71

71

4. RESULTS AND DISCUSSION

The results obtained from the present study entitled “Evaluation of

protease inhibitor on insect proteases and isolation of gene encoding protease

inhibitor from rice bean (Vigna umbellata)” have been presented in this Chapter.

Attempts have been made to discuss the findings of the experiments in the light

of available scientific literature. The present discussion establishes the cause

and the result relationship between the findings. The results obtained from

various experiments conducted to achieve the said objectives are presented and

discussed here with the help of pertinent data tables / figures under the following

sub heads:

4.1 Isolation, purification and characterization of protease inhibitor.

4.2 Metabolic interaction of protease inhibitor with insect gut proteases.

4.3 Assessment of inhibitory potential of rice bean flour on Spodoptera litura

and Callosobruchus maculates.

4.4 Isolation of gene encoding protease inhibitor.

4.1 Isolation, purification and characterization of protease inhibitor

4.1.1 Isolation and purification of protease inhibitors

Recent research studies have resulted in the development of agricultural

use of plants for the detection and characterization of protease inhibitors

responsible for resistance in plants towards insect infestation. Among these,

serine protease inhibitor from legume seeds plays an important role. Trypsin

inhibitors have shown resistance to some Lepidoptera and Coleoptera insect

species (De Leo et al. 2001).

Looking into the needs of alternative genes to deploy through transgenic

development to increase insect resistance, attempts were made to isolate and

purify trypsin inhibitor from rice bean. Rice bean genotype BRS-2 was subjected

to extraction and purification of trypsin inhibitor.

72

72

Three extraction media distilled water, 0.001 N NaOH and 0.1 M

phosphate buffer pH 7.5 were used for extracting trypsin inhibitor from rice bean

flour. The trypsin inhibition percent in these extracts was 8.21, 7.95 and 25.52

percent, respectively (Table 4.1). The maximum activity was observed when the

flour was extracted with 0.1 M phosphate buffer (pH 7.5). Final purification of

trypsin inhibitor from BRS-2 was carried out in 0.1 M phosphate buffer as trypsin

inhibitor was found to be stable and could be extracted well in this media.

Table 4.1 The trypsin inhibition percent in different extraction media

S.No. Extraction medium Trypsin inhibition (%)

1 Distilled water 8.21

2 0.1 M Phosphate buffer pH 7.5 25.52

3 0.001 N NaOH 7.95

Ammonium sulphate precipitation has been widely used to precipitate

proteins in a partially purifired form. The precipitation of the proteins was carried

from 60-90 per cent saturation with ammonium sulphate (Table 4.2). The

maximum trypsin inhibitor activity was recorded at 80 per cent saturation (45.90

%). The precipitates obtained were dissolved in 0.1 M phosphate buffer (pH 7.5)

and dialyzed against 0.05 M phosphate buffer pH 7.5 for 24 h. After dialysis an

aliquot of dialyzed sample was taken for checking the inhibitory activity (48.80

%).The sample was then lyophilized and kept for further purification processes.

Table 4.2 The trypsin inhibition (per cent) and protein content (mg) after different levels of precipitation with ammonium sulphate

S.No. Ammonium sulphate

saturation (%)

Trypsin inhibition

(%)

Protein content

(mg/ml)

1 60 40.3 79.8

2 70 41.8 88.9

3 80 45.9 121.9

4 90 31.4 103.2

73

73

Ion exchange chromatography: 1ml of dialysed and lyophilized fractions were

loaded on to the ion exchanger DEAE- Sepharose (fast flow) column (40.7 × 2.0

cm; flow rate 25 ml/h). Fractions of 2.5ml each were collected using a linear

gradient of NaCl (0.2M - 0.4M) in 0.1 M phosphate buffer, pH 7.5. The fractions

collected were assayed for protein and inhibitory activity. Subsequent elution with

a linear NaCl gradient resulted in the elution profile which featured two peaks

corresponding to 0.2 M and 0.3 M NaCl gradient. The second broad peak was

chosen for further purification due to its high trypsin inhibitory activity as well as

protein content corresponding to 0.3 M NaCl gradient. The elution profile of

DEAE-Sepharose column is shown in Figure 4.1. The active fractions those

possessing high trypsin inhibitory activity were collected and grouped into two

groups G1, G2. The pooled active fractions were lyophilized, were designated as

DEAE fractions and stored for further studies.

Gel permeation chromatography: 0.5ml of DEAE fraction was loaded on to

Superdex-75 column (22.5x1.5 cm; flow rate 0.5 ml/min) for gel filtration

chromatography was equilibrated with 0.1 M phosphate buffer (pH 6.9) and

eluted with the same buffer. The fractions of 2ml each were collected at a flow

rate of 0.1 ml/ min. The protein content in the fractions was determined and

inhibitory activities against trypsin were also assayed. The inhibitory activity

emerged as one major peak and all fractions within the peak exhibited high

trypsin inhibitory activity. The elution profile obtained on Superdex-75 is shown in

Figure 4.2. The active fractions were pooled and lyophilized for the next step of

purification.

Affinity chromatography: 0.5ml of the above lyophilized sample pooled from

Sephadex G-75 column was dissolved in phosphate buffer 0.1M pH 7.5 and was

allowed to flow through CNBr activated Sepharose-trypsin column (0.9 cm x 14

cm). Fractions of 1.5ml each were eluted with 0.05N Tris buffer pH 7.8 using a

flow rate of 0.5 ml/min. The elution profile of column Sepharose- trypsin column

is shown in Figure 4.3. Fifteen fractions were collected and monitored for protein

and trypsin inhibitory activity. The active fractions were lyophilized and

designated as Sepharose- trypsin fraction. The apparent homogeneity of the

74

74

Figure 4.1 Trypsin inhibitor activity (%) and protein content (mg) in various DEAE- Sepharose chromatographic fractions

0

0,1

0,2

0,3

0,4

0,5

0,6

0,7

0,8

0,9

1

0

10

20

30

40

50

60

70

801 2 3 4 5 6 7 8 9

10

11

12

13

14

15

16

17

18

19

20

21

22

23

24

25

26

27

28

29

30

31

32

33

34

35

36

37

38

39

40

41

42

43

44

45

46

47

48

49

50

51

52

53

54

55

56

57

58

59

60

0.1 0.2 0.3 0.4 0.5

Pro

tein

(m

g)

Try

psin

in

hib

ito

ry a

cti

vit

y (

%)

Fraction number

Trypsin inhibitory activity (%) Protein (mg) NaCl

75

75

Figure 4.2 Trypsin inhibitor activity (%) and protein content (mg) in various Superdex-75 chromatographic fractions

