1

1

2

Membrane topology and identification of critical amino acid residues in the Wzx O-antigen 3

translocase from Escherichia coli O157:H4 4

5

6

Cristina L. Marolda,1 Bo Li,

1 Michael Lung,

1 Mei Yang

1, Anna Hanuszkiewicz

1, Amanda Roa 7

Rosales1, and Miguel A. Valvano

1,2* 8

9

Center for Human Immunology, Siebens-Drake Research Institute, Departments of Microbiology 10

and Immunology1, and Medicine

2, The University of Western Ontario, London, Ontario, Canada, 11

N6A 5C1 12

13

14

* Corresponding author. Mailing address: Miguel A. Valvano; Department of Microbiology and 15

Immunology, Dental Sciences Building 3014, University of Western Ontario, London, ON, N6A 16

5C1, Canada; Tel: (519) 661-3427; Fax: (519) 661-3499; Email: mvalvano@uwo.ca 17

18

RUNNING TITLE: Functional residues and topology of Wzx 19

20

SECTION: Enzymes and Proteins 21

22

Copyright © 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Bacteriol. doi:10.1128/JB.00141-10 JB Accepts, published online ahead of print on 24 September 2010

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

2

Abstract 22

Wzx belongs to a family of membrane proteins involved in the translocation of isoprenoid lipid-23

linked glycans, which is loosely related to members of the major facilitator superfamily. Despite 24

Wzx homologs performing a conserved function, it has been difficult to pinpoint specific motifs 25

of functional significance in their amino acid sequences. Here, we elucidate the topology of the 26

Escherichia coli O157 Wzx (WzxEcO157) by a combination of bioinformatics, substituted cysteine 27

scanning mutagenesis, as well as targeted deletion-fusions to green fluorescent protein and 28

alkaline phosphatase. We conclude that WzxEcO157 consists of 12 transmembrane (TM) helices, 29

six periplasmic, and five cytosolic loops, with N- and C- termini facing the cytoplasm. Four TM 30

helices (TMs II, IV, X, and XI) contain polar residues (aspartic acid or lysine), and they may 31

form part of a relatively hydrophilic core. Thirty-five amino acid replacements to alanine or 32

serine were targeted to five native cysteines, and most of the aspartic acid, arginine, and lysine 33

residues. From these, only replacements of aspartic acid-85, aspartic acid-326, arginine-298, and 34

lysine-419 resulted in a protein unable to support O antigen production. Aspartic acid-85 and 35

lysine-419 are located in TM helices II and XI, while arginine-298 and aspartic acid-326 are in 36

periplasmic and cytosolic loop four, respectively. Further analysis revealed the charge at these 37

positions is required for Wzx function since conservative substitutions maintaining the same 38

charge polarity resulted in a functional protein, while those reversing or eliminating polarity 39

abolished function. We propose that the functional requirement of charged residues at both sides 40

of the membrane and in two TM helices could be important to allow the passage of the Und-PP-41

linked saccharide substrate across the membrane. 42

43

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

3

INTRODUCTION 43

The lipopolysaccharide (LPS), a major component of the outer membrane of Gram-negative 44

bacteria, plays critical roles in bacterial cell physiology (36) and in disease (53). The structure of 45

LPS is complex and consists at a minimum of lipid A and core oligosaccharide (OS) (42). Many 46

Gram-negative bacteria also have an O-specific antigen polysaccharide (or O antigen) attached to 47

one of the terminal residues of the core OS (42). The O antigen is the most variable portion of 48

the LPS molecule and arises from the polymerization of discrete oligosaccharide units (42, 54). 49

The biosynthesis of LPS requires many enzymes and assembly proteins, and generally 50

involves two separate pathways. One pathway results in the synthesis of the lipid A-core OS 51

(42), which is translocated across the inner membrane by the lipid A flippase MsbA, an ABC 52

transporter (14, 15, 60). The other pathway involves the synthesis and assembly of the O antigen 53

polysaccharide, which also begins at the cytosolic side of the inner membrane resulting in the 54

formation of a lipid-linked molecule that is further translocated across the inner membrane. The 55

formation of a complete LPS molecule containing O antigen is catalyzed by the O antigen ligase 56

WaaL (41). LPS molecules are further translocated to the outer leaflet of the outer membrane by 57

the Lpt transport system involving a number of inner membrane, periplasmic, and outer 58

membrane proteins (44, 45, 48, 49). 59

There are at least three known mechanisms for the assembly and translocation of lipid-linked 60

O antigens (42, 54). One of them involves a synthase protein that is homologous to processive 61

glycosyltransferases involved in the synthesis of cellulose and chitin (24, 42). The other 62

mechanism requires ATP hydrolysis for the translocation step, which is mediated by a two-63

component ABC transporter. This mechanism was initially described for homopolymeric O 64

antigens (42), but also occurs with heteropolymeric O antigens (38). The third mechanism, 65

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

4

known as the Wzy-dependent pathway (42, 54), requires three proteins: Wzx (O antigen 66

translocase), Wzy (O antigen polymerase) and Wzz (regulator of O antigen chain length 67

distribution). This mechanism, used primarily for the synthesis of heteropolymeric O antigens, 68

differs from the other two in that each O unit is separately synthesized and individually 69

translocated across the inner membrane, while the polymerization takes place at the periplasmic 70

side of the membrane (42, 54). The O antigen precursors are always synthesized as 71

oligosaccharides covalently attached by a phosphoanhydride linkage to an isoprenoid lipid 72

known as undecaprenyl phosphate (Und-P). The formation of the phosphoanhydride linkage is 73

the first committed step towards the synthesis of O antigens and is catalyzed by two classes of 74

membrane enzymes whose prototypes are WecA and WbaP (3, 26, 39, 46, 54). Remarkably, the 75

involvement of an isoprenoid phosphate lipid for these reactions is a common theme in nature, 76

and also appears in the synthesis of glycan precursors for cell wall peptidoglycan, and protein 77

glycosylation in bacteria and eukaryotic cells (9, 10). Furthermore, the Wzy-dependent pathway 78

is functionally analogous to the initial steps of dolichol-PP-linked glycans at the endoplasmic 79

reticulum, which are involved in protein N-glycosylation (21, 54). Indeed, a membrane protein 80

with roughly similar features as Wzx has been identified in eukaryotic cells as the dolichol-PP-81

linked glycan flippase and named Rft1 (22). 82

Our laboratory focuses on the characterization of the Wzy-dependent pathway, and we have 83

previously shown that a single Und-PP-sugar is the minimal substrate for translocation (19, 33). 84

Consistent with this notion, Wzx proteins appear to recognize the Und-PP-bound sugar of the O 85

antigen unit, irrespective of the composition and structure of the remainder O unit (19, 33). 86

Based on these observations, Wzx proteins can be loosely separated among those that can 87

function with Und-PP-linked N-acetylhexosamines vs. those that can function with Und-PP-88

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

5

linked N-hexoses (33). However, comparisons among Wzx primary amino acid sequences do not 89

provide any hints on putative functional residues conserved across the members of this family. It 90

is generally accepted that the translocation process mediated by members of Wzx and Rft1 91

families does not involve ATP hydrolysis (21, 54), which agrees with the absence of features in 92

the protein that are characteristic of ATP binding or hydrolysis domains. Another complication 93

to investigate functionally the members of these families is the lack of solid topological models 94

that accurately predict transmembrane helices and solvent-exposed loops. Currently, 95

experimentally based topological models have only been established for the Salmonella enterica 96

serovar Typhimurium Group B Wzx protein (12), and the Wzx-like protein PssL from Rhizobium 97

leguminosarum (35), which is involved in exopolysaccharide capsule production. However, 98

these studies did not identify any regions or specific amino acids from the protein that could play 99

a functional role in the translocation process. In this work, we have experimentally characterized 100

the topology of the Wzx protein from E. coli O157 (WzxEcO157) and subjected this protein to 101

extensive mutagenesis by alanine and serine replacements targeting native cysteines and most of 102

the aspartic acid, arginine, and lysine residues. Complementation experiments measuring the 103

ability of each mutant protein to restore O antigen synthesis in a wzx deleted E. coli K-12 mutant 104

resulted in the identification of four charged residues that are required for function, two of which 105

occur in transmembrane helices. Additional replacement mutagenesis revealed that charge but 106

not the nature of the residue is important for Wzx function. 107

108

MATERIALS AND METHODS 109

Bacterial strains, plasmids and reagents. Strains and plasmids in this study are described 110

in Table 1, and oligonucleotide primers are listed in Table 2. Bacteria were cultured in Luria 111

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

6

broth (LB) supplemented with antibiotics at the following final concentrations: 100 µg/ml 112

ampicillin, 30 µg/ml chloramphenicol, 40 µg/ml kanamycin, and 80 µg/ml spectinomycin. 113

Chemicals and antibiotics were purchased from Sigma Aldrich and Roche Diagnostics. 114

Oligonucleotide primers were purchased from Invitrogen. Plasmids were introduced into 115

electrocompetent cells by electroporation (16). GFP fusions, PhoA fusions, plasmids, and single 116

replacement constructs were confirmed by sequencing analysis (York University Core Molecular 117

Biology Facility). 118

Construction of an E. coli araCIBAD mutant. The deletion of the araCIBAD 119

chromosomal genes in W3110 was performed as described by Datsenko and Wanner (13). We 120

generated primers composed of 40 to 45 nucleotides corresponding to regions adjacent to the 121

genes targeted for deletion of the ara genes. The primers also contained 20 additional 122

nucleotides that annealed to the template DNA from plasmid pKD4, which carries a kanamycin-123

resistance gene flanked by FRT (FLP recognition target) sites. A PCR reaction was carried out 124

using primers 3341 and 3342 (Table 2) and the DNA product was introduced by electroporation 125

into E. coli W3110(pKD46) competent cells grown in LB containing 0.5% (w/v) arabinose. 126

