24-0514

7/22/2019 24-0514

1/93

um am oto U niversity R epository S ystem

Title Studies on COD removal using poly (vinyl alcohol)-

gel beads as biomass carrier in UASB reactor

A uthor(s) Do Phuong Khanh

C itation

Issue date 2012-03-23

Type Thesis or Dissertation

U R L http://hdl.handle.net/2298/24903

R ight

7/22/2019 24-0514

2/93

STUDIES ON COD REMOVAL USING POLY(VINYL ALCOHOL)-GEL

BEADS AS BIOMASS CARRIER IN UASB REACTOR

A Dissertation Submitted in Partial Requirement for the Graduation in Engineering

February, 2012

DO PHUONG KHANH

Graduate School of Science and Technology

KUMAMOTO UNIVERSITY

7/22/2019 24-0514

3/93

STUDIES ON COD REMOVAL USING POLY(VINYL ALCOHOL)-GEL

BEADS AS BIOMASS CARRIER IN UASB REACTOR

(PVA UASB COD)

A Dissertation Submitted in Partial Requirement for the Graduation in Engineering

Doctoral Dissertation

February, 2012

By

DO PHUONG KHANH

Supervisor

Prof. KENJI FURUKAWA

Department of New Frontier Sciences

Graduate School of Science and Technology

KUMAMOTO UNIVERSITY

7/22/2019 24-0514

4/93

i

Acknowledgement

I am appreciated to many people whose support, advice and encouragement allowed

me to complete this work.

Firstly, I would like to express my sincere and honest thanks to my supervisor, Prof.

Kenji Furukawa. His academic guidance, technical advice and incisive considerations

during my study deserve all my gratitude. Without his patient instruction, the completion

of this thesis and the publications would not have been possible.

Secondly, I am very thankful to Prof. Susumu Takio, Prof. Yoshito Kitazono and

Assoc. Prof. Takeshi Kitano for their help to check my dissertation.

I am extremely thankful to Dr. Lai Minh Quan, Dr. Zhang Wenjie, Dr. Daisuke Hira,

Dr. Qiao Sen, Dr. Xu Xiaochen, Dr. Ma Yongguang, Dr. Li Zhigang, Mr. Kazuya

Kamishima and Mr. Takahiro Sato for the direct support during my experiments. I have

learned from all of you. My thanks are also due to Ms. Murashima Kimiyo, who never

failed to give me great encouragement and suggestions. I express my appreciation to

Kuraray Corporation for providing me the polymer gel beads.

Im indebted to the Japanese students, Vietnamese students and Chinese students in

Prof. Furukawas lab. Specially, I deeply appreciate my tutors, Dr. Taichi Yamamoto and

Mr. Takehiko Shinohara; my elder brother and elder sister, Dr. Yang Jiachun and Dr.

Zhang Li; my young colleagues, Mr. Masashi Takekawa, Mr. Satoshi Ohta, Mr. Ryouta

Esaki, Mr. Yuuki Nakayama, Mr. Daisuke Yoshida; Dr. Liu Chengliang, Dr. Gao Yanning,

Dr. Sou Tyou Syun, Dr. Masako Sakai, Mr. Tran Thanh Liem, Ms. Phan Thi Hong Ngan,

Mr. Chen Cheng, Ms. Jiang Jing, Ms. Xu Shan, Ms. Wei Qiaoyan, Mr. Yuki Tomoshige

7/22/2019 24-0514

5/93

ii

and Dr. Keita Takagi for their kindness and friendships. Im very grateful to Ms. Seiko

Saito for giving me so much administration guidance and sharing the unforgettable

moments in Hanoi.

Im thankful to IJEP and GelK programs for giving me not only fundamental

academic knowledge and financial support, but also good friends. I have highly

appreciated all members of Meidensha Corporation (Stationed staff in Nagoya), who

have taught and helped me so much during my internship.

My gratitude also extends to Mr. & Mrs. Sakimoto, Mr. & Mrs. Harada, Ms. Midori

Noguchi, Mr. & Mrs. Akimoto, Ms. Mieko Ikeda, Ms. Megumi Yoshii and my closest

friends in Kumavina, who give me the second family. I would like to appreciate my

doctoral friends, Ms. Meshkatul Jannat, Ms. Nguyen Thi Ngoc, Ms. Liany Hendratta, Mr.

Lei Lu, Mr. Bingwei Tian, Mr. Tohirin Sukarno and Ms. Mahsa Saeidi, who always cheer

me up.

Special thanks to my all family members: Mom, Dad, Phuong Hanh and Duc Anh

for lots of spiritual support.