0

0,05

0,1

0,15

0,2

0,25

0,3

0,35

0

10

20

30

40

50

60

70

80

1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39

Pro

tein

(m

g)

Try

psin

in

hib

ito

ry a

cti

vit

y (

%)

Fraction number

Trypsin inhibitory activity (%) Protein (mg)

76

76

Figure 4.3 Trypsin inhibitor activity (%) and protein content (mg) in various Sepharose-Trypsin affinity chromatographic fractions

0

0,005

0,01

0,015

0,02

0,025

0

10

20

30

40

50

60

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

Pro

tein

(m

g)

Try

psin

in

hib

ito

ry a

cti

vit

y (

%)

Fraction number

Trypsin inhibitory activity (%) Protein (mg)

77

77

M: Marker, C: Crude Extract, I.E: Ion Exchange, G.P: Gel Permeation, A: After

affinity

Figure 4.4 Protein profile of the fractions after final purification

M C I.E G.P A

35 kDa

25 kDa

70kDa

100 kDa

15 kDa

120 Kda

50 Kda

Single protein band

of Purified inhibitor

(24.0 kDa)

MW

78

78

purified trypsin inhibitor protein (P1) obtained from Sepharose-trypsin column

was checked by SDS-PAGE. The data of total trypsin units inhibited (TUI),

protein content, specific activity, fold purification and yield of different fractions

obtained at different stages of purification is presented in Table 4.3.

The trypsin inhibitor was purified to 181.55 fold with 29.18 per cent yield.

The specific activity increased from 8.89 in crude extract to 1614.0 units per mg

of total protein after affinity chromatography. The polypeptide composition of

purified trypsin inhibitor (P1) was determined by SDS-PAGE using 12.5 percent

acrylamide gel. The inhibitor showed one single band on the gel. The molecular

weight was found to be 24.0 kDa using standard molecular weight marker

proteins (Fig. 4.4). This was in consonance with the earlier studies conducted by

Haq and Khan (2003) who purified protein proteinase inhibitor (PI) from

pigeonpea Cajanus cajan (L.) PUSA 33 variety by acetic-acid precipitation, salt

fractionation and chromatography on a DEAE-Cellulose column. The content of

inhibitor was found to be 15 mg/20 g dry weight of pulse. The molecular weight of

the inhibitor as determined by SDS-PAGE under reducing conditions was found

to be about 24.0 kDa. It showed inhibitory activity toward proteolytic enzymes

belonging to the serine protease group, trypsin and chymotrypsin.

Similarly, Benjakul et al. (2000) purified cysteine proteinase inhibitors

(CPI) to 59 and 54 fold from black gram (Vigna mungo (L.) Hepper) and rice

bean (Vigna umbellata Thunb.), respectively, by using heal treatment, followed

by chromatography on a carboxymethyl (CM)-papain-Sepharose affinity column.

The purified inhibitors were highly inhibitory to papain and Pacific whiting

cathepsin L in a concentration dependent manner. They were detected as a dark

band on tricine-SDS-PAGE gel stained for inhibitory activity. The apparent

molecular weights of purified CPI from black gram and rice bean seeds were

estimated to be 19.0 and 21.0 kDa, respectively. Likewise two trypsin inhibitory

activity bands have been purified from soybean (21.0 kDa) and mustard seeds

(20.0 kDa) by Mandal et al. (2002).

79

79

Table 4.3 Purification of trypsin inhibitor from rice bean flour

Step Volume (ml)

TUI Protein (mg)

Specific activity

Fold purification

Yield (%)

Crude extract 100 42806 4811 8.89 1 100

(NH4)2SO4 ppt 50 30211 1080 27.97 3.14 70.57

Ion exchange

chromatography 40 22198 49 483.02 50.95 51.85

Gel filtration 35 16123 25.5 632.27 71.12 37.66

Affinity

Chromatography 14 10491 6.5 1614.0 181.55 29.18

It is likely that the inhibitor purified is of Kunitz type because it has been

well documented that the Kunitz type inhibitors are proteins of a molecular weight

of more than 20 kDa, with low cysteine content and a single reactive site,

whereas the Bowman-Birk type inhibitors have a molecular weight of 8–10 kDa,

as well as a high cysteine content and two reactive sites (Richardson 1991).A

higher molecular mass 24 kDa (> 20 kDa) of the purified inhibitor may either

bedue to monomer-dimer equilibrium (Whitley and Bowman 1975) or due to

oxidation of cysteine residues as reported by Ferrason et al. (1997).

Electrophoretic analysis of the purified trypsin inhibitor on SDS-PAGE revealed a

single band indicating that it was apparently homogenous with a molecular

weight of 24.0 kDa which was similar to the molecular mass of other trypsin

inhibitor purified from Chick pea (Kansal et al. 2008). Gomes et al. (2005) also

purified a proteinase inhibitor from chick pea using affinity Red- Sepharose C1-

6B which was a monomeric protein.

Maggo et al. (1999) purified a protease inhibitor from seeds of rice bean to

homogeneity as judged by native-PAGE with about 29 per cent recovery using

ammonium sulfate fractionation, ion exchange chromatography on DEAE-

cellulose and gel filtration through Sephadex G-100. The purified preparation with

molecular weight of 21.8 kDa was found to be a monomer as revealed by SDS-

PAGE under reducing and non-reducing conditions.

80

80

Using similar purification methods Klomklao et al. 2011 extracted and

characterised trypsin inhibitor from mung bean (Vigna radiata (L.) R. Wilczek)

seeds. The optimal extraction medium was attained by shaking the defatted

mung been seed powder in distilled water (P < 0.05). The extraction time of 2 hrs

was optimum for the recovery of the trypsin inhibitor from mung bean seeds. The

trypsin inhibitor from mung bean seeds was purified by heat-treatment at 900C for

10 min, followed by ammonium sulphate precipitation with 30–65 per cent

saturation and gel filtration on Sephadex G-50. It was purified to 13.51 fold with a

yield of 30.25 per cent. Molecular weight distribution and inhibitory activity

staining showed that the purified trypsin inhibitor had a molecular weight of 25.0

kDa.

4.1.2 Characterization of trypsin inhibitor

The characterization of purified trypsin inhibitors is important because

inhibitors obtained from different sources differ in characteristic such as basic

structure, molecular mass, specific enzyme they recognize and stability.

4.1.2.1 Effect of temperature on stability of trypsin inhibitor

Varying temperature from ambient to 100oC it was observed that the

inhibitory activity was stable upto 70oC, thereafter the activity decreased

gradually, losing 61 percent activity at 100oC. Rice bean trypsin inhibitor showed

maximum percent inhibition at 37oC (65.50%) and lowest at 100oC (35.30%) (Fig

4.5). Gupta et al. (2000) reported that in general protease inhibitors from

legumes are quite stable upto 80OC. They observed that trypsin inhibitor loses its

activity at 100oCwhile working on the purification and characterization of trypsin

inhibitor from seedsof faba bean (Vicia faba L.). Similar results have been

reported for pigeon pea trypsin inhibitors (Benjakul et al.2000).