Ampicillin-sensitive (indicating loss of pKD46), kanamycin-resistant (presence of inserted 127

cassette) colonies were screened by PCR using primers annealing to regions outside of the 128

mutated genes (primers 3333 and 3335, Table 2). The antibiotic gene was excised by introducing 129

the plasmid pCP20 encoding the FLP recombinase. Plasmids pKD46 and pCP20 are both thermo 130

sensitive for replication and they were cured at 42 °C. 131

Construction of fusions to green fluorescent protein (GFP). Plasmid pCM256, encoding 132

WzxEcO157 fused to GFP was constructed by PCR amplification of a 1.3-kb fragment encoding 133

wzxEcO157 from plasmid pJV7 with primers 252 and 3370. The PCR product was digested with 134

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

7

EcoRI and StuI, while pBADGFP was digested with EcoRI and SmaI. The digested DNA 135

products were ligated (Rapid Ligation Kit, Roche Diagnostics) and the ligation mix introduced 136

by electroporation into DH5α competent cells. To construct the plasmids encoding the WzxGFP 137

deleted derivatives PCR products were amplified using pCM256 as DNA template and primers 138

containing StuI restriction sites (underlined). A combination of primer GFP and primers K244, 139

T288, Q301, T308, D320, K331, and G397 (Table 2) were used. The PCR products were 140

digested with StuI and self ligated. Plasmid pBL1 was constructed by PCR amplification of a 141

1.3-kb fragment encoding wzxEcO157 from plasmid pJV7, using primers 252 primer 2317. The 142

PCR product and the vector plasmid pBADHIS were digested with NheI and XhoI, ligated and 143

transformed into DH5α as described above. pBL1 was used as a template to replace all native 144

cysteine residues in WzxEcO157 (13, 102, 130, 434 and 449) with alanine giving rise to pBL2, 145

pBL3, pBL4, pML202 and pML203 (Table 1). The replacement of other residues in either pBL1 146

or pML203 was also performed by site directed-mutagenesis. 147

Construction of fusions to alkaline phosphatase (PhoA). The phoA gene was amplified 148

from E. coli JM109 genomic DNA using primers 4771 and 4770 (Table 2). The primers were 149

designed such that only the portion of the gene encoding the mature PhoA protein was amplified. 150

The PCR product and plasmid pBADNTF were both digested with PstI and HindIII, and after 151

ligation, the mixture was introduced into E. coli DH5α cells, resulting in the isolation of pAH18 152

(Table 1). A fragment of the wzxEcO157 gene in pJV7 encoding amino acids 1 to K367 was 153

amplified using primers 4769 and 4772. The PCR product and pAH18 were both digested with 154

NheI and PstI, and ligation was performed for 15 min at room temperature (Rapid Ligation Kit). 155

The ligation mixture was introduced by transformation into E. coli CC118 cells and the 156

transformants plated on LB/ampicillin agar with 60 µg/ml BCIP (5-chromo-4-chloro-3-indolyl 157

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

8

phosphate, XP). Plasmids from blue colonies were isolated and sequenced with primers 252 and 158

4817 (Table 2) to verify the correct insertion of wzxEcO157-1-K367 into pAH18. The 4772 primer 159

incorporated a PstI site to facilitate the cloning, which resulted in the addition of two amino acids 160

between the K367 and the PhoA protein. One of these plasmids, encoding WzxEcO157-K367-161

PhoA(PstI) was designated as pAH18-K367PhoA(PstI). This plasmid was used to produce further 162

PhoA-fusion constructs by inverse PCR amplifications using Pwo DNA polymerase (Roche 163

Diagnostics), the same forward primer 4768, and the various reverse primers 4764, 4766, 4767, 164

and 4816 (Table 2). In this case, the primers were designed to remove the PstI site and the extra 165

two amino acids used initially for constructing WzxEcO157-K367-PhoA(PstI). PCR products were 166

phosphorylated for 30 min with polynucleotide kinase (PNK, Roche Diagnostics) and self-167

ligated for 15 min at room temperature (Rapid Ligation Kit). The ligation mixtures were 168

introduced into E. coli CC118 cells and transformants screened for blue-colony phenotypes in 169

XP/ampicillin plates. DNA sequencing with primers 252 and 4817 confirmed the presence of in-170

frame fusions. 171

Alkaline phosphatase assay. To quantify alkaline phosphatase activity 1:100 diluted 172

overnight cultures were grown for 4 h at 37°C in LB with ampicillin and 0.02% (v/v) arabinose, 173

harvested, lysed, and assayed as described (29) with the addition of 1 mM iodoacetamide in all 174

buffers. E. coli CC118 cell lysates were used as negative control. 175

Microscopy. An overnight culture of CLM74 cells containing the plasmids encoding the 176

GFP-fusion proteins (Table 1), were diluted in LB to an OD600 of 0.15, and protein expression 177

was induced with 0.1% (w/v) arabinose when OD600 reached values between 0.6-0.7. After 3-h 178

induction, the culture was placed on ice for 60 min to facilitate GFP folding. Similar experiments 179

were also done without arabinose in the growth medium. Bacteria were visualized with no 180

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

9

fixation using an Axioscope 2 (Carl Zeiss) microscope with an X100/1.3 numerical aperture 181

Plan-Neofluor objective and a 50 W Mercury arc lamp with a GFP band pass emission filter set 182

(Chroma Technology) with a 470 ± 20 nm excitation range and a 525 ± 25 nm emission range. 183

Images were digitally processed using the Northern Eclipse version 7.0 imaging analysis 184

software (Empix Imaging, Mississauga, Ontario, Canada). 185

Labeling of cells and vesicles with sulfhydryl-reactive reagents. Overnight cultures of 186

DH5α cells containing the appropriate plasmids (Table 2) supplemented with 100 µg/ml 187

ampicillin, were diluted in LB medium (250 ml) to an OD600 of 0.2, when the OD600 reached 188

values between 0.6-0.7 protein expression was induced with 0.1% arabinose. After 3-h induction 189

bacteria were harvested at 3300 xg for 15 min, washed twice with 0.1 M sodium phosphate 190

buffer (pH 7.2) and resuspended in 8 ml of the same buffer. At this point the bacterial suspension 191

was divided into two 4 ml aliquots to proceed to the biotinylation steps (8). One aliquot was pre-192

treated with 0.5 mM [2-(Trimethylammonium)ethyl] methanethiosulfonate bromide (MTSET; 193

Toronto Research Chemicals Inc., Toronto, Ontario, Canada) for 10 min at room temperature. 194

Both aliquots were then treated with 0.5 mM Nα-(3-maleimidylpropionyl)biocytin (biotin 195

maleimide, BM; Invitrogen) for 60 min at room temperature, with constant rocking. The reaction 196

was terminated by addition of 350 µl of 2% (v/v) 2-mercaptoethanol in 0.1 M sodium phosphate 197

buffer (pH 7.2). Treated cultures were then washed twice with 20 ml phosphate buffer and 198

resuspended in a final volume of 3 ml of the same buffer containing protease inhibitors 199

(Complete Cocktail inhibitor, Roche Diagnostics). Cells were lysed in two passes at 15,000 psi 200

using a French press, lysates were centrifuged at 39,000 xg for 15 min and the supernatant 201

sedimented at 280,000 xg for 30 min. The pellet, containing total membranes, was resuspended 202

in 80 µl of 20 mM Tris-HCL buffer (pH 8) plus protease inhibitor and the membranes were 203

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

10

solubilized for 4 h with 0.5% Triton X-100 in 20 mM Tris-HCL buffer pH 8 and 8M urea (pH 8). 204

To label membrane vesicles, total membranes were resuspended in 2 ml of 0.1M sodium 205

phosphate buffer, pH 7.2, treated with 0.4 M dithiothreitol (DTT; Sigma Chemical Company) for 206

10 min and centrifuged at 280,000 xg for 30 min. The membrane pellets were resuspended in 207

500 µl of 0.1 M sodium phosphate buffer pH 7.2 and divided in two aliquots of 25 µl each. The 208

volume was brought up to 1 ml with the same buffer and one aliquot was pre-treated for 30 209

minutes at room temperature with 125 mM MTSET. Both aliquots were incubated with 0.5 mM 210

BM for 60 min as described for whole cells. The reaction was terminated by addition of 83 µl of 211

2% (v/v) 2-mercaptoethanol in 0.1 M sodium phosphate buffer (pH 7.2) and the membranes were 212

sedimented again. Membrane proteins were solubilized in 0.5% Triton X-100 as described 213

above. 214

Isolation of His-tagged protein. Solubilized samples were spun at 39,000 x g for 45 min 215

to remove insoluble material. The supernatant was mixed with 100 µl of Ni-bound Chelating 216

Sepharose Fast Flow resin (GE Healthcare), equilibrated with wash buffer (20 mM Tris-HCl, 217

300 mM NaCl, 100 mM imidazole, 8 M urea, pH 8) and the mix was incubated for 2 h at room 218

temperature with gentle mixing. The resin was spun down at 1000 xg for 2 min, the supernatant 219

aspirated and the protein-loaded column was washed three times with1 ml of wash buffer. 220

WzxEcO157 was eluted by incubating the resin with 70 µl of elution buffer (20 mM Tris-HCl, 300 221

mM NaCl, 300 mM imidazole, 8 M urea, 0.5% Triton X-100, pH 8) for 15 min. Elution fractions 222

were incubated for 30 min at 45°C, separated on a 14% sodium dodecyl sulfate (SDS)-223

polyacrylamide gel electrophoresis (PAGE), and transferred to nitrocellulose membranes that 224

were reacted with anti-FLAG monoclonal antibodies (Sigma). Biotinylated proteins were 225

detected by incubation with IRDye800-Streptavidin (Rockland, Pennsylvania). 226

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

11

LPS analysis. LPS was prepared as previously described (31) from cells grown on LB plates 227

with 0.1% (w/v) arabinose and the samples were separated on 14 % (w/v) Tricine SDS-PAGE. 228