I wish to acknowledge all people, whom I might have not mentioned here and who

have either directly or indirectly give me their thoughtfulness and encouragement.

7/22/2019 24-0514

6/93

iii

List of contents

Abstract .. v

List of acronyms and abbreviations ....... vii

Lists of tables .. viii

List of figures .... ix

Chapter 1 Literature review ... 01

1.1Introduction . 01

1.1.1 Treatment of low-strength wastewater by UASB reactors 01

1.1.2 Application of PVA-gel carrier for wastewater treatment . 09

1.2Objectives of this study ... 12Chapter 2 Effect of temperature on UASB treatment of low-strength wastewater

using poly(vinyl alcohol)-gel carrier .. 17

2.1 Introduction . 17

2.2 Materials and methods . 18

2.2.1 Experimental setup ... 18

2.2.2 Synthetic medium . 19

2.2.3 Biomass carrier . 20

2.2.4 Analytical methods ... 20

2.3 Results . 21

2.3.1 UASB reactor performance .. 22

2.3.2 Effects of temperature decrease and extremely short HRTs . 25

2.3.3 Characteristics of attached growth ... 26

2.3.4 Archaeal community analysis ... 28

2.3.5 Post-treatment of UASB reactor effluent . 30

2.4 Discussion 31

2.5 Conclusions . 32

Chapter 3 Response of poly(vinyl alcohol)-gel and poly(ethylene glycol)-gel

biogranular sludges in two identical UASB reactors 37



3.2.1 Reactor setup 38

3.2.2 Substrates .. 39

7/22/2019 24-0514

7/93

iv

3.2.3 Biomass carrier . 39


3.3 Results and discussion . 40

3.3.1 Reactor performance . 40



Chapter 4 Substrate removal kinetics in a UASB reactor using poly(vinyl

alcohol)-gel carrier operated at 15oC ................................................................. 50




4.2.2 Synthetic influent .. 52

4.2.3 Seed sludge ... 52



4.3.1 Reactor performance . 53


4.3.3 Substrate removal kinetics in UASB reactor 56


Chapter 5 Post-treatment of UASB effluents by a swim-bed reactor . 66




5.2.2 Seed sludge ... 68

5.2.3 Biomass carrier . 685.2.4 Analytical methods ... 68


5.3.1 Reactor startup .. 69

5.3.2 COD removal performance .. 70


Chapter 6 Conclusions 75

Publications... 78

7/22/2019 24-0514

8/93

v

Abstract

Low-strength wastewater is identified with COD concentrations below 1000 mg/L.

Its main sources are cesspit leakage, septic tank, sewage treatment plant, industrial

process water, rainfall runoffs, agricultural drainage, etc. In many developing countries,

such wastewaters are large in quantity and discharged into water bodies without a

treatment process.

Over the past forty years, UASB reactor was introduced by Dr. Lettinga and his

coworkers in Netherlands. It has become one of the most popular anaerobic wastewater

treatment processes because of low energy demand, simple construction and high

removal efficiency. The application of UASB reactor for industrial wastewater treatment

indicated a number of reports on the treatment of high-strength wastewater and

medium-strength wastewater. A small fraction of published papers have discussed on the

treatment of low-strength wastewater, because such wastewater is poor in recoverable

materials, therefore treating them brings insignificant returns. It becomes crucial to treat

low-strength wastewater with less input of energy and other resources.

Sludge granulation is considered as the key success of UASB process. In our

experiments, PVA-gel beads were employed as a biomass carrier. This functional resin

has a reticulate structure that can trap and carry microorganisms. PVA-gel beads have

been employed as biomass carrier in hundreds of projects on industrial water treatment

systems in Japan. Recently, PVA gels have been applied for lab-scale anaerobic

bioreactors, including packed-bed, anammox and UASB. Zhang et al. (2009) carried out

his experiments with UASB reactor using PVA gels treating high-strength wastewater. In

my study, the treatment of low-strength wastewater by UASB reactor using PVA gel

beads has been discussed. This dissertation covered six following chapters:

Chapter 1 An overview of the studies on low-strength wastewater treatment by

UASB bioreactors and the application of poly(vinyl alcohol)-gel beads as biomass carrier

for anaerobic wastewater treatment.

Chapter 2 The performance of a UASB reactor treating low-strength wastewater

under mesophilic (35

o

C) to psychrophilic (15

o

C) conditions. The effect of temperature

7/22/2019 24-0514

9/93

vi

decrease on COD removal was evaluated. The operational strategy was keeping the stable

influent COD concentrations and accelerating HRT to below 1 hr. A stepwise increase of

organic loading rates was achieved, excluding the requirements for time and space of

experiments. The acceptable organic loading rates for treatment of low-strength

wastewater by UASB reactor were discussed.