The stability of inhibitor at high temperatures may be attributed to its rigid

and compact structure stabilized by a number of disulfide linkages (Sierra et al.

1999). Intramolecular disulfide bridges are presumably responsible for the

functional stability of Kunitz-type inhibitors in the presence of physical and

chemical denaturants such as temperature, pH and reducing agents.

81

81

Vasconcelos et al. (1997) observed that trypsin inhibitor from Brazilian soybean

was destroyed completely by heat treatment at 920C for 5 min. The thermal

stability of trypsin inhibitors may differ, depending on the variety. The differences

in heat stability of different inhibitors from different seeds were probably due to

the differences in nature of conformation and bonding involved in their structures.

Figure 4.5 Effect of temperature on the activity of purified rice bean trypsin inhibitor

4.1.2.2 Effect of pH on trypsin inhibitor

More than 85 per cent inhibitory activity from rice bean trypsin inhibitor

was observed when it was pre-incubated between the pH range of 2.2-9.0. It

showed two pH optima at pH 2.2 and other at pH4.0 showing approximately

85.65 per cent and 89.50 per cent trypsin inhibition, respectively. But when

exposed to pH 7.5 and 9.0 about 68 per cent of the activity was lost (Fig 4.6).

Similar observations were reported by Benjakul et al. (2000) that inhibitors from

pigeon pea and cowpea retained their activities between pH 4 and 10. However,

for bambara groundnut, a decreased activity was observed at alkaline pH. The

trypsin inhibitor purified from adzuki bean seeds was stable over a wide pH range

(4–10) (Klomklao et al. 2010a).

0

10

20

30

40

50

60

70

15 37 50 70 90 100

% T

ryp

sin

In

hib

ito

ry a

cti

vit

y

Temperature (oC)

(%) Trypsin Inhibitory activity

82

82

Figure 4.6 Effect of pH on the activity of purified rice bean trypsin inhibitor

Annapurna et al.(1991)studied the pH stability of enzyme inhibitor at

different pH ranging from 3.0 to 12.0 by preincubating the enzyme inhibitor from

jack fruit seeds in different buffers for 24 h and then assaying the inhibitor

activity. The trypsin inhibitor was stable at pH 4.0 and pH 5.0 and started losing

activity at pH values higher than 5.0. The inhibitor was completely unstable at

extreme pH values. This may be due to the conformational changes in the

structure of trypsin inhibitor.

Johnston et al. (1991) observed that the larvae of phytophagous

lepidopterans have acidic conditions in their midgut region, with pH optima for

digestive enzymes typically in the range of 4.0 -5.0. The stability of rice bean

inhibitor over a wide range pH might suggest its efficacy in controlling a variety of

phytophagous insects.

4.2 Metabolic interaction of protease inhibitor with Spodoptera lituragut proteases (SLGP)

Protease inhibitor play important role in plant defense mechanism by

preventing proteolysis in the midgut of insect larvae leading to their starvation

and subsequent death (Gatehouse et al. 1999). This fact can be used as

potential strategy for increasing the level of plant defense against insects. Many

0

10

20

30

40

50

60

70

80

90

100

2,2 4 7,5 9

% T

ryp

sin

In

hib

ito

ry a

cti

vit

y

pH

(%) Trypsin Inhibitory activity

83

83

reports have demonstrated retardation in the growth and development of insect

pests fed on diets incorporating PIs or on transgenic plants expressing PIs

(Murdock and Shade 2002; Telang et al. 2003).Therefore, it is important to

biochemically study the metabolic interaction of these inhibitors with insect

proteases to evaluate their insecticidal potential.

In insects, the most abundant and best studied group of serine proteases

contains those expressed in the larval midgut of Lepidopterons (Mosolov and

Valueva 2005). In this study Spodoptera litura, better known as leafworm, which

is a general feeder was used to study protease- protease inhibitor interaction.

4.2.1 Proteinase activity assays

To assess theproteolytic activity, midguts of 1st to 5th instar larvae of S.

liturawerecarefully dissected out in six batches. The gut luminal contents were

centrifuged and resultant supernatant was filtered and used for further studies.

Protein in crude gut extracts of was estimated by Lowry‟s method (1951),

keeping bovine serum albumin as a standard. Differences in total protein content

among different larval stages were significant (Table 4.4) and were higher in

second and third instar larvae.

Thegut extracts were assayed for proteases activity by using synthetic

substrates with respect to their specificities towards the protease enzyme. Total

gut proteinase activity was measured by using chromogenic substrate azocasein

at a final concentration of 2 per cent. The trypsin and chymotrypsin activity were

measured with BApNA and BTpNA as synthetic substrate, respectively. Specific

protease activity in different larval stages of Spodoptera litura has been

summarized in Table 4.4.

There were significant differences in the proteolytic activity at different

larval stages (α<0.05). Among the larval stages, with developing larval instars,

enzyme activity decreased. Maximum azocaseinolytic (1.93U), trypsin (0.66U)

and chymotrypsin activity (0.37U) was observed in second larval instar (Fig 4.7).

Azocasein activity was significantly lower at late fifth larval stage as compared to

other stages where as activity in fourth and early fifth larval stage was at par.

84

84

Significantly higher trypsin and chymotrypsin activity was observed in second

instar larva whereas there was no statistical significant difference in the activity at

third and fourth larval stage.

Table 4.4: Protein content (mg/ml) and proteolytic activity (U) at different larval instars of Spodoptera litura

Set No.

Larval instar

Protein (mg/ml)

Azocaseinolytic Activity (U)

Trypsin Activity(U)

Chymotrypsin Activity(U)

1 First 10.88 1.11 d ± 0.06 0.58 ba ± 0.05 0.16 c ± 0.04

2 Second 16.42 1.93 a± 0.07 0.66 a ± 0.11 0.37 a± 0.03

3 Third 13.29 1.47 b± 0.10 0.62 ab ± 0.05 0.28 b± 0.04

4 Fourth 12.24 1.35 bc± 0.17 0.58 ba ± 0.09 0.28 b± 0.09

5 Early Fifth 10.50 1.22 cd± 0.08 0.48 bc ± 0.09 0.15 c± 0.04

6 Late Fifth 11.71 0.79 e± 0.09 0.38 c ± 0.03 0.11 c ± 0.05

CV 1.57

CD (5%) 0.35

SE (±) 0.18

*Comparative values converted into units are presented in table. Reported values are ± SEM of triplicate determinations. **Means with the same letter are not significantly different and are at par (one way Annova followed by Duncan's multiple range test, α=0.05).

