class with Monty Silverstone: Next session to be announced!

Resource & Referral Program: In addi-tion to the above programs and classes, the Senior Center’s Resource and Referral service is available Monday through Friday. Seniors and family members needing information about senior services can meet with staff to address a wide variety of needs.

For more information about any of the Senior Center’s programs, events and classes or to be added to the mailing list, please call (858) 756-3041. Additional special programs will be announced as they are scheduled.

RSF Senior Scene: Mark your calendars for the Senior Center’s special programs and classes

Terrie Litwin


Dixie and Ken Unhruh and Chris and Craig Andrews

Robert and Gena Joyce

Don Breitenberg and Jeanne Jones

Pilar DeLaTorre

Linda and Don Swortwood

Julie FissJerry Pikolysky and Lee Clark Lisa Albanez and Elaine Murphy

Corina Catalano and Tom Grunow

John and Kathryn Stephens

Las Patronas hosted its annual Jewel Ball event Aug. 4 featur-ing the 2012 theme “Passeg-

giata! (evening stroll)” For the eve-ning, the La Jolla Beach and Tennis Club was transformed into Italian scenes right out of “Roman Holi-day” or “La Dolce Vita.”

This year’s major beneficiaries include Alpha Project for the Home-less, American Red Cross, Greater San Diego After-School All-Stars, La Jolla Historical Society, Reuben H. Fleet Science Center, San Diego Hos-pice, Senior Community Centers, and the Zoological Society of San Diego. For more information, visit laspatronas.com. PHOTOS/CAROL SONSTEIN

Las Patronas Jewel Ball

Bobby, John and Thomas Murphy

Cathy Carroll, Barbara Bowen and Linda Kurtz Scott and Mary Lippman and Elspeth and Jim Myer

More on page B18


Encinitas Nursing & Rehabilitation Center

Award Winning Care in San Diego!

Perfect Score on our last State Survey. Come fi nd out why we

are the best in San Diego county.

Patient Rooms with Ocean ViewsSkilled Nursing at its BEST.

Offer Physical, Occupational & Speech Therapy among other great services for your loved ones.

Please call or stop by for a tour

760.753.6423 FIVE STAR RATED

900 Santa Fe Dr. Encinitas, CA 92024 www.EncinitasNursingANDRehab.com

760.635.1641310 N.Coast Hwy

Encinitas

760.943.7256136 Ranger Rd

Fallbrookwww.maddpotter.com

Where Pottery is just the beginning!

ENTIRE PURCHASE

Pottery • Fountains • Garden Art Succulents • Plumeria • Palms

Old World Pottery • Terra Cotta • TalaveraCustom Water Features • Unique Gifts

Glazed Pottery From Around The World

With this coupon. Not valid with other offers, exchanges or previous pur-

chases. In stock items only. Exp. 8.23.12

Topics discussed on the radio show are not meant to be interpreted as individual advice. Please consult with your tax or legal advisors for information on how the topics may apply to your particular situation. Neither the material on the radio broadcast constitutes an offer to sell or purchase any security. Securities offered through Independent Financial Group, LLC, member FINRA and SIPC. OSJ: 12636 High Bluff Dr., Ste 100, San Diego, CA. 92130. CA Insurance Lic. 0529290. Advisory services offered through Financial Designs, Ltd., a CA State Registered Investment Advisor. IFG is not affiliated with FDL.

Financial Designs, Ltd.Personal Financial Advisors Since 1981

5075 Shoreham Place, Suite 200San Diego, CA. 92122

Phone (858) 597-1980 · Fax (858) 546-1106

AM 600 KOGO News & Talk Radiovisit www.MoneyTalkRadio.com

with:Aubrey Morrow, Certified Financial Planner™

Forrest Padilla, Certified Financial Planner™

David Elhoff, Registered Principal

tune in to:

...to The Financial Advisors

Radio Series Every Saturday at 8am

On AM 600 KOGO

tune-in

Helping You PlanYour Financial Future

TOPICS INCLUDE: Investments, Real Estate, Retirement Planning, Comprehensive Personal Financial Planning,

Risk Management, Estate Planning, Income Tax Reduction Strategies and more.

THIS SATURDAY - AUGUST 11th

Are You Financially Organized? Part II

The World’s Finest Beds, Bath

& Linens

7616 Girard Ave 800.883.3305

everettstunz.com

August White SaleUp To 70% OFF!

BY RW “PETE” PETERSON Coincidence seems

prevalent in the world of in-vestigation. Sometimes in-vestigators become para-noid, probably as a byprod-uct of the work. However, sometimes the watcher be-comes the watched. Our firm has experienced in-stances where the subjects have hired their own inves-tigators and it became spy vs. spy. It can cause you to become very familiar with your rearview mirrors. It can also be very comedic.

We’ve had cases that turned out to involve the same people, same houses (years apart with different occupants), or addresses next door to each other years apart. Subjects of for-mer cases wanting to retain us.

One such coincidence was a case in which I had been contacted by a Denver oilman who was concerned about his estranged son who they believed was in Spring-field, Mo.

They hadn’t spoken for several years and he wanted to know if we could locate the son and determine what his situation was. We didn’t hear back from the client for two weeks.

Several days later a woman called us in Denver wanting to know if we could check on her husband who came to Denver several times a month on business. She thought he might be having an affair, she said she would call us back.

Approximately a week later we received a call back from the oil man and he

gave us a retainer to go to Springfield to see if we could locate his son. They knew through a friend that he was somewhere in the area, per-haps living on a farm.

I went to Springfield and located the son on the first day. That evening after dinner I went to a local country western night club. I was sitting at the bar and an attractive lady who was at a table with her friends walked by on her way to the restroom. We struck up a conversation and I joined them at the table. While dancing I told her my occu-pation and she said “that’s interesting because I talked to a Denver investigator a couple of weeks ago about possibly checking on my husband when he went to Denver on business.”

I remembered that call and told her that it was me that she had talked to.

I had been involved in some fairly heavy criminal cases that year, one involv-ing organized crime, and this conversation and chance meeting seemed very

The InvestigatorCoincidence and Paranoia

RW “Pete” Peterson

coincidental. What was the chance of the “oil man” sending me to Springfield and my encountering her in the night spot? (She had entered the place after me.)

As she told me more about her now legally sepa-rated husband, I realized that I had seen him months prior at a restaurant in Idaho Springs (just outside Denver where I had a house) several times when he was up in the mountains with his Polyne-sian girlfriend. I had no-ticed him because of his Corvette — I also had a Cor-vette. We had eaten several tables apart and had ex-changed compliments on our cars.