Gels were stained with silver nitrate as described previously (31, 34). Densitometry of silver 229

stained gels was performed using the program ImageJ (1). Three regions of the gel were 230

considered for the quantitative analysis: the bands in the polymeric O antigen region, the band of 231

lipid A-core OS plus one O antigen unit, and the lipid A-core OS band. The relative amount of O 232

antigen expression was determined by adding the pixels corresponding to the polymeric O 233

antigen region of the gel (previously subtracted from background pixels) + the pixels 234

corresponding to the lipid A-core OS plus one O antigen unit, divided by the pixels of the lipid 235

A-core OS band. The results were expressed as percent values relative to the positive control 236

(100 %). 237

Protein analysis. Total membranes were prepared from cells grown using the same 238

conditions indicated above for preparation of LPS samples. Bacterial cells were suspended in 20 239

mM Na2PO4 pH 7.2 plus protease inhibitors (Complete Tablets, Roche Diagnostics) and they 240

were lysed by sonic disruption for two 15-s pulses (Branson). Total membrane fractions were 241

obtained by centrifugation of the lysates for 40 min at 40,000 g and the pellet resuspended in the 242

same buffer. Protein concentration was measured by the Bradford assay (Bio Rad Protein 243

Assay). 20-40 µg of total membrane proteins were incubated for 30 min at 45°C, separated on a 244

14% SDS-PAGE, and transferred to nitrocellulose membranes that were reacted with one of the 245

following: anti-FLAG polyclonal rabbit antibodies (Rockland, Pennsylvania), anti-FLAG 246

monoclonal antibodies (Sigma) and anti-GFP monoclonal antibodies (Roche Diagnostics). The 247

reacting bands were detected by fluorescence with an Odyssey infrared imaging system (Li-cor 248

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

12

Biosciences) using IRDye800CW affinity purified anti-rabbit IgG antibodies (Rockland, 249

Pennsylvania) and Alexa Flour® 680 anti-mouse IgG antibodies (Invitrogen). 250

251

252

RESULTS 253

Topological analysis of WzxEcO157 by the substituted cysteine accessibility method. We 254

attempted to establish a working topological model for WzxEcO157 using commonly employed 255

algorithms that predict the number and location of transmembrane helices and the orientation of 256

the intervening loops (17, 37). The programs HMMTOP (52), MEMSAT (23), TMHMM (50), 257

and Octopus (55) predicted twelve TM helices with six periplasmic and five cytoplasmic loops, 258

while TOPPRED (11) predicted only 10 TM helices, five periplasmic and four cytoplasmic loops 259

(Fig. 1). All the programs predicted that the N-terminus and C-terminus of the protein were 260

located in the cytoplasm. However, even with the programs predicting the same number of TM 261

helices each of the models obtained differed in the length and orientation of periplasmic and 262

cytoplasmic loops, particularly in the region between amino acids 260 and 425 (Fig. 1, square). 263

Given the difficulties in producing a reliable topological model for WzxEcO157 by computer 264

predictions, we resorted to the substituted cysteine accessibility method (SCAM; 8). The native 265

WzxEcO157 protein contains five cysteines at positions 13, 102, 130, 434 and 449, which were all 266

replaced by alanine in a sequential manner, resulting in WzxEcO157 forms with one or more 267

cysteine replacements. These proteins were engineered to contain an N-terminally fused FLAG 268

epitope for detection by western blot and a C-terminal 7xHis to facilitate their isolation by Ni2+

-269

affinity chromatography after labeling with biotin maleimide (see below). To determine whether 270

these proteins support O antigen expression we prepared LPS samples from CLM17(pMF19) 271

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

13

bacteria containing the appropriate plasmid constructs. We have demonstrated earlier that the 272

WzxEcO157 protein can restore O16 antigen synthesis in the ∆wzxEcO16 mutant with the same 273

efficiency as WzxEcO16 (33). The pMF19 plasmid contains the wbbL gene encoding a 274

rhamnosyltransferase that allows for the completion of O16 LPS synthesis in the E. coli K-12 275

W3110 strain and its derivatives (19, 28, 33). The WzxEcO157 mutant proteins lacking one or 276

more native cysteines (Fig. 2A, lanes 3-7) supported O antigen production with the same banding 277

pattern characteristics as the one mediated by the parental WzxEcO157-FLAG-7xHis protein (Fig. 2A, 278

lane 2). Cells expressing mutant proteins containing quadruple or quintuple cysteine 279

replacements also exhibited a small reduction in the amount of polymeric O antigen (Fig. 2A, 280

lanes 6-7). This reduction could be due instability of the mutated protein in the membrane. 281

However, all the proteins were found at roughly the same level in the membrane fractions (Fig. 282

2B, lanes 2-7) and our method to prepare membrane fractions affords a mixture of outer and 283

inner membrane proteins with negligible contamination of cytoplasmic proteins (4-6, 26, 32, 33, 284

56). Therefore, the experimental results demonstrate that replacing all the native cysteines in 285

WzxEcO157-FLAG-7xHis does not significantly affect protein expression, membrane localization, and 286

O antigen production. 287

We used the WzxEcO157-Cysless protein to introduce novel cysteine replacements at various 288

positions for topological analysis (Table 2 and Fig. 3). All replacements resulted in proteins that 289

were detectable by western blot with anti-FLAG antibodies, confirming that the cysteine 290

replacement are well tolerated and do not affect protein stability or targeting to the plasma 291

membrane (data not shown). The accessibility of the novel cysteines to the sulfhydryl reactive 292

reagent biotin maleimide was determined by incubating whole cells with the label, followed by 293

treatment with excess β-mercaptoethanol before bacterial cell lysis. This treatment prevents the 294

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

14

labeling of any cysteine that could become exposed to biotin maleimide during cell fractionation. 295

Biotin maleimide is membrane permeable and reacts with thiol groups that are next to water 296

molecules since the reaction with an ionized thiol group requires a water molecule as a proton 297

acceptor (8). Therefore, cysteines buried in the core of the hydrophobic transmembrane segments 298

are usually not labeled (8). Cysteine-substituted K144, K367, R298, H209, and D277 were 299

accessible to biotin maleimide (Fig. 4A, lanes 3, 7, 9, 11, and 13), suggesting these residues are 300

exposed to the labeling reagent (Fig. 2 and Table 2). In contrast, the parental WzxEcO157-Cysless and 301

the cysteine-substituted forms at P313, F293, and P306 positions were not labeled (Fig. 4A, lanes 302

1, 5, 15 and 17), indicating that these residues are not exposed to biotin and suggesting they are 303

in close proximity to the inner membrane or buried within the membrane bilayer. Similarly, 304

cysteine substitutions at positions K244, D320, R324 and K331 were not labeled in whole cells 305

(Table 2 and data not shown). 306

To determine whether the labeled amino acids were located at the periplasmic face of the 307

inner membrane we used MTSET, a charged thiol-specific probe that reacts with sulfhydryl 308

groups under similar conditions as biotin maleimide, but is impermeable to the cytoplasmic 309

membrane due to its positive charge (8). Incubation of whole bacterial cells with MTSET prior to 310

treatment with biotin maleimide prevents labeling of periplasmic cysteines (26). Accordingly, 311

pretreatment with MTSET prevented the labeling with biotin maleimide of cysteine-substituted 312

K144, K367, R298, His209, and D277 residues (Fig. 4A lanes 4, 8, 10, 12 and 14), suggesting 313

that these residues are exposed to the periplasmic face of the inner membrane. These results 314

agree with the control experiment using WecAS362C (not protected by MTSET) and WecAG181S 315

(protected by MTSET), which contain cysteine replacements in cytosolic and periplasmic 316

residues, respectively (26)(data not shown). 317

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

15

Despite that biotin maleimide is supposed to be membrane permeable we could not confirm 318

by labeling in whole cells the location of cysteine-substituted residues at positions K244, D320, 319

R324, and K331, which were all expected to be in the cytosolic loops 3 and 4 (Fig. 3). To resolve 320

the location of these residues we performed the labeling experiment on isolated membrane 321

vesicles. This strategy permitted us to biotinylate all periplasmic and cytoplasmic exposed 322

residues. Cysteine-substituted proteins at D320, K331, K367 and R324 positions were labeled 323

with biotin but labeling was prevented by MTSET (Fig. 4B, lanes 3-10), indicating that these 324

residues are surface exposed. From these, the cysteine-substituted K367 residue was the only one 325

that could be labeled in whole cells and also in membrane vesicle preparations, and in both cases 326

labeling was prevented by pretreatment with MTSET (Fig. 4A and B, lanes 7-8). Therefore, this 327

residue is unequivocally located in the predicted periplasmic loop 5 (Fig. 3). Because cysteine 328

replacements at D320, K331, and R324 could not be labeled with biotin maleimide upon 329

treatment of whole cells (Table 2 and data not shown), but were detectable in membrane vesicles 330

(Fig. 4B, lanes 3-6, 9-10), we concluded that these residues are exposed to the cytoplasmic face 331

of the inner membrane. Vesicles prepared from cells expressing the Cys substitution at Phe264 332

did not react with biotin maleimide (Fig. 4B, lanes 1 and 2) nor did vesicles containing Wzx 333

proteins with replacements at P254, G286, F293, P306, and P313 (data not shown). From these, 334

cysteines at positions P254, P306, and P313 were also not labeled in whole cells (Table 2), 335

suggesting that they are buried in the membrane. G286 and F293 span an 18-amino acid (from 336