The enzymatic activities at each larval stage of Spodoptera varied

because of different feeding habits. At early larval stages larvae feed

gregariously on leaves leaving midrib veins only. In this study, protease activity in

the early larval stages (second and third) was high and decreased gradually. This

decline might have result from a greater degradation or a lower synthesis of

digestive proteases produced by a quantitative decrease of the feed intake when

a larva is near of the next molt stage. Therefore, the diminution in enzymatic

activity could be related with anatomical and physiological modifications of larvae

gut (Alarcon et al. 2002).

The above results were in consonance with the findings of Satheesh and

Murugun (2012) who studied the insecticidal potential of protease inhibitor from

leaves of Coccinia grandis (L.) against Spodoptera litura and observed that

maximum protease activity was in 3rd and 4rth larval stage corresponding to ninth

85

85

day of larval development. Changes in gut protein activity overlapped the tryptic

activity until the fourth instar while a significant decrease was observed at 5th

larval stage.

**Bars represent the standard error

Figure 4.7: Variation in proteolytic activity (azocasein, trypsin, chymotrypsin) at different larval instars of Spodoptera litura.

The results obtained were also in direct conformity with the findings of

Mendiola-Olaya et al. (2000) who observed protease activity at highest value in

the second larval instar of P. truncates. The enzyme activity in second larval

stage was more than third instar and only a little activity was detected in pupal

stage. In different larval instars of M. domestica with developing larva to third

instar, amino peptidase, trypsin, chymotrypsin and elastase activity decreased

(Blahovec et al. 2006). Thus, high protease activity in early larval stage and

especially decreasing activity with developing insects may be depends on

feeding behavior,as lepidopteran larvae have a long midgut and food

immediately pass from mouth to midgut, the digestive enzymes works on it and

after digestion absorbance also occurs simultaneously in midgut (Nation 2002).

0

0,5

1

1,5

2

2,5

First Second Third Fourth Early Fifth Late Fifth

Pro

tea

se

ac

tivit

y (

U)

Larval instars

Azocaseinolytic activity (U) Trypsin activity(U) Chymotrypsin activity (U)

86

86

Ravan et al. 2009 while studying the biochemical characterization of

digestive enzymes of wheat bug, Eurygaster Maura found thatprotease activity

reached its highest value (0.0063 Umg protein-1) in the third-nymphal stage and

specific activity in the immature stages decreased constantly up to fourth-instar

nymph. There was significant differences in activity between first, second third

and fourth instars nymphal stages.

4.2.2 Spodoptera litura gut proteases (SLGPs) interaction with protease inhibitors

Serine proteinases have been identified in gut extracts of many

lepidopteran insects including Spodoptera litura (Houseman et al. 1989) and

many of these enzymes are inhibited by proteinase inhibitors. The pH of

lepidopteran guts are alkaline, ranging from 9.0-11.0 (Applebaum 1985) where in

serine proteases are most active. Hence, serine proteinase inhibitors show high

levels of inhibitory effects against several lepidopteran insects (Shulke and

Murdock 1983). They inhibit insect gut proteinases by binding tightly to the active

site, complex formation being essentially irreversible. The inability to utilize

ingested protein and to recycle digestive enzymes results in a critical amino acid

deficiency, which inhibits the protease activity, growth, development and survival

of the insect (Ryan 1990).

In the present study, the inhibitory potential of protease inhibitors, purified

trypsin inhibitor from rice bean was evaluated against gut proteases

(SLGPs).Inhibitory assays were carried out by incubating purified fraction of

trypsin inhibitor with crude gut proteases extract. BApNA and BTpNA were used

as synthetic substrates for studying trypsin and chymotrypsin inhibitory activity,

respectively. Different larval stages of Spodoptera exhibited different responses

to inhibition by rice bean trypsin inhibitor. Bioassay revealed that rice bean

trypsin inhibitors are strong inhibitor of Spodoptera litura and inhibited more than

80 per cent for trypsin and around 69 per cent for chymotrypsin activity.

Maximum trypsin and chymotrypsin inhibition was observed in third larval stage

(83.08% and 69.23%) followed by fourth larval stage (80.39 and 66.66 %)

whereas minimum inhibitory activity was noticed in early fifth stage (Table 4.5).

87

87

Table 4.5: Percent protease inhibition at different larval instars of Spodoptera litura by rice beantrypsin inhibitor

Set No. Larval instar Trypsin Inhibition (%)

Chymotrypsin Inhibition (%)

1 First 72.46 d ± 0.77 57.46 e ± 1.03

2 Second 71.51 d± 1.27 61.18 d ± 0.20

3 Third 83.08 a± 0.96 69.23 a± 1.91

4 Fourth 80.39 b± 1.76 66.66 b ± 0.57

5 Early Fifth 70.27 d± 0.94 58.76 e± 0.55

6 Late Fifth 75.45 c± 1.44 63.60 c ± 0.37

*Data is reported as means of ± SEM of three independent determinations and are expressed as per cent inhibitory activity relative to control. **Means with the same letter are not significantly different and are at par (one way Annova followed by post hoc testing using Duncan's multiple range test. A significant level of 0.05 was used for all statistical tests α=0.05).

Trypsin inhibitory activity (%) at first and second larval stage was

statistically at par whereas chymotrypsin inhibition varied significantly among all

the stages (Fig 4.8). The inhibition in proteolytic activities could be attributed to

the production of protease inhibitor-insensitive enzymes which replace the

protease inhibitor-sensitive enzymes (Broadway 1995). PIs reduce the quantity of

proteins that can be digested and also cause hyper-production of the digestive

enzymes which enhances the loss of sulfur amino acids (Shulke and Murdock

1983) as a result of which, the insects become weak with stunted growth and

eventually die of starvation.

In two other lepidopterans, Heliothis zea and S. exigua, Broadway and

Duffey (1986a) hypothesized that massive overproduction of the protease

inhibitor-insensitive enzyme, which meant that essential amino acids were no

longer available for the production of other proteins, causes reduction in the

protease activities and also reduction in the growth of larva. The inhibitory

potential of rice bean trypsin inhibitor was higher than that observedin

Dimorphandra mollis seed trypsin inhibitor (DMTI) which showed 67 per cent

inhibition among bruchid (Callosobruchus maculates) (Macedo et al. 2002).