This was becoming more “coincidental.”

I had my office run background on the husband and found that he had been indicted on loan sharking and bookmaking. We also found that he had had busi-ness dealings with our “oil

man” client. The lady and I spent

the evening together and in the morning she told me that her husband was sched-uled to fly to Denver in the afternoon. When she told me the airline and flight I realized that it was the same flight that I was scheduled on.

On the flight I wore a cap and sat in a vacant seat far away from him. I didn’t want him to recognize me from Colorado. I was still trying to digest the whole scenario.

When I related this sto-ry to people they said things like “that’s not possibly a co-incidence” or “the odds of that coming together that way are out in the iono-sphere.”

After further investiga-tion my conclusion is that it was, in fact, a series of coin-cidences.

RW “Pete” Peterson has operated his investigative firm for 30-plus years. He can be reached at 760-443-0575; www.RWPeterson.com.

Former TPHS football coach Ed Burke seeks families to host members of Japanese football team

Former Torrey Pines High School football coach Ed Burke is hosting the senior members of the Ritsumeikan Uji Panthers football team from Kyoto, Japan, and is looking for families that are interested in hosting a player.

They will arrive the Friday evening, Aug. 17, and depart early Monday morning, Sept. 3. The team will be attending school and practicing at Torrey Pines during their stay, so most of the transportation needs will be similar to that of students attending Torrey Pines. They will be on campus from 7:30 a.m. to 5 p.m each school day.

If interested, please contact Ed Burke by phone at (760) 331-7412 or through email at [email protected].


Gerald and Tracy Bracht

Jan Jones and Kathleen Pacurar

Rusti Bartell and Steven Rosenberg

Jewel Ball continued from page B16

Megan and Oby Popal; Denise Hug

Jake Figi and Patsy MarinoBassam and Cari Massaad

Joyce Grosvenor and Catherine Clark

BY ARNOLD E. CUENCA, DO, SCRIPPS HEALTH

For many kids across San Diego County, August means back to school. For parents, it means making sure kids have everything they need for a suc-cessful start to the school year. Use the health and safety “checklist” below to ensure your kids are ready to go.

Immunizations: Check that your kids have the recommended (and often required) immunizations before the school year begins. Under the Califor-nia School Immunization Law, children are required to receive certain immuni-zations in order to attend public and private elementary and secondary schools, child care centers and other educational programs. Immunizations required to attend kindergarten include polio, DTaP (diphtheria, tetanus, per-tussis), measles-containing vaccine (e.g. MMR), Hepatitis B, and Varicella (chicken pox). Starting with the 2012-13 school year, all students entering into seventh grade will need proof of an adolescent pertussis (whooping cough) booster immunization (Tdap) in order to begin school. Pertussis is a very contagious respiratory disease that can be severe and last for months; although many children were vaccinated during early childhood, immunity wears off over time, leaving older students and adults susceptible. Ask your pediatri-cian or family physician which immu-nizations your child may need.

Annual physical: It’s a good idea for all kids to have a yearly check-up with their physician to make sure they are in good health and receive vision

and hearing tests. This can also be an opportunity for physicians to talk to kids privately about any health issue or questions they may have—often, kids may not be comfortable discussing cer-tain topics with their parents present.

Avoid backpack overload: Kids today carry a lot of stuff. A backpack that is too heavy, poorly constructed or worn incorrectly can injure the muscles and joints, cause neck or back strain, and lead to fatigue. Choose a light-weight backpack with two wide, well-padded shoulder straps, a padded back and a waist strap. Pull both straps tight-ly enough so that the pack fits snugly against the back but doesn’t pull on the shoulders. Distribute the weight of items within the pack evenly on both sides, and don’t overload it. The Ameri-can Academy of Pediatrics recommends that backpacks not exceed 10 to 20 per-cent of the child’s weight.

Get back on track: For many kids, summer break means staying up later and sleeping in. Do yourself and your kids a favor by gradually getting them back on their school schedules. Encour-age them to go to bed earlier and wake up earlier for a week or so before the first day of class, and make time for a healthy breakfast, so that by the time school begins, they’ll be used to the change in schedule.

Similarly, prepare kids to get back into the school routine after a carefree summer. Discuss when and where homework will be done, make after-school care arrangements if necessary (including a back-up plan) and deter-mine how kids will get to extracurricu-

lar activities such as sports. Getting ev-eryone on the same page will make it easier to juggle busy schedules.

Keep schedules realistic: Sports, clubs and other after-school activities are a great way to keep kids active and engaged, but too much can be un-healthy. “Over-scheduling” can lead to stress, fatigue and anxiety; over-train-ing for sports can cause physical inju-ries such as stress fractures. Make sure your kids have enough “down time” to rest and unwind, and don’t pressure them to participate in activities they don’t enjoy.

Make lunch healthy: If your child brings lunch to school, include fruit or veggies and a lean protein source such as chicken or turkey. Try to avoid pro-cessed foods or high-fat, high-calorie items. Substitute baked chips for fried and whole-grain bread for white. If the plan is to buy lunch, talk about how to make healthier choices.

Provide important information: Make sure the school has current, accu-rate contact information for parents, emergency contacts, and your child’s physician. Let the school know of any medications your child takes both at home and at school, as well as any medical conditions such as diabetes, asthma, or allergies to bees, peanuts, la-tex, or anything else. Ensure the school knows what to do in case of an emer-gency.

Talk it over. Take time every after-noon or evening to ask your child about his or her school day. Ask about lessons, what they learned that was new or interesting, favorite and least

To Your Health: Get your kids ready for school favorite parts of the day, and so on. This is a good way to un-cover possible problem areas and show your child that you care about how he or she is doing.