F279 to T296) region containing hydrophobic residues flanked by D277 and R298, which were 337

both mapped to the periplasmic space (Fig. 3) as they strongly react with biotin maleimide and 338

labeling is prevented by MTSET in whole cells (Fig. 4A, lanes 9-10, 13-14). Therefore, it is 339

unlikely that this region can form a transmembrane helix but it could still have a secondary 340

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

16

structure such that would prevent access to biotin maleimide for labeling, as we have previously 341

shown for an analogous short hydrophobic region within the large cytoplasmic loop 5 of WecA 342

(26). Together, the SCAM results allowed us to construct an experimentally supported 343

topological model of WzxEcO157 (Fig. 3). 344

Additional topological analysis by targeted fusions to green fluorescent protein and 345

alkaline phosphatase. To get additional evidence for the topological assignments from the 346

SCAM, we constructed a WzxEcO157 derivative C-terminally fused to GFP (encoded by pCM256, 347

Table 1), a reporter that can only fluoresce if present in the cytosol (18). As before, the 348

WzxEcO157 protein expressed from pCM256 also contains an N-terminal FLAG epitope. The 349

WzxEcO157-GFP fusion protein afforded an ~80-kDa polypeptide band in western blots of total 350

membrane preparations reacted with anti-GFP and anti-FLAG antiserum, indicating that Wzx is 351

correctly fused to the GFP protein and that is also in the membrane fraction (Fig. 5A, lanes 4 and 352

6; black arrowheads). In contrast, the membrane fraction from E. coli cells expressing the 353

parental WzxEcO157-FLAG-7xHis shows a ~ 53-kDa band that is only detectable with anti-FLAG 354

antibodies (Fig. 5A, lane 5, white asterisk), in agreement with the predicted mass of this protein. 355

As a control, we detected a 27-kDa band corresponding to soluble GFP in the cell lysate from 356

DH5/pBADGFP (Fig. 5A, lane 1, asterisk). Additional bands of large molecular mass reacting 357

with either anti-GFP or anti-FLAG antibodies are also detected (Fig. 5A, lanes 1, 4-6). These 358

were likely oligomeric forms of Wzx (lanes 4-6) and GFP (lane 1) due to the incomplete 359

denaturing conditions used to prepare the samples. Complete denaturation including treatment of 360

the samples by heating at 100 °C in SDS prevents the detection of membrane proteins in SDS-361

PAGE, as we have previously observed with various membrane proteins containing multiple 362

transmembrane helices (26, 41, 51, 56), including several other Wzx proteins (33). 363

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

17

Using the wzxEcO157-gfp gene encoded in pCM256 as a starting point, various deletions were 364

constructed that resulted in C-terminally truncated forms of WzxEcO157 remaining C-terminally 365

fused to GFP. The deletion-fusion endpoints chosen corresponded to amino acids K244, T288, 366

Q301, T308, D320, K331, and G397 of the native WzxEcO157 protein (Table 1). These endpoints 367

were chosen to help resolve the topology of the most difficult part of WzxEcO157, where most of 368

the prediction programs differed (Fig. 1, square). The expected fusion was produced by all 369

plasmid constructs, as suggested by the detection with anti-GFP antibodies of polypeptide bands 370

of decreasing molecular mass, ranging from 80 kDa for the parental WzxEcO157-GFP (Fig. 5B, lane 371

1) to 55.3 kDa for WzxEcO157-K244GFP (Fig. 5B, lane 8). 372

The plasmids encoding parental and deleted versions of WzxEcO157-GFP fusions were 373

introduced into the E. coli cells CLM74 by electroporation. CLM74 has a deletion of the 374

araCIBAD chromosomal genes (Table 1), which reduces toxic effects of arabinose and its 375

metabolites on E. coli K-12 strains (43). We have observed that arabinose toxicity affects cell 376

growth and leads to altered cell morphologies upon membrane protein expression driven by 377

cloned genes under the control of arabinose-inducible promoters (data not shown). Bacterial cells 378

expressing parental WzxEcO157-GFP displayed fluorescence around the cell periphery detectable 379

after 0.85-s exposure to UV light (Fig.1D), confirming the prediction that Wzx is in the 380

membrane with the C-terminus facing the cytosol (Fig. 3). Cells expressing WzxEcO157-K244-381

GFP, WzxEcO157-K331-GFP, and WzxEcO157-G397-GFP (Fig. 5C) also displayed fluorescence 382

around the periphery but with less intensity (samples exposed for 3 s to be able to detect a 383

fluorescent signal), suggesting that residues K244, K331, and G397 are exposed to the cytosol. 384

The cytosolic location of K244, D320, and K331 agreed with the SCAM data (Figs. 3 and 4). 385

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

18

Also, these results support the assignment of R324 at the cytoplasmic side of the membrane 386

given its proximity to D320 and K331 (Fig. 3). 387

In CLM74 cells expressing WzxEcO157-D320-GFP, WzxEcO157-Q301-GFP, and WzxEcO157-388

T308-GFP the fluorescence was very faint, requiring 4-s exposures, and also present within the 389

cell bodies, while cells expressing and WzxEcO157-T288-GFP did not fluoresce even after longer 390

exposure (Fig. 5D and data not shown). We interpreted these results as an indication that 391

residues D320, Q301, T308, and T288 are not exposed to the cytosol. To verify this, we 392

performed similar deletion fusion experiments using the alkaline phosphatase PhoA as a reporter 393

for periplasmic localization. This protein can only fold properly, and therefore becomes 394

enzymatically active, if exported to the periplasmic space (30). Although we originally intended 395

to obtain protein fusions at identical endpoints as those for GFP fusions, this was only achievable 396

in some cases, while in others only small in-frame deletions were recovered that resulted in 397

fusions to nearby residues. Also, despite numerous attempts we could not obtain a WzxEcO157-398

PhoA C-terminal fusion, concluding this fusion is probably toxic to E. coli cells (data not 399

shown). E. coli CC118 cells (Table 1) containing plasmids encoding WzxEcO157-PhoA fusions 400

with deletion-fusion endpoints at amino acids W139, T288, V360, and K367 gave a strong blue-401

colony phenotype in XP plates (data not shown). In agreement to these results, cell-free lysates 402

of CC118 bacteria expressing PhoA fusions at W139, T288, V360, and K367 gave 10,754 ± 390, 403

1372 ± 75, 3288 ± 237, and 3134 ± 170 units of alkaline phosphatase activity, respectively, 404

suggesting these residues are exposed to the periplasmic space. This agrees with data obtained 405

from the SCAM method for residues at the fusion endpoint (K367) or nearby residues to those 406

experimentally determined as exposed to the periplasm (W139 near K144, and V360 near K367 407

(Fig. 3), and also with the absence of GFP-mediated fluorescence in the case of T288-GFP 408

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

19

fusion. In contrast, expression of the WzxEcO157-F242-PhoA fusion only afforded white colonies 409

and cell-free lysates had no enzymatic activity. F242 is near K244, which based on GFP fusion 410

data and SCAM can unequivocally be placed in cytoplasmic loop 3 (Fig. 3). Thus, the 411

combination of fusion experiments with GFP and PhoA reporters, and the SCAM methods 412

confirmed the topological assignment of WzxEcO157 (Fig. 3) as a membrane protein with 12 TM 413

helices, 6 periplasmic and 5 cytoplasmic loops, and the C-terminus in the cytosol (Fig. 3). 414

Identification of functional residues in WzxEcO157. We investigated whether any of the 415

cysteine-substituted WzxEcO157 mutants was unable to support O antigen surface expression in 416

vivo using CLM17(pMF19). Bacteria containing WzxEcO157 proteins with cysteine replacements 417

at K244, K331, K367, and K402 showed moderate reduction in surface O antigen production, 418

ranging from 60 to 90% as compared to cells expressing the parental cysteine-less WzxEcO157 419

(Table 3 and data not shown). Substitutions P313C, D320C and K176C resulted in proteins 420

greatly compromised in their ability to support O antigen production, as demonstrated by a 421

reduction in surface O antigen ranging from 30 to 50% relative to levels in the parental strain 422

(Table 3). In the case of the WzxEcO157 mutant R298C there was no O antigen production (Table 423

3). The differences in O antigen production observed in these mutant proteins were not due to 424

lack of protein expression as confirmed by western blot with anti-FLAG antibodies (data not 425

shown). That the mutant proteins were detected in total membrane fractions suggests that they 426

are sufficiently similar to the parental derivative to least be inserted in the membrane, although 427

we cannot rule out localized changes in secondary structure. Because the cysteineless form of 428

WzxEcO157 mediated a somewhat reduced production of O antigen when compared to the parental 429

protein with its native cysteines (Fig. 2A, compare lanes 2 and 7), and the replacement of a 430

native amino acid by a cysteine at certain positions could lead to local structural changes due to 431

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

20

differences in hydrophobicity and the oxidation state of the SH- side chain, we reconstructed the 432

cysteine substitutions that caused a functional defect in WzxEcO15 as alanine or serine 433

replacements in the parental protein. Alanine and serine are usually much better tolerated since 434

because of their small mass they generally cause only minor conformational changes in the 435

protein structure (7). Also, serine favors the formation of loops (25), and therefore would not be 436

expected to alter the extracellular loops of WzxEcO157. Using this approach, we confirmed that 437

only WzxEcO157-D326A and WzxEcO157-R298A were functionally impaired in mediating O antigen 438

production showing 60% and no O antigen, respectively (Fig. 6A, lanes 9 and 15), while the rest 439

of the replacements did not compromise WzxEcO157 functionality. 440

Charged residues are rarely found in the interior of transmembrane helices (57). Therefore, 441

we also investigated the functional contribution of the charged residues D85, K159, D385, and 442

K419 in transmembrane helices 2, 4, 10 and 11, respectively. We also investigated the functional 443

role of Q223 and Q267 in transmembrane helices 6 and 7, since residues at analogous positions 444

are important for the function of the LacY permease (2), a prototypic member of the major 445

facilitator superfamily. As shown in Fig. 6B, lanes 3 and 8, only D85 and K419 are required for 446