Chapter 3 The role of the porous macrostructure of PVA granules in UASB reactor

was investigated. COD removal and the dominant microbial species in two identical

UASB reactors using PVA-gel carrier and poly(ethylene glycol) (PEG)-gel carrier for

treating low-strength wastewater were studied.

Chapter 4 The operation of a cylinder-shaped UASB reactor using PVA-gel carrier

at 15oC and under short HRTs. It was compared with the performance of a cuboid-shaped

UASB reactor as described in Chapter 2. The microbial population and substrate removal

kinetics for the cylinder-shaped UASB reactor was presented.

Chapter 5 The feasibility of applying a swim-bed reactor as post-treatment of

UASB effluents was investigated.

Chapter 6 Conclusion remarks and recommendation for future work.

7/22/2019 24-0514

10/93

vii

List of acronyms and abbreviations

AHR Anaerobic Hybrid Reactor

BF Biofringe

BOD5 5-day Biological Oxygen Demand

COD Chemical Oxygen Demand

GSS Gas Solid Separator

HRT Hydraulic Retention Time

OLR Organic Loading Rate

OTU Operational Taxonomic Unit

PCR Polymerase Chain Reaction

PVA Poly(vinyl alcohol)

PEG Poly(ethylene glycol)

SEM Scanning Electron Micrograph

SS Suspended Solids

TN Total Nitrogen

UASB Upflow Anaerobic Sludge Blanket

VFA Volatile Fatty Acids

VSS Volatile Suspended Solids

7/22/2019 24-0514

11/93

viii

List of Tables

Table Title

1-1 Classification of methanogenic bacteria (Whitman et al., 2001)

1-2 Five-year reports on COD removal using PVA bio-carriers (2005-2011)

2-1 Operational parameters

2-2 Performance of UASB reactor during Period I-III

2-3 Comparison of temperature coefficient ()for anaerobic treatments

2-4 Performance of lab-scale UASB reactors using PVA gel carrier

2-5 Archaeal communities of UASB sludge

2-6 BOD5, COD and TN concentrations in UASB effluents

3-1 Operational parameters of the two identical UASB reactors

3-2 Properties of the original PVA/PEG beads

3-3 Treatment performance of UASB reactors using PVA/PEG-gel carriers

3-4 Archaeal communities in UASBPVAand UASBPEGsludges

4-1 Operational parameters of 2.5 L-cylinder-shaped UASB reactor

4-2 Treatment performance of 2.5 L-cylinder-shaped UASB reactor

4-3 Treatment performance of UASB reactors using PVA-gel at 15oC

4-4 Archaeal communities in the granular sludge obtained from 2.5 L-UASB

4-5 Data for Grau second-order kinetic model for 2.5 L-UASB reactor

4-6 Comparison of kinetic parameters in the Grau second-order model

4-7 Data for modified Stover-Kincannon model for 2.5 L-UASB reactor

4-8 Comparison of kinetic parameters in the Stover-Kincannon model

5-1 Treatment performance of the swim-bed reactor

7/22/2019 24-0514

12/93

ix

List of Figures

Figure Title

1-1 Five-year reports (1999-2004) on the treatment of industrial wastewaters by

UASB reactors

1-2 Schematic diagram of a basic UASB reactor

1-3 Anaerobic conversion of organic substrates to methane

1-4 Schematic of the multi-layer model for anaerobic granulation

1-5 Kurarays wastewater treatment technology using PVA gel beads

2-1 Schematic diagram of UASB reactor (A); blank PVA beads (B); macrostructure of

blank PVA bead, scale bar 20 m (C); cultivated PVA beads (D)

2-2 Time courses of COD removal

2-3 COD concentrations at different sampling ports under loading rate of 17 kg-COD

m-3d-1(HRT 0.6 h)

2-4 Temperature dependence of COD removal rate

2-5 Scanning electron microscopic images of a matured PVA-gel beads

2-6 BOD5, COD and TN concentrations in UASB effluents under COD loading rates

of 5 to 40 kg-COD m-3d-1

3-1 Schematic of two identical 1L-cylinder-shaped UASB reactors

3-2 Time courses of COD removal by UASBPVAand UASBPEGreactors

3-3 SEM of the anaerobic sludge attached to a matured PVA bead

3-4 SEM of the macrostructure of an original PEG bead

3-5 SEM of the anaerobic sludge attached to a matured PEG bead

4-1 Schematic diagram of 2.5 L-cylinder-shaped UASB reactor

4-2 Time courses of COD removal by 2.5 L-cylinder-shaped UASB reactor

7/22/2019 24-0514

13/93

x

4-3 Grau second-order model application for 2.5 L-UASB reactor

4-4 Modified Stover-Kincannon model application for 2.5 L-UASB reactor

4-5 Comparison of the predicted and the actual COD concentrations from 2.5

L-cylinder-shaped UASB reactor operated at 15oC

5-1 Schematic diagram of 7.7 L-swim-bed reactor as the post treatment of UASB

effluents from 3.9 L-cuboid-shaped UASB reactor (A) and 2.5 L-cylinder-shaped

UASB reactor (B)