Dr. Arnold Cuenca is a family medicine and sports medicine physician with Scripps Health. “To Your Health” is brought to you by the physicians and staff of Scripps Health. For more informa-tion or a physician referral, please call 1-800-SCRIPPS.

discuss her book, “El Cabal-lero del Titanic,” which doc-uments the story of Manuel Uruchurtu Ramírez, the only Mexican passenger aboard the ill-fated ship. Tickets: $18-$27. (877) 946-7797. sdnhm.org

Sounds of SummerSwing to the sounds of

Benny Hollman’s Big Band Explosion when La Jolla Concerts by the Sea presents the music, 2-4 p.m. Sunday, Aug. 12 at Scripps Park, La Jolla Cove. The free concert is underwritten by conces-sion sales. (858) 454-1600. ljconcertsbythesea.org

SummerFest Going Strong: La Jolla Music Soci-ety’s chamber music concert series is in full bloom with free-to-the-public rehearsals and encounters, evening concerts and preludes through Aug. 24 at Sher-wood Auditorium, Museum of Contemporary Art, 700 Prospect St. This week you can hear the Tokyo String Quartet, pianists John Nova-cek and Ken Noda, the New-

bury Trio, and clarinetist John Bruce Yeh, among many others. Tickets: $50 and $75. (858) 459-3728. View the schedule at ljms.org

Ballet for BeginnersSan Diego Civic Youth

Ballet (the resident classical ballet school of Balboa Park since 1945) will present its fourth annual “Fairy Tales in the Park” with performances at 1, 3 and 5 p.m. Saturday, Aug. 18. The program is a whimsical, interactive dance event for families to intro-duce them to the art of bal-let through familiar stories. This year’s will be “Little Red Riding Hood” and “Beauty & the Beast,” narrated by a professional storyteller and interpreted by student danc-ers and guest artists. The event takes place in the Casa del Prado Theatre, 1800 Vil-lage Place, in Balboa Park. Doors open 30 minutes be-fore each 45-minute show. Tickets: $10. (619) 233-3060. sdcyb.org

EVENTS continued from page B8


BY CATHARINE KAUFMANAug. 10 has been desig-

nated “National S’mores Day” in honor of this quint-essential campfire treat. Cre-ative culinary minds have tweaked the iconic recipe to make it even more fun and scrumptious (if that’s possi-ble), while health-conscious chefs have re-jiggered the in-gredients to make it more guilt-free.

No one has really laid a solid claim to the invention of s’mores, although the first recipe for this novel sand-wich appeared in a 1927 handbook, “Tramping and Trailing with the Girl Scouts.” The basic ingredi-ents and Simple Simon con-

cept provided a portable and non-perishable treat for camping trips and cookouts.

The name’s origin, prob-ably apocryphal, is the con-traction of “some more,” supposedly the garbled ver-biage from a child scarfing down a mouthful of the treat and asking for a second help-ing.

S’mores consist of three solid components: marsh-mallows, honey Graham crackers and chocolate bars.

The former, the oldest and gooiest has been around for 4,000 years when ancient Egyptians blended honey with root extracts of the marshmallow plant to create a sore throat elixir. Millenni-ums later, French gastro-nomes refined the recipe by blending egg white me-ringues and rose water into the gummy root juices to create a frothy paste. Today’s marshmallow is completely void of the mallow plant juices, swapping them out for gelatin and corn syrup giving the confection its fa-miliar pillowy shape.

The second component is the Graham cracker named after the pioneer health food guru, Sylvester Graham who

created the crisp, high-fiber flat bread from non-sifted whole-wheat flour in the 1820s.

The final ingredient to complete is the food of the gods: chocolate. Cocoa entre-preneur Milton Hershey honed the blissful milk choc-olate bar at his Pennsylvania

factory. He mass-produced and distributed the iconic Hershey bar for all wallets to enjoy.

For s’mores galore here’s a gustatory line-up for those who want a break from tradi-tion:

• Amore, s’more: Make an Italian version with a ha-

zelnut chocolate spread like Nutella.

• Aloha with a Hawaiian flare of toasted coconut and candied pineapple chunks.

• Go Mediterranean with a sprinkling of sea salt and cayenne pepper.

• South-of-the-border s’mores use Mexican choco-late and a dash of cinnamon and nutmeg.

• The Blondie is made with organic white choco-late.

• The Elvis uses the King’s favorite sandwich fix-in’s — peanut butter and ba-nanas.

• The Grasshopper fea-tures mint chocolate.

• The Turtle adds cara-mel and toasted pecans to the middle.

• Tutti Frutti adds your favorite fruit to the mix, like blueberries, strawberries, peach slices or dried apricots.

• Sustainable S’mores are a health-conscious, organic version with made-from-scratch Graham crackers and marshmallows along with high-octane, full-of-antioxi-dants bittersweet chocolate.

• Vegans can buy kosher marshmallows sans animal by-products (gelatin) or seek

out a soy-based mallow spread.

• Adult-only S’mores employ Martini of Smirnoff Marshmallow or cinnamon-infused vanilla vodka, choco-late liqueur and bitters.

Around town, you can sample these concoctions minus the bonfire: The Gaslamp’s Saltbox offers Chef Simon Dolinky’s “Campfire S’more,” which marries house-made marsh-mallows and Graham crack-ers with a smoked chocolate drizzle; Sprinkles La Jolla does a s’mores cupcake com-bining Graham cracker cake filled with bittersweet choco-late ganache and marshmal-low frosting; pig out with Gaijin Noodle + Sake House’s kitschy Bacon S’mores, mix-ing crisky nueske bacon driz-zled with Hershey’s choco-late, toasted marshmallows and house-made Grahams. The US Grant’s Chef Chris Kurth monkeys around with vanilla marshmallows, Gra-ham cracker ice cream and brown sugar bananas, driz-zled with warm fudge.

— For homemade marsh-mallow or graham-cracker reci-pes, e-mail [email protected]

There’s more than one way to make a s’more, señor!The Kitchen Shrink

Ingredients■ 2 slices of bread (Chal-lah, Brioche are best)■ 4 honey Graham crack-ers, crushed■ 2 squares good quality dark chocolate■ 4 marshmallows, toast-ed■ 1/8 cup almond or coco-nut milk or half and half cream■ 2 large eggs■ 1 teaspoon butter or canola oil■ 1/2 teaspoon vanilla ex-tract■ 1/2 teaspoon cinnamonDash of salt

Method: In a large mixing bowl whisk together milk, eggs, vanilla, cinnamon and salt. Soak bread in the mixture for a minute

or two, then coat with crushed Graham crumbs.

In a skillet, on medium, melt butter or heat oil. Assemble the s’mores French toast by placing the toasted marshmallows on one slice, topping with chocolate, and then place the other piece of Gra-ham-crusted bread on top. Pan fry on both sides until golden and gooey.