WzxEcO157 function since the mutant proteins WzxEcO157-D85A and WzxEcO157-K419S were unable to 447

mediate O-antigen production. The lack of function was not due to loss of protein expression 448

since all mutant proteins were produced at similar levels by western blot (data not shown). From 449

these experiments, we concluded that residues D85, R298, D326, and K419 are required for the 450

normal function of WzxEcO157. 451

To gain more information on the role of these residues we constructed additional replacement 452

mutants geared to cause charge modifications. Thus, D85 and D326 were also replaced with 453

glutamic acid and arginine, R298 was replaced with aspartic acid and lysine, and K419 was 454

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

21

replaced with arginine and aspartic acid. The plasmids expressing the replaced proteins were 455

examined for their ability to support O antigen production in CLM17(pMF21) bacteria. Only 456

substitutions preserving the net charge at each residue were functional (Fig. 7), while 457

substitutions causing a charge reversal were not functional as with the control replacements to 458

alanine or cysteine. From these experiments, we conclude that the net charge of these residues is 459

key for WzxEcO157 activity. 460

461

DISCUSSION 462

A combination of deletion-fusions to the GFP and PhoA proteins as topology probes and 463

biotin-maleimide labeling of cysteine replacement mutants allowed us to construct an 464

experimentally validated topological model for WzxEcO157 that contains 12 TM helices, 6 465

periplasmic and 5 cytoplasmic loops. A cysteineless version of WzxEcO157 that remained 466

functional and localized to the membrane indicated that the native cysteines are dispensable for 467

Wzx function. Some interesting observations can be drawn from the topology of WzxEcO157. 468

First, four TM helices (TMs II, IV, X, and XI) contain polar residues (aspartic acid or lysine), 469

which are atypical residues for a TM location. Second, some of the periplasmic loops contain 470

stretches of hydrophobic residues flanked by polar residues (D277-R298 in periplasmic loop 471

four, and E358-K367 in periplasmic loop five). De novo modeling of the D277-R298 segment 472

predicts that the intervening amino acids form two β-strands in parallel orientation (data not 473

shown). This arrangement could be important for interactions with the Und-PP-O unit substrate. 474

R298, which is required for a functional WzxEcO157, could be involved in interactions with the 475

phosphates of the Und-PP. Similarly, we have recently shown that positively charged 476

periplasmic residues in the O antigen ligase WaaL are prime candidates to interact with the 477

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

22

phosphate residues of Und-PP-linked saccharides (41). Whether this is also true for WzxEcO157 478

will require additional experiments to test specific interactions of this protein with Und-PP-479

linked O antigen precursors. 480

With the programs we used, the periplasmic loops containing hydrophobic residues 481

correspond to the part of the protein that are most difficult to predict topologically in a consistent 482

manner. Similar features appear in the topological models of Wzx proteins from S. enterica 483

(WzxSe) (12) and R. leguminosarum (PssL) (35). In both proteins there are also four 484

transmembrane domains, each containing lysine or arginine residues, and two periplasmic loops 485

with short stretches of hydrophobic amino acids. The only major difference between these 486

proteins and WzxEcO157 is that R. leguminosarum PssL has a larger cytosolic loop between TM 487

helices 6 and 7, which is absent in the E. coli O157 and S. enterica homologs. Paulsen et al (40) 488

have classified proteins involved in lipid-linked saccharide transport into one family with two 489

subclasses based on the presence of the large predicted cytosolic loop. However, it remains 490

unclear if this has any functional significance and unfortunately, it has not been possible to 491

obtain mutants of pssL in R. leguminosarum (35). 492

As an attempt to identify functional amino acids we utilized alanine and/or serine 493

replacement mutagenesis taking advantage of the topological model. We were particularly 494

interested in targeting the charged residues in TM helices and also residues in periplasmic and 495

cytosolic loops. Each mutant protein was examined for expression and localization to the inner 496

membrane. We have found with other membrane proteins, like WecA and WaaL that mutations 497

affecting protein insertion in the membrane result in no detectable protein. By these criteria, we 498

assumed that all the replacement mutants behave identically to the parental WzxEcO15, although 499

small local changes cannot be identified. Only D85, R298, D326, and K419 yielded non-500

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

23

functional proteins when replaced by alanine. Furthermore, conservative replacements at these 501

positions demonstrated that the charge, but not the nature of the targeted amino acid, is critical to 502

retain the ability of WzxEcO157 to support O antigen production. These results suggest that 503

residues at these positions could be involved in making contacts with substrates directly or via 504

water molecules. 505

From our current data, we propose that Wzx proteins have similar features to transporters of 506

the major facilitator superfamily. This is based on the following: (i) the presence of at least four 507

TM helices with charged amino acids, suggesting the possibility of tertiary structure such that a 508

core of TM helices interact with each other and locate further way from the lipid bilayer, in a 509

similar arrangement as that found for LacY (47); and (ii) the functional requirement of charged 510

residues at both sides of the membrane and in two TM helices, which could be important to 511

create an electrostatic cavity (2, 47) and perhaps even electrostatic interactions with the 512

phosphate groups of Und-PP-linked sugars, which may allow localized perturbation of the lipid 513

bilayer to facilitate the movement of the Und-PP-linked saccharide substrate across the 514

membrane. These possibilities are supported by previous results of in vitro studies of interactions 515

between hydrophobic peptides with lipid vesicles containing isoprenoid phosphates, and 516

molecular modeling of isoprenoid phosphates in artificial membranes (58, 59). Further 517

experiments involving additional mutagenesis, neighborhood analysis of TM helices, and Und-518

PP-saccharide substrate binding assays are required to unequivocally identify functional regions 519

of WzxEcO157 based on an experimentally established topological model and begin elucidating the 520

mechanism of translocation. 521

522

523

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

24

ACKNOWLEDGMENTS 524

The authors thank the colleagues referenced or mentioned in Table 1 for strains and plasmids. This 525

work was supported by grants from the Canadian Institutes of Health Research and the Mizutani 526

Foundation for Glycoscience. Summer Research Awards from the Natural Sciences and 527

Engineering Research Council of Canada supported B.L. and M.L.. M.A.V. holds a Canada 528

Research Chair in Infectious Diseases and Microbial Pathogenesis. 529

530

REFERENCES 531

532

1. Abramoff, M. D., P. J. Magelhaes, and S. J. Ram. 2004. Image processing with 533

ImageJ. Biophotonics Int. 11:36-42. 534

2. Abramson, J., I. Smirnova, V. Kasho, G. Verner, H. R. Kaback, and S. Iwata. 2003. 535

Structure and mechanism of the lactose permease of Escherichia coli. Science 301:610-536

615. 537

3. Alexander, D. C., and M. A. Valvano. 1994. Role of the rfe gene in the biosynthesis of 538

the Escherichia coli O7-specific lipopolysaccharide and other O-specific polysaccharides 539

containing N-acetylglucosamine. J. Bacteriol. 176:7079-7084. 540

4. Amer, A. O., and M. A. Valvano. 2001. Conserved amino acid residues found in a 541

predicted cytosolic domain of WecA (UDP-N-acetyl glucosamine:undecaprenol-542

phosphate N-acetylglucosamine-1-phosphate transferase) are implicated in the 543

recognition of UDP-N-acetylglucosamine. Microbiology 147:3015-3025. 544

5. Amer, A. O., and M. A. Valvano. 2002. Conserved aspartic acids are essential for the 545

enzymic activity of the WecA protein initiating the biosynthesis of O-specific 546

lipopolysaccharide and enterobacterial common antigen in Escherichia coli. 547

Microbiology 148:571-582. 548

6. Amer, A. O., and M. A. Valvano. 2000. The N-terminal region of the Escherichia coli 549

WecA (Rfe) protein containing three predicted transmembrane helices is required for 550

function but not for membrane insertion. J. Bacteriol. 182:498-503. 551

7. Baase, W. A., A. E. Eriksson, X. J. Zhang, D. W. Heinz, U. Sauer, M. Blaber, E. P. 552

Baldwin, J. A. Wozniak, and B. W. Matthews. 1992. Dissection of protein structure 553

and folding by directed mutagenesis. Faraday Discuss:173-181. 554

8. Bogdanov, M., W. Zhang, J. Xie, and W. Dowhan. 2005. Transmembrane protein 555

topology mapping by the substituted cysteine accessibility method (SCAMTM

): 556

application to lipid-specific membrane protein topogenesis. Methods 36:148-171. 557

9. Bugg, T. D., and P. E. Brandish. 1994. From peptidoglycan to glycoproteins: common 558

features of lipid-linked oligosaccharide biosynthesis. FEMS Microbiol. Lett. 119:255-559

262. 560

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

25

10. Burda, P., and M. Aebi. 1999. The dolichol pathway of N-linked glycosylation. 561

Biochim Biophys Acta 1426:239-257. 562

11. Claros, M. G., and G. von Heijne. 1994. TopPred II: an improved software for 563

membrane protein structure predictions. Comput. Appl. Biosci. 10:685-686. 564

12. Cunneen, M. M., and P. R. Reeves. 2008. Membrane topology of the Salmonella 565

enterica serovar Typhimurium Group B O-antigen translocase Wzx. FEMS Microbiol. 566