88

88

Giri et al. (2003) reported at least 14 trypsin inhibitors from winged

beanseeds. Winged bean tryspin inhibitor (WBTI-1) was identified as a potent

inhibitor of H. armigera gut protease (HGP) activity (94 %). WBTI-2 (24.0 kDa)

and WBTI-4 (20.0 kDa) inhibited HGP activity up to 85 per cent. The results

obtained were also in agreement to Shahout et al. (2011) who reported that

cowpea and soybean protease inhibitors had a significant influence on the

inhibitory activity, growth and development of Spodoptera litura.

**Bars represent the standard error.

Figure 4.8: Variation in protease inhibition (trypsin, chymotrypsin) at different larval instars of Spodoptera litura

Similar responses of decline in protease activity were reported by

Satheesh and Murugun (2012). The antagonist effects of Coccinia grandis (L.) on

the endogenous level of protease activity of 5th instar larvae of Spodoptera litura

showed an overall decline of seven fold in trypsin like activity and a two fold

reduction in levels of chymotrypsin activity.

Sadaati and Badani (2011) reported a significant decrease in tryptic

activity in digestive tract extracts of Helicoverpa armigera fed with a diet

containing soybean trypsin inhibitor paved the beginning of the strategy adopted

0

10

20

30

40

50

60

70

80

90

First Second Third Fourth Early Fifth Late Fifth

(%)

Pro

tea

se

in

hib

itio

n

Larval instars

Trypsin Inhibition (%) Chymotrypsin Inhibition (%)

89

89

by insects to counter the deleterious effects of protease inhibitors. An emerging

trend emphasizes that the leaf chewing lepidopterans induce not only over

production of PI insensitive protease of same class as that of the inhibitor but

may also switch over to alternate pathways involving enzymes with the same

mechanistic class but with a swapped substrate specificity class. Therefore, it

may be possible that the down regulation of tryptic activity by one type of serine

protease inhibitor is compensated by an upregulation of another class of serine

proteases (Sadaati and Badani 2011).

Since ricebean trypsin protease inhibitor is effective against both trypsin

and chyotrypsin protease it could generate a better approach to combat the

overall growth and developmental physiology of insect larvae.Previous studies on

insect protease-protease inhibitors interaction have reiterated in the fact that the

best inhibitory effects are obtained with an inhibitor with multiple inhibitory

activities (Babu et al. 2012).

4.2.3 Feeding of rice bean flour to Spodoptera litura and Callosobruchus maculatus

4.2.3.1 Feeding of Spodoptera litura

PIs contribution to the plant defense mechanisms relies on the inhibition of

proteases present in insect‟s gut causing reduction in the availability of amino

acids necessary for their growth.The effect of protease inhibitor on insects is

chronic rather than acute, but the effects on pest population are usually dramatic

as they increase the mortality of insect population. PIs are potent inhibitors and

produce deleterious effect when fed to larvae. In order to determine the effects of

rice bean protease inhibitors, feeding experiments were conducted on

Spodoptera litura larvae. Larvae were reared on diet preparation of rice bean

flour along with artificial diet. Percent composition of diet and mean percentage

mortality has been summarized in Table 4.6.

90

90

The above results revealed that addition of rice bean flour in the diet had a

significant effect on mortality rate of Spodoptera litura. Larvae fed on 75 and 100

per cent rice bean flour composition resulted in 80 per cent larval mortality just

after 48 and 72 hrs of the feeding experiment, respectively. 100 per cent mortality

rate was observed after 72 hrs when rice bean flour was given as sole diet. Even

the lowest concentration of 25 and 50 per cent of rice bean reduced S. litura

viability to 40 per cent after 48 hrs wheres, no effect was observed in the positive

control where the larvae were fed on artificial diet without rice bean flour. In all

treatments the percentage mortality increased with increase induration after

feeding. After 96 hrs (4days) of the experiment 100 percent mortality was

observed in all treatments. The mortality of S. litura larvae fed on rice bean flour

diet is in accordance with the reported insecticidal activity by Copaifera

langsdorffii (Mendonça et al. 2005).

Table 4.6: Mortality (%) of Spodoptera litura larvae fedon rice bean flour

Per cent Composition of

diet

Per cent Mortality after

24 hrs 48 hrs 72 hrs 96 hrs

25 0.0 40 ± 0.98 80 ± 0.0 100 ± 0.99

50 20 ± 1.04 40 ± 0.57 80 ± 0.97 100± 0.57

75 20 ± 0.5 60 ± 0.28 80 ± 0.57 100 ± 0.0

100 40 ± 0.0 80 ± 0.50 100 ± 0.50 100 ± 0.0

Control 0.0 0.0 0.0 0.0

*Data is reported as means of ±SEM of three independent determinations

Qin et al. (2004) observed total larval mortality of S.litura larvae after eight

days of feeding on cowpea (Vigna unguiculata) flour, which was four days longer

than observed in the present study. Elbadry et al. (2009) observed total larval

mortality of Spodoptera after nine days of feeding on sweet potato (Ipomoea

batatas) and cotton (Cocos nucifera).

91

91

Similar results were reported by Saadati and Bandani (2011) who studied

the effects of serine protease inhibitors on growth, development and digestive

serine proteinases of the Sunn pest, Eurygaster integriceps. They observed that

their survival rate was affected significantly by the presence of protease inhibitors

in their diets. There was decline in enzyme activity of E. integriceps when the

insect faced high doses of inhibitors in their diet.On lowering the doses of

proteinase inhibitors, the enzyme activity was higher than those feeding on high

doses of proteinase inhibitors.

Telang et al. (2003) also conducted a feeding experiment to study the

effect of bitter gourd protease inhibitors on insect growth and development by

incorporation of four different doses of inhibitors in artificial diet (3, 6, 9 and 12

trypsin inhibitor units/g of feed). In the case of Spopdotera litura, larval mortality

ranged from 40 to 80 per cent of the total larval population. Reduction in pupal

weight by 30 per cent and 35 per cent pupal mortality were also observed with

the highest dose of BGPIs whereas in case of H. armigera, larvae fed on diet

containing the highest dose of BGPIs (12 trypsin inhibitor units/g) showed

mortality rate of about 80 per cent after 3 days of feeding as compared with

larvae fed on control diet. Highest larval mortality of 90 per cent was observed in

larvae fed on diet containing 15-trypsin inhibitor units/g of feed.

4.2.3.2 Feeding of Callosobruchus maculates adults

Storage of pulses over long periods, especially at small scale farming

levels is limited due to bruchids like Callosobruchus maculates. Their damage

causes loss of weight, nutritional value and viability of stored grains. For

evaluating the efficacy of rice bean protease inhibitors for these brucids, feeding

experiment was also conducted with Callosobruchus maculates. 25, 50, 75 and

100 per cent rice bean flour was blended in artificial diet for rearing C. maculates.