S’mores Stuffed French Toast

To place your ad call 800.914.6434B20 August 9, 2012 Rancho Santa Fe Review

MARKETPLACE your neighborhood classifiedsindex

For Rent PAGE B20

Real Estate

PAGE B20

Home Services PAGE B20

For Sale PAGE B20

Health & Beauty PAGE B20

Jobs PAGE B21

Legal Notices PAGE B21

Pets & Animals PAGE B21

Crossword PAGE 21

CONTACT US800.914.6434

[email protected]

LEGAL NOTICESDebbie 858.218.7235

OBITUARIESCathy 858.218.7237

CELEBRATIONS858.218.7200

PET CONNECTIONKaty 858.218.7234

RELIGION858.875.5956

RENTALS858.218.7200

IN PERSON: Monday - Friday 8am to 5pm 3702 Via De La Valle, Suite 202WDel Mar, CA 92014

DEADLINES:Classified display ads Monday 12pm

Line ads and Legals Monday 5pm

Houses

(858) 259-4000

DEL MAROceanfront

$3100/ Month

CARMEL VALLEY2BR/ 2BA

$3,500/ Month

CARDIFF3BR/ 3BA

$5,500/ Month

DEL MARL’Auberge, Furnished$2,850 / $3,850 / Month

DEL MARShort-term, Furnished

$4,000/ Week

SOLANA BEACHShort-term, Furnished

$3,500/ Month

FREEProperty Management

Joe Jelleyjoejelley@

jelleyproperties.com858-259-4051619-200-3400

www.jelleyproperties.com

LA JOLLA SHORES Great family home. walk to Beach Club, minutes to Bishop’s and La Jolla High, 4BR/3BA, formal dining, family, separate nanny or teen room w/BA, AC, and pool. $7,300. 858-344-9004

Wanted

A PROPERTY CARETAKER THAT PAYS YOU!

http://NancyCaretakerGallery.Shutterfly.com

858-759-9652 [email protected]

FOR RENT

OFFER YOURSERVICESin the Marketplace

Call800.914.6434

Lessons

HOME SERVICES

Concrete Masonry

HARDSCAPE CONSTRUCTION

Patios, Driveways, Walkways, Pavers, BBQs,

Stamped, Retaining Walls, Stucco, Landscape.

15% OFF LABORQuality Work

Reasonable RatesBonded & Insured

Lic. 813748

858-583-6324Woodworth Construction

For SaleAuto

1973 CORVETTE $23,65065K miles, A/T, PW, PS, PB New top, interior, tires.www.funcarsofsandiego.comWe BUY and sell - Fun Cars619-807-8770 858-212-5396

REAL ESTATE

Services

WOLF REAL ESTATEGROUP

TIRED OF THE STOCK MARKET?

Investment / Fixers avail in SD County.

Call 858-243-4100 or visit:

www.wolfrealestategroup.com

RENT YOUR SPACE IN THE MARKETPLACE CALL TODAY! 800-914-6434 or 858.218.7200

SELL YOUR ITEMS FOR $12.52 Private parties only, items up to $500. Call 800-914-6434

Health And Beauty

RSF References

Veronica RaggioCertified Massage Therapist

Relieve stress and muscle tension.Enjoy a professional combination

of Swedish, Deep Tissue and Neuromuscular/Trigger Point technique

in the convenience of your home.

1 HourMassage $85Gratuity not accepted

For Appointment619-886-5522

WILL MANAGE ESTATE/CARETAKE in exchange for Cottage/Guesthouse. Responsible professional. Horse property ideal, have extensive experience with horses. 619-742-6450

Exclusive and Prestigious Central Location

22,495 Sq Ft Total Building Size

14,112 Sq Ft Available for Buyer to Occupy

Highly Functional and Visually Pleasing Office Improvements

Excellent Freeway Access to I-805, I-5 and SR-52

Attractive SBA Financing Available

GOVERNOR PARK OFFICE 5040 Shoreham Place | San Diego 92122

TOM WILCOX(858) 677-5345 License No. [email protected]

JOHN GROSS(858) 677-5350 License No. [email protected]

GOLDEN TRIANGLE Purchase Opportunity

RARE

Home Improvement/ RepairsSUMMER’S HEREGet your Deck, Patio Cover & Decorative Concrete work done now. Free estimate. 30 years exp. Lic #469422Blue Pacific Contracting760-519-3524

Lawn & Garden

FREE BOOK with EVERY JOB!

New Customers onlyProducts (excluding Liner)

NewNew Cu Custostomermers os onlynly

San Diego’s #1 Pond StoreConstruction – Service – Maintenance

We have everything you need!

Call 858-486-0033

14055 Midland Rd., Powaysdpondandgarden.com

Lic. #933311

10% OFF

Largest Selection of High Quality Koi and Aquatic Plants

858-486-0033

San Diego Pond & Garden

Services

Chimney Sweeps, Inc. 619-593-4020

Is Your CHIMNEYStructurally Sound?

FREE inspection for NEW customers

and water damage

Family Owned and Operated

Since 1985 Fully Licensed

and Insured

Any other interesting rare

European/American Classics, including

muscle cars.

WANTEDEarly European & American Classic Cars

By Local CollectorFinders Fee Gladly Paid!

(858) 454-0856 or (602) 810-2179

For SaleCLUB CAR GOLF CART, like new, used less than 10 times, bright cherry red, chrome wheels, all the extras. $6200. 760-213-1510

DID YOU KNOW? The US nickname Uncle Sam was de-rived from Uncle Sam Wilson, a meat inspector in Troy, New York.

To place your ad call 800.914.6434 Rancho Santa Fe Review August 9, 2012 B21

OFFER YOURSERVICESin the Marketplace

Call 800.914.6434

Need a new home for your pet due to life changes?

only $699includesa 1 inchphoto andan onlineposting.

800-914-6434 or 858-218-7200

Help Wanted

KIDS BACK TO SCHOOL? Earn $500-$2000/mo?