Lett. 287:76-84. 567

13. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes 568

in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645. 569

14. Doerrler, W. T., and C. R. H. Raetz. 2002. ATPase activity of the MsbA lipid flippase 570

of Escherichia coli. J. Biol. Chem. 277:36697-36705. 571

15. Doerrler, W. T., M. C. Reedy, and C. R. H. Raetz. 2001. An Escherichia coli mutant 572

defective in lipid export. J. Biol. Chem. 276:11461-11464. 573

16. Dower, W. J., J. F. Miller, and C. W. Ragsdale. 1988. High efficiency transformation 574

of E. coli by high voltage electroporation. Nucleic Acids Res. 16:6127-6145. 575

17. Drew, D., D. Sjöstrand, J. Nilsson, T. Urbig, C.-n. Chin, J.-W. de Gier, and G. von 576

Heijne. 2002. Rapid topology mapping of Escherichia coli inner-membrane proteins by 577

prediction and PhoA/GFP fusion analysis. Proc. Natl. Acad. Sci. USA 99:2690-2695. 578

18. Feilmeier, B. J., G. Iseminger, D. Schroeder, H. Webber, and G. J. Phillips. 2000. 579

Green fluorescent protein functions as a reporter for protein localization in Escherichia 580

coli. J. Bacteriol. 182:4068-4076. 581

19. Feldman, M. F., C. L. Marolda, M. A. Monteiro, M. B. Perry, A. J. Parodi, and M. 582

A. Valvano. 1999. The activity of a putative polyisoprenol-linked sugar 583

translocase(Wzx) involved in Escherichia coli O antigen assembly is independent of the 584

chemical structure of the O repeat. J. Biol. Chem. 274:35129-35138. 585

20. Guzman, L. M., D. Belin, M. J. Carson, and J. Beckwith. 1995. Tight regulation, 586

modulation, and high-level expression by vectors containing the arabinose pBAD 587

promoter. J. Bacteriol. 177:4121-30. 588

21. Helenius, J., and M. Aebi. 2002. Transmembrane movement of dolichol linked 589

carbohydrates during N-glycoprotein biosynthesis in the endoplasmic reticulum. Semin. 590

Cell. Dev. Biol. 13:171-178. 591

22. Helenius, J., D. T. Ng, C. L. Marolda, P. Walter, M. A. Valvano, and M. Aebi. 2002. 592

Translocation of lipid-linked oligosaccharides across the ER membrane requires Rft1 593

protein. Nature 415:447-450. 594

23. Jones, D. T., W. R. Taylor, and J. M. Thornton. 1994. A model recognition approach 595

to the prediction of all-helical membrane protein structure and topology. Biochemistry 596

33:3038-3049. 597

24. Keenleyside, W. J., and C. Whitfield. 1996. A novel pathway for O-polysaccharide 598

biosynthesis in Salmonella enterica serovar Borreze. J. Biol. Chem. 271:28581-28592. 599

25. Lahti, J. L., A. P. Silverman, and J. R. Cochran. 2009. Interrogating and predicting 600

tolerated sequence diversity in protein folds: application to E. elaterium trypsin inhibitor-601

II cystine-knot miniprotein. PLoS Comput Biol 5:e1000499. 602

26. Lehrer, J., K. A. Vigeant, L. D. Tatar, and M. A. Valvano. 2007. Functional 603

characterization and membrane topology of Escherichia coli WecA, a sugar-phosphate 604

transferase initiating the biosynthesis of enterobacterial common antigen and O antigen 605

lipopolysaccharide. J. Bacteriol. 189:2618-2628. 606

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

26

27. Lin, W.-J., and M.-J. Hwang. 1998. VHMPT: a graphical viewer and editor for helical 607

membrane protein topologies. Bioinformatics 14:866-868. 608

28. Liu, D., and P. R. Reeves. 1994. Escherichia coli K12 regains its O antigen. 609

Microbiology 140:49-57. 610

29. Manoil, C. 1991. Analysis of membrane protein topology using alkaline phosphatase and 611

beta-galactosidase gene fusions. Methods Cell. Biol. 34:61-75. 612

30. Manoil, C., and J. Beckwith. 1986. A genetic approach to analyzing membrane protein 613

topology. Science 233:1403-1408. 614

31. Marolda, C. L., P. Lahiry, E. Vinés, S. Saldías, and M. A. Valvano. 2006. 615

Micromethods for the characterization of lipid A-core and O-antigen lipopolysaccharide 616

Methods Mol Biol. 347:237-252. 617

32. Marolda, C. L., L. D. Tatar, C. Alaimo, M. Aebi, and M. A. Valvano. 2006. Interplay 618

of the wzx translocase and the corresponding polymerase and chain length regulator 619

proteins in the translocation and periplasmic assembly of lipopolysaccharide O antigen. J. 620

Bacteriol. 188:5124-5135. 621

33. Marolda, C. L., J. Vicarioli, and M. A. Valvano. 2004. Wzx proteins involved in O 622

antigen biosynthesis function in association with the first sugar of the O-specific 623

lipopolysaccharide subunit. Microbiology 150:4095-4105. 624

34. Marolda, C. L., J. Welsh, L. Dafoe, and M. A. Valvano. 1990. Genetic analysis of the 625

O7-polysaccharide biosynthesis region from the Escherichia coli O7:K1 strain VW187. J. 626

Bacteriol. 172:3590-3599. 627

35. Mazur, A., M. Marczak, J. E. Król, and A. Skorupska. 2005. Topological and 628

transcriptional analysis of pssL gene product: a putative Wzx-like exopolysaccharide 629

translocase in Rhizobium leguminosarum bv. trifolii TA1. Arch. Microbiol. 184:1-10. 630

36. Nikaido, H. 2003. Molecular basis of bacterial outer membrane permeability revisited. 631

Microbiol. Mol. Biol. Rev. 67:593-656. 632

37. Nilsson, J., B. Persson, and G. von Heijne. 2000. Consensus predictions of membrane 633

protein topology. FEBS Lett. 486:267-269. 634

38. Ortega, X., T. A. Hunt, S. Loutet, A. D. Vinion-Dubiel, A. Datta, B. Choudhury, J. 635

B. Goldberg, R. Carlson, and M. A. Valvano. 2005. Reconstitution of O-specific 636

lipopolysaccharide expression in the Burkholderia cenocepacia strain J2315 that is 637

associated with transmissible infections in patients with cystic fibrosis. J. Bacteriol. 638

187:1324-1333. 639

39. Patel, K. B., S. E. Furlong, and M. A. Valvano. 2010. Functional analysis of the C-640

terminal domain of the WbaP protein that mediates initiation of O antigen synthesis in 641

Salmonella enterica. Glycobiology. 642

40. Paulsen, I. T., A. M. Beness, and M. H. Saier. 1997. Computer-based analyses of the 643

protein constituents of transport systems catalysing export of complex carbohydrates in 644

bacteria. Microbiology 143 ( Pt 8):2685-2699. 645

41. Pérez, J. M., M. A. McGarry, C. L. Marolda, and M. A. Valvano. 2008. Functional 646

analysis of the large periplasmic loop of the Escherichia coli K-12 WaaL O-antigen 647

ligase. Mol Microbiol 70:1424-1440. 648

42. Raetz, C. R. H., and C. Whitfield. 2002. Lipopolysaccharide endotoxins. Annu. Rev. 649

Biochem. 71:635-700. 650

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

27

43. Reiner, A. M. 1977. Xylitol and D-arabitol toxicities due to derepressed fructose, 651

galactitol, and sorbitol phosphotransferases of Escherichia coli. J. Bacteriol. 132:166-652

173. 653

44. Ruiz, N., D. Kahne, and T. J. Silhavy. 2006. Advances in understanding bacterial outer-654

membrane biogenesis. Nat. Rev. Microbiol. 4:57-66. 655

45. Ruiz, N., D. Kahne, and T. J. Silhavy. 2009. Transport of lipopolysaccharide across the 656

cell envelope: the long road of discovery. Nat. Rev. Micro. 7:677-683. 657

46. Saldías, M. S., K. Patel, C. L. Marolda, M. Bittner, I. Contreras, and M. A. Valvano. 658

2008. Distinct functional domains of the Salmonella enterica WbaP transferase that is 659

involved in the initiation reaction for synthesis of the O antigen subunit. Microbiology 660

154:440-453. 661

47. Sorgen, P. L., Y. Hu, L. Guan, H. R. Kaback, and M. E. Girvin. 2002. An approach to 662

membrane protein structure without crystals. Proc. Natl. Acad. Sci. U.S.A. 99:14037-663

14040. 664

48. Sperandeo, P., G. Dehò, and A. Polissi. 2009. The lipopolysaccharide transport system 665

of Gram-negative bacteria. Biochim. Biophys. Acta 1791:594-602. 666

49. Sperandeo, P. a., F. K. Lau, A. Carpentieri, C. De Castro, A. Molinaro, G. Dehò, T. 667

J. Silhavy, and A. Polissi. 2008. Functional analysis of the protein machinery required 668

for transport of lipopolysaccharide to the outer membrane of Escherichia coli. J. 669

Bacteriol. 190:4460-4469. 670

50. Stenberg, F., P. Chovanec, S. L. Maslen, C. V. Robinson, L. Ilag, G. von Heijne, and 671

D. O. Daley. 2005. Protein complexes of the Escherichia coli cell envelope. J. Biol. 672

Chem. 280:34409-34419. 673

51. Tatar, L. D., C. L. Marolda, A. N. Polischuk, D. van Leeuwen, and M. A. Valvano. 674

2007. An Escherichia coli undecaprenyl-pyrophosphate phosphatase implicated in 675

undecaprenyl-phosphate recycling. Microbiology 153:2518-2529. 676

52. Tusnády, G. E., and I. Simon. 2001. The HMMTOP transmembrane topology 677

prediction server. Bioinformatics 17:849-850. 678

53. Ulevitch, R. J., J. C. Mathison, and J. da Silva Correia. 2004. Innate immune 679

responses during infection. Vaccine 22 Suppl 1:S25-30. 680

54. Valvano, M. A. 2003. Export of O-specific lipopolysaccharide. Front. Biosci. 8:s452-681

471. 682

55. Viklund, H., and A. Elofsson. 2008. OCTOPUS: improving topology prediction by two-683

track ANN-based preference scores and an extended topological grammar. 684

Bioinformatics 24:1662-1668. 685

56. Vinés, E., C. L. Marolda, A. Balachandran, and M. A. Valvano. 2005. Defective O 686

antigen polymerization in tolA and pal mutants of Escherichia coli in response to 687

extracytoplasmic stress. J. Bacteriol. 187:3359-3368. 688

57. Von Heijne, G. 2006. Membrane-protein topology. Nat Rev Mol Cell Biol 7:909-918. 689

58. Zhou, G. P., and F. A. Troy. 2005. NMR study of the preferred membrane orientation 690

of polyisoprenols (dolichol) and the impact of their complex with polyisoprenyl 691

recognition sequence peptides on membrane structure. Glycobiology 15:347-359. 692