During early stages (upto 24 hrs) no larval mortlality was observed with 25 and

50 per cent rice bean flour whrereas 100 per cent mortality was observed after

48 hrs in the insects which had been fed with rice bean flour alone (Table 4.7).

The results obtained confirms with the other studies which revealed that

coconut(Cocos nucifera) was effective in controlling Zabrotes subfaciatus, a

Mexican bean weevil (Busungu And Mushobozy 1991).

92

92

Abdullahi and Muhammad (2004) showed that powdered sample of Piper

guineense had pronounced effects on the fecundity of C. maculatus where 83

per cent to 100 per cent mortality rates were observed in the treated samples.

These feeding experiments showed that apart from protease inhibition, ingestion

of potent rice bean PIs adversely affects the protein intake at the larval stage,

which caused developmental abnormalities and increased mortality of insect

larvae.

Table 4.7: Mortality (%) of Callosobruchus maculatus adults fed on rice bean flour

Percent Composition

of diet

Per cent Mortality after

24 hrs 48 hrs 72 hrs 96 hrs 120 hrs 140 hrs

25 0.0 0.0 20±0.15 60±0.40 80±0.32 100±0.46

50 0.0 40±0.47 60±0.11 60±0.30 100±0.34 100±0.0

75 20 ± 0.15 60±0.37 60±0.51 60±00 100±0.15 100

100 60 ± 0.25 100±0.35 100±0.23 100±00 100±00 100

Control 0.0 0.0 0.0 0.0 0.0 0.0

*Data is reported as means of ± SEM of three independent determinations

Gomes et al. (2005) studied the effect of trypsin inhibitor from Crotalaria

pallid seeds (CpaTI) on Callosobruchus maculatus (cowpea weevil) and Ceratitis

capitata (fruit fly). A feeding trial was conducted to assess the potential effects of

CpaTI on these two insects which were used as models. The inhibitor added to

the diet of these pests in artificial seeds was moderately effective against C.

maculatus and caused mortality to this bruchid (LD50: 2.1) and reduced the

mass of larvae (ED50: 3.2 per cent). In artificial diets fed to Ceratitis capitata, the

larvae were more affected in initial concentrations, causing 27 per cent mortality

and 44.4 per cent mass decrease. The effect of trypsin inhibitor of Crotalaria

pallid was lower as compared with Vigna umbellata trypsin inhibitor on

C.maculatus.

93

93

A trypsin inhibitor (ApTI) isolated from Adenanthera pavonina seeds

showed activity against papain (Macedo et al. 2002). The inhibition was highly

effective against digestive proteinases from C. maculatus, Acanthoscelides

obtectus (bean weevil) andZabrotes subfasciatus (Mexican bean weevil). In case

of C. maculates fed an artificial diet containing 0.25 per cent and 0.5 per cent

ApTI (w/w), the latter concentration caused 50 per cent mortality and reduced

larval weight gain by approximately 40 per cent. The action of ApTI on C.

maculatus larvae may involve the inhibition of ApTI-sensitive cysteine

proteinases and binding to chitin components of the peritrophic membrane (or

equivalent structures) in the weevil midgut.

4.2.4 Isolation of gene encoding protease inhibitor from rice bean.

In the course of millions of years of co-evolution, plants have evolved

some very effective counter measures to predatory insects. Even though many

different classes of plant proteins have shown some toxicity or antimetabolic

effect on insects, protease inhibitors as insect control proteins have proved to

enhance resistance in transgenic plants. Inhibitor genes of plant origin are

particularly promising as they are not likely to have problems in expression, when

inserted into other plant genomes. Moreover, plants PIs also have practical

advantages over the other genes in terms of optimal expression from their own

wound inducible or constitutive promoters (Boulter, 1993).

Serine protease inhibitors are generally low molecular weight proteins that

make complexes with proteases and reduce their proteoIytic activities of insects.

Over expression of these inhibitors with constitutive promoters has been shown

to confer protection to transgenic plants against lepidopteron and coleopteron

insect pests. Inhibitor genes of plantorigin are particularly promising for

development of insect resistant crop plant and it was first demonstrated by Hilder

et al. (1987) through transfer of trypsin inhibitor gene from Vigna unguiculata to

tobacco which conferred resistance to wide range of insect pests. Among serine

protease inhibitors trypsin protease inhibitors genes are primary genes which are

found to be excellent sources for engineering resistance into plants to develop

insect resistant crop plants.

94

94

In the present study, efforts were made to isolate genes encoding trypsin

protease inhibitors from rice bean and the results obtained have been presented

below:

4.3.1 Total RNA Isolation

Total RNA was isolated using Trizol method. The RNA concentration was

967.9 ng/µl and the integrity of isolated RNA was qualitatively checked by 1per

cent formaldehyde agarose gel electrophoresis. The sample was loaded in three

different lanes and presence of bands in gel confirmed the isolation of RNA from

rice bean leaves (Fig 4.9). Isolated total RNA was further used for cDNA

synthesis.

4.3.2 cDNA synthesis by RT-PCR

For cDNA synthesis, RT-PCR (reverse transcription-polymerase chain

reaction) was used. RNA was first reverse transcribed into cDNA using a reverse

transcriptase and the resulting cDNA was amplified in PCR using 26 S rRNA

primers of size 550 bp. Four sets of cDNA amplicons were prepared and loaded

in four different lanes of 1 per cent agarose gel. The size of amplified cDNA was

~550 bp corresponding to 26 S rRNA primer size (Fig 4.10). These cDNA

amplicons were used for further study.

4.3.3 PCR Amplification with degenerate primers

Different sets of PCR primers for amplification of trypsin protease inhibitor

gene were designed. The primers were selected from highly conserved regions

by using a simultaneous alignment tool through computer analysis with Clustal W

tool. Oligo calc software was used for checking self-dimers, melting temperature

and priming efficiency. Primer alignment specificity was checked using NCBI

blast. PCR was carried out for amplifying the coding gene of the trypsin protease

inhibitor from cDNA. The amplified PCR product was analyzed by conventional

electrophoresis using 1 per cent (w/v) agarose gels and ethidium bromide

staining agarose gel electrophoresis. The amplified product of size 200 bp was

obtained (Fig 4.11).

95

95

4.3.4 Elution of gel, ligation and Cloning of PCR product

The 200 bp amplicon of rice bean trypsin protease inhibitor was eluted

from preparative gel. pGEM -T easy vector was used as cloning vector for

cloning the amplified fragments. The recombinant molecules were transformed

into E. coli DH5α, using 5µl ligation mixture. Bacteria were allowed to recover

and express the antibiotic marker encoded by the plasmid. The transformed cells

were picked up and restreaked on Luria agar containing ampicillin and X-gal. The

clones containing recombinant molecules were selected by blue-white colony

assay. Recombinant plasmids in E. coli DH5α (white colonies) with trypsin PIs

gene were isolated. The white colonies were restreaked for maximum number of

transformants. The transformants selected were tested and confirmed by

amplification of the vector and inserted DNA by colony PCR.