P/T Flexible Schedule Established Company

Bonuses and Commissions Computer Required

Full Training Provided 760-440-5612

JOBS & EDUCATION

all or some of the personal property, fixtures and other general tangibles and intangibles more particularly described in the Deed of Trust, Guarantees, UCC’s and/or Security Instruments. The street address(es) and other common designation(s), if any, of the subject real property described above is purported to be: APN 303-100-24-00, 14747 ROXBURY TERRACE, Rancho Santa Fe, CA 92067; the legal description of which is attached hereto as Exhibit “A” and incorporated herein by this reference. EXHIBIT “A” THE LAND REFERRED TO HEREIN IS SITUATED IN THE STATE OF CALIFORNIA, (UNINCORPORATED AREA), COUNTY OF SAN DIEGO AND IS DESCRIBED AS FOLLOWS: PARCEL 1: LOT 24 OF COUNTY OF SAN DIEGO TRACT NO. 4865, IN THE COUNTY OF SAN DIEGO, STATE OF CALIFORNIA, ACCORDING TO MAP THEREOF NO. 13355, FILED IN THE OFFICE OF THE COUNTY RECORDER OF SAN DIEGO COUNTY, AUGUST 29, 1996. PARCEL 2: AN EASEMENT AND RIGHT OF WAY FOR INGRESS, EGRESS, DRAINAGE AND PUBLIC UTILITIES OVER, UNDER, ALONG AND ACROSS LOT 28 OF COUNTY OF SAN DIEGO TRACT NO. 4865, IN THE COUNTY OF SAN DIEGO, STATE OF CALIFORNIA, ACCORDING TO MAP THEREOF NO. 13355, FILED IN THE OFFICE OF THE COUNTY RECORDER OF SAN DIEGO COUNTY, AUGUST 29, 1996. PARCEL 3: AN EASEMENT APPURTENANT TO LOT 24 OF MAP 13355 IN THE COUNTY OF SAN DIEGO, STATE OF CALIFORNIA, FILED IN THE OFFICE OF THE COUNTY RECORDER OF SAN DIEGO COUNTY AUGUST 29, 1996 AS FILE NO. 1996-440494 OVER LOT 23 OF SAID MAP 13355, FOR CONSTRUCTION, RECONSTRUCTION AND MAINTENANCE OF A RETAINING WALL AND RIGHTS INCIDENT THERETO WHICH INCLUDES BUT IS NOT LIMITED TO THE RIGHT FOR FOOTINGS AND SUBTERRANEAN SYSTEMS FOR THE WALL AS SHOWN ON THE FOLLOWING LEGAL DESCRIPTION: THAT PORTION OF LOT 23 ACCORDING MAP THEREOF NO. 13355 FILED IN THE OFFICE OF THE COUNTY RECORDER OF SAN DIEGO COUNTY, STATE OF CALIFORNIA, AUGUST 29, 1996 AS MORE FULLY DESCRIBED AS FOLLOWS: BEGINNING AT THE SOUTHWESTERLY CORNER OF SAID LOT 23; THENCE EASTERLY ALONG THE SOUTHERLY LINE OF SAID LOT 23 NORTH 76° 05’ 05” EAST, 43.00 FEET TO THE TRUE POINT OF BEGINNING; THENCE CONTINUING ALONG SAID SOUTHERLY LINE NORTH 76° 05’ 05” EAST 67.00 FEET; THENCE LEAVING SAID SOUTHERLY LINE NORTH 13° 54’ 55” WEST, 10.00 FEET; THENCE WESTERLY ALONG A LINE PARALLEL WITH AND 10.00 FEET NORTHERLY OF SAID SOUTHERLY LINE SOUTH 76° 05’ 05” WEST, 67.00 FEET; THENCE SOUTH 13° 54’ 55” EAST, 10.00 FEET TO THE TRUE POINT OF BEGINNING. The undersigned trustee disclaims any liability for any incorrectness of the street address and other common designation, if any, shown herein. The Beneficiary under said Deed of Trust has heretofore executed and delivered to the undersigned a written Notice of Default and Election to Sell. The undersigned caused said Notice of Default and Election to Sell to be recorded in the County where the real property is located. August 1, 2012 GALT HOLDINGS, INC. a California corporation by: Paul T. Johnson, Vice President Sales Information: (760) 431-8988 x 4 GALT HOLDINGS, INC., A CALIFORNIA CORPORATION, IS ASSISTING THE BENEFICIARY

TO COLLECT A DEBT AND ANY INFORMATION OBTAINED MAY BE USED FOR THAT PURPOSE WHETHER RECEIVED ORALLY OR IN WRITING. If the trustee is unable to convey title for any reason, the successful bidder’s sole and exclusive remedy shall be the return of the monies paid to the Trustee, and the successful bidder shall have no further recourse. By bidding at the trustee’s sale noticed herein, all bidders expressly agree to the terms and conditions of the preceding sentence. P970544 8/2, 8/9, 08/16/2012. RF256

FICTITIOUS BUSINESS NAME STATEMENTFile No. 2012-019556Fictitious Business Name(s):Brilliant DiamondsLocated at: 861 6th Ave., Ste. 411, San Diego, CA., 92101, San Diego County. This business is conducted by: An Individual. The first day of business was: 07/20/2012. This business is hereby registered by the following: Ariel Berko, 7235 Calabria Ct., #98, San Diego, CA., 92122. This statement was filed with Ernest J. Dronenburg, Jr., Recorder/ County Clerk of San Diego County on 07/20/2012. Ariel Berko. RF255, Aug. 2, 9, 16, 23, 2012

FICTITIOUS BUSINESS NAME STATEMENTFile No. 2012-019958Fictitious Business Name(s):Charles Dorsch Ship’s Agent, Inc.Located at: 1981 Main Street, San Diego, CA., 92113, San Diego County. This business is conducted by: A Corporation. The first day of business was: 12/01/2011. This business is hereby registered by the following: Charles Dorsch, Ship’s Agent, Inc., 1981 Main Street, San Diego, CA., 92113. State of Incorporation/Organization: California. This statement was filed with Ernest J. Dronenburg, Jr., Recorder/ County Clerk of San Diego County on 07/25/2012. Russell Bruce Thornburg. RF254. Aug. 2, 9, 16, 23, 2012

FICTITIOUS BUSINESSNAME STATEMENFile No. 2012-018388Fictitious Business Name(s):From Above Productionslocated at: 6370 Paseo Aspada, Carlsbad, CA., 92009, San Diego County. This business is conducted by: A General Partnership. The first day of business was: July 5, 2012. This business is hereby registered by the following: #1. Phil Barron, 6370

LegalsTS# 2910010 TO# 6516740 / (DARIEN MCDONALD) APN: 303-100-24-00 YOU ARE IN DEFAULT UNDER A DEED OF TRUST DATED DECEMBER 28, 2007. UNLESS YOU TAKE ACTION TO PROTECT YOUR PROPERTY, IT MAY BE SOLD AT A PUBLIC SALE. IF YOU NEED AN EXPLANATION OF THE NATURE OF THE PROCEEDING AGAINST YOU, YOU SHOULD CONTACT A LAWYER. NOTICE OF TRUSTEE’S SALE NOTICE IS HEREBY GIVEN that GALT HOLDINGS, INC., a California corporation, as duly appointed Trustee under and pursuant to the Deed of Trust dated DECEMBER 28, 2007, recorded on JANUARY 2, 2008 as instrument #2008-0001786 of the Official Records of the County of San Diego, State of California, executed by: ALB PROPERTIES, LLC, A CALIFORNIA LIMITED LIABILITY COMPANY, under the power or sale contained therein, WILL SELL AT PUBLIC AUCTION TO THE HIGHEST BIDDER FOR CASH (payable in full at the time of sale) ON AUGUST 28, 2012, 10:00 AM AT THE ENTRANCE TO THE EAST COUNTY REGIONAL CENTER BY STATUE, 250 E. MAIN STREET, EL CAJON, CA 92020, all rights, title and interest conveyed to and now held under said Deed of Trust in the subject real property situated in said County and State and as is more fully described in the above referenced Deed of Trust. In addition to Cash (lawful money of the United States of America), the Trustee will accept cashier’s checks drawn on a state or national bank, a check drawn by a state of federal credit union, or a check drawn by a state or federal savings and loan association, savings association or savings bank specified in Section 5102 of the Financial Code and authorized to do business in this State. The total amount of the unpaid balance with interest thereon of the obligation secured by the property to be sold and reasonable estimates costs, expenses and advances at the time of the initial publication of the Notice of Sale is $3,632,131.25. Said sale will be made, in an “AS-IS, WHERE-IS” condition, but without covenant or warranty, express or implied, regarding title, possession, or encumbrances, to satisfy the indebtedness secured by said Deed of Trust, all advances thereunder, with interest as provided therein, and the unpaid principal of the Note(s) secured by said Deed of Trust with interest thereon as provided in said Note, plus fees, charges and expenses of the Trustee and of the trusts created by said Deed of Trust. The beneficiary may elect, in its discretion, to exercise its rights and remedies in any manner permitted under Section 9501 (4)(A)II of the California Commericial Code, or any other applicable section, as to