59. Zhou, G. P., and F. A. Troy, 2nd. 2005. NMR studies on how the binding complex of 693

polyisoprenol recognition sequence peptides and polyisoprenols can modulate membrane 694

structure. Curr. Protein Pept. Sci. 6:399-411. 695

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

28

60. Zhou, Z., K. A. White, A. Polissi, C. Georgopoulos, and C. R. Raetz. 1998. Function 696

of Escherichia coli MsbA, an essential ABC family transporter, in lipid A and 697

phospholipid biosynthesis. J. Biol. Chem. 273:12466-12475. 698

699

700

701

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

29

TABLE 1. Strains and plasmids used in this study 701

Strains Relevant propertiesa Source or 702

and plasmids Reference 703

Strains 704

DH5α F- φ80lacZ M15 endA recA hsdR(rK

-mK

-) nupG 705

thi glnV deoR gyrA relA? ∆(lacZYA-argF)U169 Laboratory stock 706

CC118 ∆(ara leu) ∆lac phoA galE galK thi rpsL rpsB argE recA Laboratory stock 707

CLM17 W3110, ∆wzxO16 (33) 708

CLM74 W3110, ∆araCIBAD This study 709

JM109 endA recA gyrA thi, hsd(rK–mK

+) relA supE Δ(lac-proAB) Laboratory stock 710

W3110 rph-1 IN(rrnD-rrnE)1, wbbL::IS5 Laboratory stock 711

712

Plasmids 713

pAH18 pBADNTF expressing the mature FLAG-PhoA This study 714

pAH18-W138PhoA wzx∆(138-463) in pAH18, ApR This study 715

pAH18-F242PhoA wzx∆(242-463) in pAH18, ApR This study 716

pAH18-T288PhoA wzx∆(288-463) in pAH18, ApR This study 717

pAH18-V360PhoA wzx∆(360-463) in pAH18, ApR This study 718

pAH18-K367PhoA wzx∆(367-463) in pAH18, ApR This study 719

pAH18-K367PhoA(PstI) wzx∆(367-463) cloned into pAH18, ApR This study 720

pBAD24 expression vector inducible with arabinose, ApR

(20) 721

pBADNTF pBAD24 for N-terminus FLAG fusions, 722

inducible by arabinose, ApR (33) 723

pBADGFP pBAD24 for C-terminus GFP fusions, 724

inducible by arabinose, ApR (41) 725

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

30

pBADHIS pBAD24 for C-terminus 5x His fusions, 726

inducible by arabinose, ApR (26) 727

pBL1 wzxEcO157-N-terminus FLAG cloned into 728

pBADHIS, 5xHis, ApR This study 729

pBL2 pBL1 expressing wzxEcO157-C102A 5xHis ApR This study 730

pBL3 pBL1 expressing wzxEcO157-C102A,C434A 5xHis ApR This study 731

pBL4 pBL1 expressing wzxEcO157-C102A,C130A,C434A 5xHis, ApR This study 732

pCP20 FLP+, λ cI857

+, Rep

ts, Ap

R, Cm

R λ pR (13) 733

pCM256 wzxEcO157 from pJV7 cloned into pBADGFP, (Wzx-GFP) ApR This study 734

pCM256-K244GFP wzx∆(244-463) in pCM256, ApR This study 735

pCM256-T288GFP wzx∆(288-463) in pCM256, ApR This study 736

pCM256-Q301GFP wzx∆(301-463) in pCM256, ApR This study 737

pCM256-T308GFP wzx∆(308-463) in pCM256, ApR This study 738

pCM256-D320GFP wzx∆(320-463) in pCM256, ApR This study 739

pCM256-K331GFP wzx∆(331-463) in pCM256, ApR This study 740

pCM256-G397GFP wzx∆(397-463) in pCM256, ApR This study 741

pJV7 wzxEcO157 cloned into pBADNTF, ApR (33) 742

pKD4 Template plasmid for mutagenesis, ApR Km

R (13) 743

pKD46 γ, β, and exo from λ phage, araC-ParaB, ApR (13) 744

pMF19 wbbLEcO16 cloned into pEXT21, SpR (19) 745

pML202 pBL1 expressing wzxEcO157-C13A,C102A,C130A,C434A7xHis, ApR This study 746

pML203 pBL1 expressing wzxEcO157 C13A,C102A,C130A,C434A,C449A7xHis, ApR This study 747

748

a Ap, ampicillin; Sp, spectinomycin; Km, kanamycin; 749

750

751

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

31

TABLE 2. Primers used in this study 751

752 753 Gene cloning/ Purpose/ Primer Sequence Restriction 754 mutation vector Enzyme Site 755 756 757 ∆araCIBAD Deletion, 3341 5’-TTATCCAGCAGCGTTTGCTGCATATCCGGTAACTGCGGCGTG 758 5’ fragment TGTAGGCTGGA 759 Deletion, 3342 5’-CGTTACCAATTATGACAACTTGACGGCTACATCATTCACTCA 760 3’ fragment TATGAATATCCTCCTTAG 761 Deletion 3333 5’-AATGAATACACGGTGGATTG 762 verification 763 Deletion 3335 5’-GTTTCGTTTGATTGGCTGTG 764 verification 765 766 wzxEcO157-GFP cloning of 252 5'-GATTAGCGGATCCTACCTGA 767 (pCM256) C-terminal GFP 768 fusion 769 cloning of 3370 5’-GACTAGGCCTTCCTCTTATATTTAACTGTCTATC StuI 770 C-terminal GFP 771 fusion 772 773 GFP fusions Reverse primer GFP 5'- GACTAGGCCTGGGAGTAAAGGAGAAGAACTTTTCAC StuI 774 775 wzxEcO157-K244GFP Forward primer K244 5’-GACTAGGCCTTTTTGTAAACTTTATTAATCGCTTTAT StuI 776 wzxEcO157-T288GFP Forward primer T288 5’-GACTAGGCCTAGTAACACCCAATGTTATAGATAT StuI 777 wzxEcO157-Q301GFP Forward primer Q301 5’-GACTAGGCCTTTGAAATAATCTCTGTGTAATGCT StuI 778 wzxEcO157—T308GFP Forward primer T308 5’-GACTAGGCCTCGTAAGAGGGACCGTAGATATTTG StuI 779 wzxEcO157-D320GFP Forward primer D320 5’-GACTAGGCCTATCTGCATAAGCAGCCCATAACGGGAT StuI 780 wzxEcO157-K331GFP Forward primer K331 5’-GACTAGGCCTTTTTATAAATTGAGTATCATTGCGTGCA StuI 781 wzxEcO157-G397GFP Forward primer G397 5'- GACTAGGCCTACCATTAAAGCTTGCAAATGTAT StuI 782 783 wzxEcO157-FLAG-5xHis pBL1 2317 5’-CTAGCTCGAGTCCTCTTATATTTAACTGTCT) XhoI 784 785 phoA gene gene cloning 4771 5’-CTATCTGCAGCCTGTTCTGGAAAACCGGGCTG PstI 786 gene cloning 4770 5’-AAGCCGCTCTGGGGCTGAAATAAGCTTTAAG) HindIII 787 788 wzxEcO157-K367PhoA(PstI)

a 4769 5’-TTTTGGGCTAGCAGGAGGAATTCAC NheI 789

4772 5’-GAAGTCGTTAATATTTGGACAGAAGGAAAGCTGCAGCCTG PstI 790 791 PhoA fusions Reverse primer 4768 5’-CCTGTTCTGGAAAACCGGGC 792 793 WzxEcO157-K367PhoA/ Forward primer 4764 5’-GAAGTCGTTAATATTTGGACAGAAGGAAAG 794 WzxEcO157-V360PhoA 795 WzxEcO157-T288PhoA Forward primer 4766 5’-GGTGATAACTTTATAATATCTATAACATTGGGTGTTACT 796 WzxEcO157-F242PhoA Forward primer 4767 5’-GGCATGATTGATTGGCAACTAGTAATAAAA 797 WzxEcO157-W138PhoA Forward primer 4816 5’-CAATTAATCTTATTATAAAGCGATTAATAAAGTTTACAAAA 798 799 wzxEcO157-1-K367 verification of 4817 5’-CTGATTGGCGATGGGATGG 800 (pAH18) cloned fragment 801 802 803 a This construct has a PstI site, added to facilitate cloning, which adds two additional amino acids, between K376 and the PhoA reporter (See 804

Materials and Methods). 805 806 807 808 809 810 811 812 813

814

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

32

TABLE 3. Properties of the replacement mutants of the cysteineless WzxEcO157 814

815

Plasmid Biotinylationa Location of O-antigen expression

c 816

Whole cells Vesicles amino acid residueb 817

818

pML203-K144C + ND P 100 819

pML203-K176C ND + C 40 820

pML203-H209C + ND P 90 821

pML203-K244C - + C 60 822

pML203-P254C ND - TM 100 823

pML203-F264C ND - TM 100 824

pML203-D277C + + P 100 825

pML203-G286C ND - ? 100 826

pML203-F293C - - ? 100 827

pML203-R298C + ND P 0 828

pML203-P306C - - TM 70 829

pML203-P313C - - TM 50 830

pML203-D320C - + C 30 831

pML203-R324C - + C 90 832

pML203-K331C - + C 70 833

pML203-K367C + + P 90 834

pML203-K402C ND ND C 80 835

836

a Bacteria were transformed with derivatives of pML203 expressing the cysteineless version of 837