4.3.5 Colony PCR

The Colony PCR was done to confirm the transformation and size of the

insert in the vector. The RBPI gene fragment was 200 bp which was confirmed

using 100bp DNA marker in 1 per cent agarose gel electrophoresis (Fig

4.12).Plasmid extraction was carried out for sequencing. The extracted plasmid

was quantified using nanodrop spectrophotometer which was 331.4 ng/µl

4.3.6 Partial Sequence of rice bean Trypsin protease Inhibitor Gene

The constructs pGEM-T easy vector containing rice bean trypsin protease

inhibitors were sequenced using M13 primers employing primer-walking

technique (Fig 4.13). The PCR product (plasmid) was cleaned thoroughly and the

sequencing was done AB Hitachi 3130 xl Genetic Analyser at Molecular Biology

lab, IHBT (CSIR) Palampur. The sequence obtained is presented below:

96

96

Lane 1, 2, 3: RNA isolated from rice bean leaves

Figure 4.9: Agarose gel electrophoresis of RNA isolated from rice bean leaves

M – 100bp DNA ladder; Lane 1 (L1): cDNA1; Lane 2 – cDNA2; Lane 3 – cDNA3; Lane 4 – cDNA4

Figure 4.10: Agarose gel electrophoresis of amplified cDNA formed from

RNA

RNA band

L 1 L2 L3

550bp

100

200

300 500

2000

1600

1200

1000

M W (bp)

M L1 L2 L3 L4

97

97

M – 100bp DNA ladder; L1 – primers F1R1; L2 – primers F1R2; L3 – primers

F1R5; L4 – primers F1R1; L5 – primers F1R2; L6 – primers F1R5

Figure 4.11: PCR amplification of cDNA with degenerate primers

Plate 4.1: Photograph showing blue-white recombinant colonies

200 bp

M L1 L2 L3 L4 L5 L6

100

200

300

800

1600

1000

500

2000

1200

M W (bp)

98

98

M – 100bp DNA ladder; L1 – L6 - Different transformed colonies

Figure 4.12: Agarose gel electrophoresis of plasmid harbouring DNA

isolated from rice bean trypsin protease inhibitor gene.

CAGCAGCTTTTAGGTGAACTATAGAATACTCAAGCTATGCATCCAACGCGTTGGGAGCTCTCCCATATGGTCGACCTGCAGGCGGCCGCGAATTCACTAGTGATT ATGATGGTGCTAAAGGTGTGTGTGTTGGTACTTTTCCTTGTAGGGGTTACTGCTGCTGGCATGGATCTGAAACACCTAAGAAGTGTTCATCATCATGACTCAAGCGATGAGCCTTCTGAGTCTTCAGAACCATGCTGTGATTTATGCCTCTGCACTAAATCAATACCTCCTCAGTGCCAACACTCAGCTTGCAAATCCTG

AATCGAATTCCCGCGGCCGCCATGGCGGCCGGGAGCATGCGACGTCGGGCCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGATCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTACAAATATTAACGCTTACATTTCCCTGATGCGTATTTTCTCTTACGCATCTGTGCCGTATTCACACGGCATCAAGGTGCACTTTTCCGGGGAATGTGCGCGAACCCCTATTGTTTATTTTCTAATAC

Figure 4.13: Partial sequence of the gene encoding trypsin protease

inhibitor of rice bean.

M L1 L2 L3 L4 L5 L6

200 bp

100

2000

1600

1200

1000

800

200

400

M W (bp)

Reverse Primer

Forward Primer

Partial sequence of trypsin inhibitor gene

of rice bean

Sequence of vector

used

Sequence of vector used

99

99

4.3.7 Sequence homology of rice bean trypsin protease inhibitor at Nucleotide and protein level

The sequence obtained were subjected for homology search at nucleotide

level and at protein level using BLASTn and BLASTx algorithms available at

http://www.ncbi.nlm.nih.gov.The BLASTn results showed that the cloned rice

bean trypsin protease inhibitor (RBPI) nucleotide sequence had 95 per cent

homology with Vigna radiata var. radiata (AY713305.2, e-value=4e-95) and

Vigna radiata var. sublobata (DQ412561.1, e-value=2e-93) proteinase inhibitor

mRNA and 93, 91 per cent with mRNA of Vigna triblobata and V. vexillata,

respectively (Fig. 4.14). The per cent homology and E value of the sequences of

the other Vigna varieties producing significant similar alignments to the sequence

of RBPIgene are given in Table 4.8. Comparative analysis of the nucleotide

sequences showed that cloned rice bean trypsin protease inhibitor gene had high

degree of homology (95 %) with the primary sequences of serine protease

inhibitor of Vigna species.

Figure 4.14: Colour key for alignment scores of known Vigna varieties

sequences with sequence obtained from rice bean trypsin protease inhibitor gene by nucleotide BLAST (BLASTn)

1

100

10

0

Table 4.8: Per cent homology and E value of the sequences of known Vigna varieties sequences producing significant similar alignments to the sequence of RBPIgene sequence

Accession Description Max score

Total score

Query coverage

E value

Max ident

AY713305.2 Vigna radiata var. radiata proteinase inhibitor mRNA, complete cds

356 356 100% 4e-95 95%

AY251011.2 Vigna radiata var. radiata mung bean inhibitor (MB) gene, complete cds

356 356 100% 4e-95 95%

DQ417203.1 Vigna radiata trypsin inhibitor gene, complete cds

356 356 100% 4e-95 95%

DQ412561.1 Vigna radiata var. sublobata trypsin inhibitor gene, complete cds

351 351 100% 2e-93 94%

HQ629949.1 Vigna mungo isolate BPI9337 serine protease inhibitor-like gene, complete sequence

345 345 100% 7e-92 93%

JN561786.1 Cicer arietinum cultivar Pusa 256 Bowman-Birk-type protease inhibitor mRNA, complete cds

342 342 100% 8e-91 93%

GU121097.1 Vigna radiata Bowman-Birk type protease inhibitor gene, complete cds

342 342 100% 8e-91 93%

DQ412560.1 Vigna trilobata trypsin inhibitor gene, complete cds

342 342 100% 8e-91 93%

DQ439979.1 Vigna vexillata trypsin inhibitor gene, complete cds

324 324 100% 2e-85 91%

AY204565.1 Vigna unguiculata subsp. sesquipedalis cultivar Gougouhong trypsin inhibitor (TI) gene, complete cds

315 315 100% 1e-82 91%

101

10

1

The BLASTx results with different known Vigna protein sequences

showed 88, 86 and 68 per cent homology with trypsin inhibitor protein sequence

of Vigna radiata (ABD85193.1, e-value= 1e-09), Vigna vexillata (ABD97866.1,e-

value = 2e-10) and Bowman-Birk-type protease inhibitor of Cicer arietinum

(AEW50186.1, e-value = 3e-10), respectively (Table 4.9). The results of BLASTx

for rice bean trypsin protease inhibitor ispresented in Figure 4.15.