LEGAL NOTICES

PET CONNECTION

ESCONDIDO HUMANE SOCIETY DISCOUNTING ADOPTION FEES IN AUGUST, SEPTEMBER AND OCTOBER In an effort to find homes for 1,500 animals during August, September and October, the Escondido Humane Society is reducing adoption fees to just $25 for all dogs, cats and bunnies during those three months. [email protected] (760) 888-2242

ADVERTISE YOUR PET EVENTS AND SERVICES

Contact Katy at 858-218-7234 or [email protected]

KOSMO is a 3-year old male Cairn Terrier-blend. He has been neutered and is up-to-date on all his vaccinations. His adoption fee is $264 and he is micro chipped for identification. As an added bonus, Kosmo also comes with two free passes to SeaWorld! For more information call 858-756-4117 or visit www.animalcenter.org

AN

SWER

S 8/

2/12

CROSSWORD

Schools & Instruction

Be job-ready in six months for:

One program trains you for multiple job opportunities!

Next session begins Sept. 17th

858-836-1420www.theaccountingacademy.com

Financial Services

Guaranteed Principal and Guaranteed Growth 6.0%GUARANTEED GROWTH RATE

or 760-452-5557EXALT INSURANCE SERVICES No Fees

CA Lic #OEO5696

Providing access to pension, banking & insurance instruments for over 10 years.

DID YOU KNOW? The oldest breed of dog is the Saluki.

LEGAL NOTICESCall Debbie

858.218.7235fax 858.513.9478


6200 Sq ft elegant Tuscan estate. 5 ac grove nets $25,000 yearly. Gorgeous home has everything the discerning homeowner wants...and more... 5B, 4.5 ba, Viking Kitchen, Master Wing, Amazing Views & Ocean Breezes!

6183 Villa Pavrone, Bonsall CA Offered at $1,650,000

Mary Connor | 760 842-6100view video:www.MaryForHomes.comCA DRE# 01770375

Open Sun 1-4

Discover Bonsall!• Quaint Country Village • Award winning schools• Horse ranches, vineyards, & groves• Surrounded by golf courses • 12 miles to ocean

Nestled on a hilltop in beautiful Del Mar, this tasteful villa is the perfect home. 3950sf of living space; 4 bedrooms, 4 bathrooms, family room, dining room, living room, laundry room, gourmet

kitchen, and 2 car garage. Just minutes from the beach with peaceful hilltop view, outdoor BBQ kitchen, patios, sweet smelling gardens, and croquet lawn. Native plants and songbirds abound. Enjoy the amazing views.

EUROPEAN VILLA IN DEL MAR $1,799,000 REDUCED TO $1,690,000

Hedy Goldman858.504.2334Windermere Real Estate So Calwww.HedyGoldman.com

This home was built in 2008 with an upstairs master retreat and 30’ x 10’ balcony with peek ocean views. Brazilian cherry hardwood floors, floor to ceiling windows, heated floors, large grass yard and 1 block to the beach.

BEACH BARBER TRACT CONTEMPORARY OFFERED AT $2,975,000

Scott ApplebyKerry Appleby [email protected]

OPEN SUNDAY 1-4PM420 DUNEMERE DRIVE

Willis Allen Realtor Linda Sansone to appear on Bravo’s Million Dollar Listing Los Angeles on Aug. 15Willis Allen Real Estate’s Linda Sansone will appear on Bravo’s hit

television series Million Dollar Listing Los Angeles on Wednesday, Aug. 15, at 6 p.m.

Sansone appears on the show to highlight a $6.5 million Rancho Santa Fe villa that she has co-listed with one of the stars of the show, Los Angeles Realtor Josh Flagg.

The 9,300-square-foot Rancho Santa Fe Covenant estate is situat-ed on 2.87 richly landscaped, gated and fenced acres. The Tuscan-in-spired main villa features a spacious, flowing floor plan with a grand foyer, five bedroom suites, five bathrooms, two powder rooms, chef’s kitchen, walnut-paneled library, family room, game room with profes-sional granite-flanked bar and climate-controlled wine cellar, state-of-the art theatre, and four-car garage.

The large backyard offers an outdoor living/dining room that seamlessly opens from the family room. The outdoor living space fea-tures a summer kitchen, pool with three grottos and a spa, and a one bedroom guest casita (music studio) with living room and full bath.

Modern amenities and exclusive finishes throughout the home include: distressed wood floors,

Linda Sansone

travertine, faux finishes, carved wood crown moldings and doors, gorgeous draperies, custom wrought iron light fixtures, hand laid stone work, slabs of granite, custom designed wrought

iron staircase, unique stone fireplaces, and cus-tom-designed cabinetry throughout.

To reach Willis Allen Realtor Linda San-sone, call (858) 775-6356.

Encinitas Lifestyles Fashion Show is Aug. 25The Downtown Encinitas MainStreet Association (DEMA) recently announced that its 5th

Annual Encinitas Lifestyles Fashion Show will be held on Saturday, Aug. 25, at 5:30 p.m. This year’s event, showcasing the diverse and unique fashions of local retailers, will be held in the cavernous garage of Encinitas Foreign & Domestic Auto Repair (901 2nd Street , at H Street).

The evening begins with an adults-only outdoor reception at 5:30 p.m., featuring wine, beer, appetizers from nearby restaurants, and live music. The party moves indoors at 7 p.m., where the runway models will be accompanied by the music of DJ Gabe Vega and video by Tregtronics.