WzxEcO157 carrying single cysteine substitutions at the indicated location. Biotinylation was 838

performed in whole cells and membrane vesicles (see data in Fig. 4). Biotinylation of membrane 839

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

33

vesicles, combined with and without treatment with the blocking reagent MTSET, allowed us to 840

determine the cytoplasmic location of amino acid residues, as described in Results. ND, not 841

determined. 842

b P, periplasm; C, cytoplasm; TM, transmembrane helix; see also Fig. 2 for a graphical location. 843

c O antigen surface expression based on complementation experiments using the strain 844

CLM17/pMF19 (see data in Fig. 5). LPS O antigen was quantified by densitometry as described in 845

Materials and Methods, and the relative expression values are indicated as percent of the 846

expression found in cell lysates of CLM17/pMF19 containing the positive control plasmid 847

pML203, which were included in each gel. 848

849

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

34

Legend to figures 849

FIG. 1. Graphical representation of the topological predictions by the various programs used in 850

this work. The numbers indicate the position of the amino acids in WzxEcO157 (463 amino acids). 851

The location of soluble segments (cytosolic or periplasmic) and the positions of predicted TM 852

helices are indicated. The colored square denotes the region of the protein, roughly between amino 853

acids 260-425, where the predictions showed the greatest differences among the programs used. 854

FIG. 2. LPS profiles (A) and protein expression (B) of CLM17(pMF19) cells expressing 855

parental WzxEcO157 or the constructs containing the single (wzx-1xC-), double (wzx-2xC

-), triple 856

(wzx-3xC-), quadruple (wzx-4xC

-) and quintuple (wzx-5xC

-) cysteine-less constructs. The 857

characteristics of the plasmids pBL1, pBL2, pBL3, pBL4, pML202, and pML203 are indicated in 858

Table 1. A, LPS was prepared from cultures induced with 0.2% (w/v) arabinose. Samples were 859

separated on a 14 % Tricine gel and the gel was stained with silver nitrate. B, Total membranes 860

were prepared from CLM74 cells containing the various constructs and vector control. 20 µg of 861

protein were separated on a 14 % SDS-PAGE, transferred to a nitrocellulose membrane and the 862

blot was incubated with anti-FLAG rabbit polyclonal antibodies. The specific bands were detected 863

with fluorescence using Alexa Flour® 680 anti-mouse IgG antibodies and IRDye800CW anti-864

rabbit IgG antibodies. M, Broad Range Prestained SDS-PAGE Standard (Bio-Rad). 865

FIG. 3. Topological model of WzxEcO157 by a combination of bioinformatics, GFP and PhoA 866

deletion-fusion analyses, and substituted cysteine accessibility (SCAM) experiments. The model 867

was originally derived according to HHMTOP computer program and graphically displayed with 868

VHMPT (27). The residues spanning predicted TM helices are enclosed in dotted boxes. The 869

numbering of periplasmic and cytosolic loops is shown. Small square boxes (in red) and circles 870

indicate residues whose replacement affects and does not affect O antigen production, 871

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

35

respectively. Black-filled small squares and circles indicate the residues labeled with biotin-872

maleimide; grey-filled circles indicate residues that did not react with BM. Rectangular boxes 873

and underlined residues indicate the endpoint of the GFP (green) and PhoA (blue) fusions. Filled 874

boxes indicate the fusions that were positive for fluorescence or alkaline phosphatase activity, as 875

applicable, and clear boxes indicate those that did not fluoresce or were enzymatically inactive. 876

FIG. 4. Labeling experiments with biotin maleimide (BM) with (-) or without (+) MTSET pre 877

treatment performed on cysteine replacement mutants of WzxEcO157. Labeled proteins were isolated 878

by NTA-Ni2+

affinity chromatography and detected with anti-FLAG antibodies as described in 879

Material and Methods. M, Broad Range Prestained SDS-PAGE Standard (Bio-Rad). A, labeling 880

of whole cells; B, labeling of membrane vesicles. 881

FIG. 5. Analysis of wzxEcO157 –GFP fusion constructs. For panels A and B, protein samples 882

were prepared as indicated in the legend to Fig. 1. A, Expression of wild type wzxEcO157 –GFP 883

fusion protein. B, expression of deleted wzxEcO157 –GFP fusion proteins. Proteins from cells 884

expressing: lane 1, WzxEcO157-GFP (~81, kDa; pCM256); lane 2, WzxEcO157-G397GFP (72.2 kDa); 885

lane 3, WzxEcO157-K331GFP (65.3 kDa); lane 4, WzxEcO157-D320GFP (64 kDa); lane 5, WzxEcO157-886

T308GFP (62.6 kDa); lane 6, WzxEcO157-Q301GFP (62 kDa); lane 7, WzxEcO157-T288GFP (60 kDa); lane 8 887

WzxEcO157-K244GFP (53 kDa). C, Fluorescence microscopy of CLM74 cells expressing wzxEcO157 –888

GFP fusion proteins. pCM256 (WzxEcO157-GFP), K331 (WzxEcO157-K331GFP), K244 (WzxEcO157-889

K244GFP), D320 (WzxEcO157-D320GFP). Arrowheads point to the fluorescence accumulated on the cell 890

perimeter, indicating a membrane location of the GFP fusion protein. 891

FIG. 6. O-antigen and WzxEcO157 protein expression in CLM17(pMF19) cells containing 892

plasmids encoding protein constructs with alanine or serine amino acid replacements. A, amino 893

acid replacements located on either periplasmic or cytosolic loops. B, amino acid replacements 894

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

36

located within TM helices. LPS samples were prepared and analyzed as described in the legend to 895

Fig. 1 and in Materials and Methods. The O antigen expression was quantified by densitometry as 896

described in Materials and Methods, and the relative expression values are indicated as percent of 897

the expression found in cell lysates of CLM17(pMF19) containing the positive control plasmid 898

pBL1, which were included in each gel. 899

FIG. 7. O-antigen (upper panel) and wzxEcO157 (lower panel) expression of CLM17(pMF19) 900

cells containing constructs with single amino acids replacements, as indicated, at positions R298, 901

D85, D 326, and K419. LPS and proteins were prepared and analyzed as described in the legend to 902

Fig. 2 and in Materials and Methods. The O antigen expression was quantified by densitometry as 903

described in Materials and Methods, and the relative expression values are indicated as percent of 904

the expression found in cell lysates of CLM17(pMF19) containing the positive control plasmid 905

pBL1, which were included in each gel. 906

907

908

909

910

911

912

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

37

913

Marolda et al. Fig. 1 914

915

916

917

Marolda et al. Fig. 2 918

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

38

919

Marolda et al. Fig. 3 920

921

922

Marolda et al. Fig. 4 923

924

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

39

925

Marolda et al. Fig. 5 926

927

928

929

930

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

40

931

932

Marolda et al. Fig. 6 933

934

935

936

Marolda et al. Fig. 7 937

938

on August 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

JOURNAL OF BACTERIOLOGY, Mar. 2011, p. 1291–1292 Vol. 193, No. 50021-9193/11/$12.00 doi:10.1128/JB.01489-10Copyright © 2011, American Society for Microbiology. All Rights Reserved.

ERRATUM

Membrane Topology and Identification of Critical Amino Acid Residues in theWzx O-Antigen Translocase from Escherichia coli O157:H7Cristina L. Marolda, Bo Li, Michael Lung, Mei Yang, Anna Hanuszkiewicz,

Amanda Roa Rosales, and Miguel A. ValvanoCenter for Human Immunology, Siebens-Drake Research Institute, Departments of Microbiology and Immunology and Medicine,

University of Western Ontario, London, N6A 5C1 Ontario, Canada

Volume 192, no. 23, p. 6160-6171, 2010. Page 6160: The title should appear as shown above.Page 6165: Fig. 3 should appear as shown below. (The wzxEcO157 gene was obtained by PCR cloning from genomic DNA of strain

UWO934-88, a clinical isolate of E. coli O157:H7 [Marolda et al., Microbiology 150:4095-4105, 2004], and its amino acid sequenceis identical to that of GenBank accession no. AE005429_8. The amino acid sequence of WzxEcO157 includes an N-terminal fusionto the FLAG epitope. To construct this fusion, the first Met of wild-type WzxEcO157 was changed to Gly [position 1/13]. The aminoacid numbers in the figure correspond to the original positions in the wild-type protein [Gly-13 corresponds to Met-1]. The tyrosineresidue at position 319 in the original figure was misplaced, and its normal location is at position 253. The methionine at position405 was displaced graphically but is actually located at the end of cytosolic loop 5.)

FIG. 3.

1291

Page 6168: Table 3 should appear as shown below (column heads have been corrected).

TABLE 3.

Plasmid

BiotinylationaLocation ofamino acid

residueb

O-antigenexpressioncWhole

cells Vesicles

pML203-K144C � ND P 100pML203-K176C ND � C 40pML203-H209C � ND P 90pML203-K244C � � C 60pML203-P254C ND � TM 100pML203-F264C ND � TM 100pML203-D277C � � P 100pML203-G286C ND � ? 100pML203-F293C � � ? 100pML203-R298C � ND P 0pML203-P306C � � TM 70pML203-P313C � � TM 50pML203-D320C � � C 30pML203-R324C � � C 90pML203-K331C � � C 70pML203-K367C � � P 90pML203-K402C ND ND C 80

1292 ERRATUM J. BACTERIOL.