Figure 4.15: Colour key for alignment scores of known Vigna varieties protein sequences with sequence obtained from rice bean trypsin protease

inhibitor gene by protein BLAST (BLASTx)

102

10

2

Table 4.9: Per cent homology and E value of the protein sequences of known Vigna varieties producing significant similar alignments to the sequence of RBPIgenes

Accession Description Max score

Total score

Query coverage

E value Max ident

ABD97866.1 Trypsin inhibitor [Vigna vexillata]

60.8 60.8 77% 2e-10 86%

ABD91575.1 Trypsin inhibitor [Vigna radiata var. sublobata]

60.5 60.5 77% 3e-10 67%

AEW50186.1 Bowman-Birk-type protease inhibitor [Cicer arietinum]

60.5 60.5 77% 3e-10 67%

ABD91574.1 Trypsin inhibitor [Vigna trilobata]

60.5 60.5 77% 3e-10 68%

ABD85193.1 [Vigna radiata var. radiata] proteinase inhibitor

58.5 58.5 77% 1e-09 88%

ADG29119.1 Bowman-Birk type protease inhibitor [Vigna radiata]

57.8 57.8 77% 2e-09 86%

AAO43982.1 Trypsin inhibitor [Vigna unguiculata subsp. sesquipedalis]

57.8 57.8 77% 3e-09 85%

AAT80340.1 Trypsin inhibitor [Vigna unguiculata]

54.7 54.7 77% 3e-08 83%

AAO43980.1 Trypsin inhibitor [Vigna unguiculata subsp. unguiculata]

54.7 54.7 77% 4e-08 83%

AAL23841.1 Trypsin inhibitor [Vigna unguiculata]

54.7 54.7 77% 4e-08 83%

S09415 Proteinase inhibitor –(Vigna unguiculata)

55.1 55.1 77% 4e-08 83%

103

10

3

This trypsin protease inhibitor genes isolated from rice bean (Vigna

umbellata) genotype BRS-2 showed high degree of sequence homology with

other trypsin inhibitors of Vigna species which are considered potent to several

lepidopteran insects.

A set of degenerate primers used to flank the partial sequence of RBPI

genewas used for the isolation of gene from RNA of rice bean leaves. About 200

bp amplicon was cloned into pGEM-T easy vector and partial sequence of the

gene was obtained. Shirani (2005) also observed similar results while cloning

and characterizing serine protease inhibitor from different legume species. About

250bp amplicon from soybean, 325 bp fragments from cowpea and yard long

bean were cloned into pTZ57R/T and transformants having recombinants were

isolated through blue-white colony assay. The clones pTZSBC3 of soybean, pTZ-

CpC1 of cowpea and pTZ-YLBC1 of yard long bean were sequenced which

yielded ORFs (654bp in SKTI 324bp in CpTI) as in original sequences in data

base.

Similarly, Hammond et al. (1984) constructed cDNA clones for soybean

protease inhibitors. To increase the probability of obtaining cDNA clones, they

isolated enriched fractions of the mRNAs by dimethyl sulfoxide sucrose

gradient centrifugation. These mRNAs were used to synthesize cDNAs ranging

in size from 250 to 500 nucleotides. The ds cDNA was ligated to synthetic EcoRI

linkers and ligated into pBR322. After transformation of E. coli HB101, several

hundred clones were screened with a ss cDNA probe prepared from the

enriched mRNA fraction. Several clones that hybridized to the probe were

further analyzed by mRNA hybrid-selected translation. Restriction enzyme

digestion of several selected clones with EcoRI revealed that the cDNA inserts

ranged from 300 to 400 nucleotides. Marchetti et al. (2000) also isolated and

cloned three serine protease inhibitors (KTi3 (651bp), C-II and PI-IV(both 252 bp

long) from soybean after amplifying the fragments with gene specific primers with

added restriction sites for different enzymes in linear phagemid pGEM-T

The partial sequence of trypsin protease inhibitorgenes from rice bean

showed 99 per cent homology with published sequences of trypsin inhibitor of

cowpea having 220 bp as coding sequence and as well as with Cicer arieuntum

104

10

4

trypsin proteinase inhibitor. Since most of the trypsin inhibitor from rice bean,

cowpea and other legumes such as mung bean belong to the same serine

protease familiy, extensive homology is observed among its members.

The results for comparative analysis and homologies of this study among

different Vigna species were in consonance with the findings of Lawrence et al.

(2001) who isolated a protease inhibitor gene from native cowpea (Vigna

unguiculata L.) cv. 130 from l-ZAP II genomic library. The nucleotide sequence of

this genomic clone shared 86 per cent homology with a cowpea trypsin inhibitor

IV mRNA and 81 per cent with Bowman- Birk protease inhibitor genes of

soybean. The isolated gene had TATA and CAT signals in the 5' upstream

region. The longest open reading frame had 504 bases, encoding 167 amino

acids from the predicted coding region. The active serine centers of this protein

was found between 105-158 amino acid residues, with a 69 amino acids long

signal peptide in its N terminal. Singh and Koundal (2008) also cloned full-length

protease inhibitor cDNA was cloned by rapid amplification of cDNA ends (RACE)

using RNA extracted from Lens culinaris immature seeds and primers designed

according to the conserved regions of legume protease inhibitors. The full-length

cDNA was 551 bp and contained a 309 bp open reading frame (ORF) „encoding

a protease inhibitor precursor of 102 amino acids.

Likewise, many trypsin PIs gene have been isolated from several plant

species and their expressions in many transgenic varieties have been studied.

Serine protease inhibitors represent the most well studied class of plant defense

proteins (Ryan 1990) and their role in plant defense was reported long back but

in the last few years, DNA sequences encoding different proteinase inhibitor

gene have been incorporated in the genome of different important plant, such as,

cereals, rapeseed, tobacco, potato and protective effect have been obtained in

some cases, mainly against phytonematodes and lepidopteranpest (Koiwa et al.

1997; Ussuf et al. 2001).