Tickets ($25 general admission, $40 VIP) are on sale at the DEMA office and at www.en-cinitas101.com. All proceeds benefit the DEMA High School Scholarship Fund.

REAL ESTATE SHOWCASE

Paseo Aspada, Carlsbad, CA., 92009. #2. Sam Wells, 3660 Seaflower Lane, Oceanside, CA., 92056. This statement was filed with Ernest J. Dronenburg, Jr., Recorder/County Clerk of San Diego County on 07/06/2012. Phil Barron. RF253, Jul. 26, Aug. 2, 8, 16, 2012

FICTITIOUS BUSINESS NAME STATEMENTFile No. 2012-019501Fictitious Business Name(s):Sandras Sculpture Studio

Located at: 8165 La Milla, Rancho Santa Fe, CA., 92067, San Diego County. Mailing Address: P.O. Box 908, Rancho Santa Fe, CA., 92067. This business is conducted by: An Individual. The first day of business: has not yet started. This business is hereby registered by the following: Sandra Eng, 8165 La Milla, Rancho Santa Fe, CA., 92067. This statement was filed with Ernest J. Dronenburg, Jr., Recorder/ County Clerk of San Diego County on 07/19/2012. Sandra

Eng. LJ1167, Jul. 26, Aug. 2, 9, 16, 2012

FICTITIOUS BUSINESS NAME STATEMENTFile No. 2012-019432Fictitious Business Name(s):Susan Stone KummerLocated at: 1175 La Moree Rd., San Marcos, CA., 92078, San Diego County. Mailing Address: 1175 La Moree Rd. This business is conducted by: An Individual. The first day of

Place your ad online anytime!

We now have a complete classifi ed advertising self-service and

payment system on our website!

From items for sale, to rental and transportation needs, to garage

sales, announcements and services, to obituaries and fi ctitious

business name notices, and more.

business: has not yet started. This business is hereby registered by the following: Susan Stone Kummer, 1175 La Moree Rd., San Marcos, CA., 92078. This statement was filed with Ernest J. Dronenburg, Jr., Recorder/ County Clerk of San Diego County on 07/19/2012. Susan Stone Kummer. RF252, Jul. 26, Aug. 2, 9, 16, 2012

FICTITIOUS BUSINESS NAME STATEMENTFile No. 2012-019022

Fictitious Business Name(s):Better Than Mama’sLocated at: 535 Broadway #205, El Cajon, CA., 92021, San Diego County. Mailing Address: 13465 Camino Canada, Ste. 106, PMB 427, El Cajon, CA., 92021. This business is conducted by: A Limited Liability Company. The first day of business: has not yet started. This business is

hereby registered by the following: Better Than Mama’s LLC., 535 Broadway #205, El Cajon, CA., 92021. State of Incorporation/Organization: California. This statement was filed with Ernest J. Dronenburg, Jr., Recorder/ County Clerk of San Diego County on 07/16/2012. Sheri Wareham. RF251, Jul. 26, Aug. 2, 9, 16, 2012

SERVICES

Complete Plumbing Repairs

858.350.5841

carmel valleyPLUMBING

24 Hr. Emergency Flood & Restoration Service

We charge by the job...not by the hour

Sell Your StuffFor $1252

For 4 weeksIndividuals only and items under $500

Place your ad at: myclassifiedmarketplace.com


HOME OF THE WEEK Privacy in Old Muirlands

Jim Hennessy · 866-625-2197 · www.jimhennessy.com Patton Properties

· Gated French Country Estate in the Hills of The Muirlands

· Ocean View

· Separate Guest Residence

· Lot size 1.33 acres

· Master Retreat with Spa Bathroom and Private Atrium

· Formal Garden

This home is currently offered for sale ranging between$5,275,000 and $5,925,000

K. Ann Brizolis leads U.S. marketRecogniz-

ing her incredi-ble sales achievements from 2011, K. Ann Brizolis was recently named to The Thousand for 2012, a presti-gious list com-piled by The Wall Street Jour-nal and Real Trends, Inc. Br-izolis and her team ranked at the 102 posi-tion for their sales out of the top 1,000 agents in the U.S.

“Ann’s commitment to ethical business practices has made her one of the nation’s elite agents,” says Herb Josepher, manager of Prudential California Realty’s Rancho Santa Fe real estate offices.

A broker associate, Brizolis is currently a director of Prudential’s Luxury Properties Di-vision. Having specialized in the marketing and sale of Rancho Santa Fe estates and fine homes throughout her 23-year career, she is known for her understanding of the com-plex local market and ability to deliver opti-

mal results for her buyers and sellers. Well-connected and thorough, Brizolis

attributes her success to her innovative ap-proach to marketing and her ability to col-laborate with colleagues on behalf of her cli-ents. “My team and I have always been com-mitted to provide our clients with a superior standard of service and support,” says Brizo-lis. “Everything that we do is centered on this simple philosophy.”

To exemplify her dedication to serving her clients, Brizolis recently hosted an invi-tation-only home tour and networking event to showcase three distinctive estates she listed for sale in the Covenant of Ran-cho Santa Fe. With attendance by some of the luxury real estate industry’s biggest names, who traveled from Los Angeles and Orange counties, the event provided each property with a tremendous amount of ex-posure.

“Our goal is to provide our sellers with the maximum possible return on their in-vestments, within the shortest time frame possible,” Brizolis said, “so we do everything that we can to accomplish that objective.”

K. Ann Brizolis and Associates may be reached at 858-756-6355, via email at [email protected], or on the web at www.kabr-izolis.com.

K. Ann Brizolis

United Way seeks volunteersUnited Way of San Diego County is looking for readers, tutors and mentors for San Diego

kids. To learn more about the program, visit uwsd.org and click on “Volunteer” or call (858) 636-4111.

Solana Beach

Del Mar

Rancho Santa Fe

Contact Colleen Gray TODAY to Receive YOUR FREE* open house listing! 858.756.1403 x 112 | [email protected]

Deadline for the print Open House Directory is 10:30am on Tuesday *Free to current advertisers with agreements, $25 per listing without a current agreement.

HOUSESOPEN$468,000 3674 Carmel View Rd Sun 1:00 pm - 4:00 pm 3BR/2BA Myriam Huneke, Coldwell Banker (619) 246-9999$599,000 5025 Caminito Exquisito Sat 1:00 pm - 4:00 pm 3BR/3BA Janet McMahon, Real Living Lifestyles (858) 361-6399$699,000 11349 Carmel Creek Rd Sun 1:00 pm - 4:00 pm 3BR/3BA Mary Heon, Coldwell Banker (619) 888-7653$879,000 4517 Calle Mar De Armonia Sat-Sun 1:00 pm - 4:00 pm 5BR/3BA Joseph & Diane Sampson, Sampson CA Realty (858) 699-1145$889,000 4297 Cordobes Sun 1:00 pm - 4:00 pm 5BR/4BA Joseph & Diane Sampson, Sampson CA Realty (858) 699-1145$929,000 5657 Willowmere Sun 1:00 pm - 4:00 pm 5BR/3BA Joseph & Diane Sampson, Sampson CA Realty (858) 699-1145$929,000 4685 Belvista Ct Sat-Sun 1:00 pm - 4:00 pm 3BR/2.5BA Charles & Farryl Moore, Coldwell Banker (858) 395-7525$979,000 13016 Chambord Way Sat-Sun 1:00 pm - 4:00 pm 4BR/3BA Charles & Farryl Moore, Coldwell Banker (858) 395-7525$1,030,000 3967 Corte Mar De Brisa Sat-Sun 1:00 pm - 4:00 pm 5BR/3.5BA J Greene/H. Patrize-Prudential CA Realty (858) 349-6626$1,275,000 4785 Keswick Court Sun 1:00 pm - 4:00 pm 5BR/4.5BA Mary Heon, Coldwell Banker (619) 888-7653$1,349,000 4358 Philbrook Square Sun 1:00 pm - 4:00 pm 5BR/4.5BA Charles & Farryl Moore, Coldwell Banker (858) 395-7525

$1,350,000 1558 Camino del Mar #519 Sun 1:00 pm - 4:00 pm 1BR/2BA Myriam Huneke, Coldwell Banker (619) 246-9999$1,925,000 13676 Mira Montana Drive Sat-Sun 1:00 pm - 4:00 pm 5BR/3BA Joseph Sampson, Sampson CA Realty (858) 699-1145

$1,195,000 7960 Entrada Lazanja Sun 1:00 pm - 4:00 pm 6BR/6.5BA Jen Drennan, Sampson CA Realty (858) 205-3077$1,199,000-$1,425,000 17176 Blue Skies Ridge Sun 1:00 pm - 4:00 pm 4BR/5.5BA Patricia Kramer, Prudential CA Realty (858) 945-4595$1,295,000 5530 La Palomas Sun 1:00 pm - 4:00 pm 3BR/3BA Pari Ziatabari, Coldwell Banker (858) 442-9940$1,650,000 16825 Via De Santa Fe Sun 1:00 pm - 4:00 pm 4BR/3BA J. Lawless Christ/hosts: B. & J. Campbell-Coldwell Banker (858) 449-2027$2,077,000 5154 Linea Del Cielo Sat-Sun 2:00 pm - 5:00 pm 4BR/5.5BA K. Ann Brizolis/C. Horn Prudential CA Realty (858) 756-6355$2,450,000 6619 La Valle Plateada Sun 1:00 pm - 4:00 pm 4BR/5.5BA Bill Talbott, The Sterling Company (760) 285-5137$2,495,000-$2,895,000 6550 Paseo Delicias Sat-Sun 1:00 pm - 4:00 pm 4BR/5BA Gallagher & Gallagher, Prudential CA Realty (858) 259-3100$3,895,000 15852 The River Trail Sat-Sun 1:00 pm - 4:00 pm 6BR/6.5BA J. Greene/hosts: S. & P. Linde-Prudential CA Realty (760) 585-5824$5,450,000 18011 Avenida Alondra Sun 1:00 pm - 4:00 pm 5BR/5.5BA K. Ann Brizolis/host: D. Henry-Prudential CA Realty (858) 756-6355

$1,499,000-$1,850,000 124 Via De La Valle #3 Sun 1:00 pm - 4:00 pm 3BR/2.75BA Gail Squires, Real Living Lifestyles (619) 972-1510

$2,095,000 565 Canyon Drive Sat-Sun 1:00 pm - 4:00 pm 5BR/5.5BA J. Greene/host: D. Williams-Prudential CA Realty (760) 585-5824

Carmel Valley


Shelley [email protected]

CA DRE #01114392

What Buyers are looking for in a Home Today?I try to hold many vacant homes ‘open’ a month to get a sense of what buyers are looking for in today’s market. I have said before: “Buyers decide in the fi rst 45 seconds if a home is right for them.” This may seem unfair when we are talking about homes well in excess of 6,000 square feet, but it still holds true. In this article, I would like to address how to sell your home faster because this usually means a higher profi t. Homes that sit on the market too long go through many price drops.

No one wants to spend money remodeling their home and then move out. When I list a home, I go in and come up with ways to update without initiating a remodeling project. I look at it from the buyer’s perspective. Today, the hot button is Tuscan style homes. Spanish Style homes have always been number one and unfortunately there are few available. Buyers complain that homes have the exterior architecture of Spanish or Italian and the interior is nothing more than a box with contemporary elements. How can we change this without a major remodel? This is where a good stage becomes crucial. Sofas should be in the right proportion with the rooms and not dominate the space. Add large accent pieces, not small ones. Colors should be neutralized even in the kid’s rooms no matter how charming they may be. You can also accent with splashes of color that direct the eye and the person to follow to the better features of your home. Your home is your investment. When marketing your home, it is important to take the ego out of the design and appeal to the most buyers.

Since we are talking about 45 seconds here, the curb appeal and the entrance to your home are vital. Keep your landscape clean and fresh looking around the entrance. I like to create large impressive pieces in the entrance using fl oral arrangements, vases, art or tapestries depending on the style I am trying to achieve. If a home’s interior lacks interest, staging can create more drama. Furniture should not run horizontally in a manner that blocks the fl ow to the window in a living room. The eye should have a clear path outside where some color should mimic an interior accent creating the illusion of more space.

Simple updating can be achieved by replacing gold and brass with the bronze tones that are popular today. Increase lighting with fi xtures or consider a skylight in an area such as a dark hall or a bathroom. Skylights that open are terrifi c visual ceiling extenders in the bathrooms. If you don’t have a loggia, you can create an outdoor room using different elements. Today’s buyer wants outdoor living spaces. In addition to outdoor spaces and architectural style, buyers are also looking for hardwood fl ooring and deeper wood colors.

Please give me a call if you are thinking about selling your home or purchasing another. I will do my best to make sure the experience is a great one.

www.LindeProperties.com

Your Home At Its Best!Shelley Linde - A Realtor ® with an

Interior Design background to help you

prepare the stage and market your home.

8.9.12 rancho santa fe review

Documents