5-2 Cross-sectional schematic diagram of swim-bed reactor

5-3 Time course of total sludge attachment to the BF carrier

5-4 Time courses of COD removal by swim-bed reactor

5-5 Linear relation between COD removal rate and COD loading rate

5-6 The BF carrier with attached growth (day 50 and day 320)

5-7 Time courses of reactor SS concentration and linear upflow velocity

7/22/2019 24-0514

14/93

1

Chapter 1 Literature Review

1.1Introduction

Anaerobic biological wastewater treatment has been majorly collected much

attention by the researchers due to its sustainability. Many anaerobic bioreactor systems,

such as anaerobic filters (AF), anaerobic sequencing batch reactors (SBR), anaerobic

expanded bed reactors (EGSB) and anaerobic fluidized bed reactors (AFB) have been

introduced for the treatment of biodegradable wastewaters. Of these, upflow anaerobic

sludge blanket (UASB) technology was recently considered as the most popular method

in which organic materials can be removed under high loading rate (Habeeb et al., 2010).

Sludge granules are at the core of UASB technology (Lettinga et al., 1980; Van Haandel

et al., 1994). A sludge granule is an aggregate of microorganisms forming under a

constant upflow hydraulic regime. The sludge granules are multi-microbial

communities and none of the individual species is capable of degrading complex

organic matters (Lens et al., 1995; Yu et al., 2000). The operation of UASB reactor was

previously limited to the treatment of high-strength industrial wastewater (Alphenaar et

al., 1993; Arching et al., 1993; Hwang et al., 1991; Imai et al., 1997; Ke et al., 1996).

Recent studies have been practically indicated the feasibility of UASB reactors to treat

low-strength industrial and domestic wastewaters (Sankar Ganesh et al., 2007; Show et

al., 2004). This chapter attempts to review the application of UASB reactor in the

treatment of such wastewaters; besides, the development of granule-based UASB

reactors using poly(vinyl alcohol)-gel is briefly introduced.

1.1.1Low-strength wastewater treatment by UASB reactors

The UASB process has been developed by Dr. Gatze Lettinga in the late 1970's at

the WageningenUniversity, The Netherlands (Lettinga et al., 1980). The UASB reactor

is mainly classified as bioreactors, due toits biological treatment of wastewater. UASB

reactor is characterized by its low energy demand, simple construction and high removal

efficiency(Show et al., 2004).Sankar Ganesh et al. (2007), cited by Habeeb et al.

(2010) reported a survey to investigate the application of UASB reactor during

7/22/2019 24-0514

15/93

2

1999-2004. With numerous advances (sludge development, microbial manipulation,

reactor hydrology, upstream controls, combination with other reactors, etc.),

biodegradable wastewaters varying in strength have been treated efficiently with UASB

reactors as illustrated inFig. 1-1.

Fig. 1-1 Five-year reports (1999-2004) on the treatment of industrial wastewaters by

UASB reactors (Sankar Ganesh, 2007)

It indicates that a small fraction of reports focused on low-strength industrial

wastewaters. UASB process was regarded to suite for the treatment of high-strength

wastewaters, followed by medium-strength ones, but low-strength wastewaters pose

special challenge. Such wastewaters generally ensue from washing operations:

households generate such wastewaters as sewages, and industries do so as streams

resulting from washing of the machinery and the rest of the shop floor. Such wastewaters

are of low-strength but are large in quantity. It therefore becomes crucial that techniquesbe developed to treat such wastewaters with less input of energy.

The UASB system is mainly consisted of a tank, pump, and biogas collector system

as illustrated in Fig. 1-2A. Untreated wastewater is distributed at the bottom and fluid up

through the sludge blanket, where organic matters are digested, absorbed, and

metabolized into bacterial cell and produce biogas. The gas solid separator (GSS) was

designed at the top of the reactor (Fig. 1-2B).

7/22/2019 24-0514

16/93

3

Fig. 1-2 Schematic diagram of a basic UASB reactor:

UASB design (A), GSS design (B), GSS process (C), biodegradation in UASB

reactor (D) (Habeeb et al., 2010)

C D

BA

7/22/2019 24-0514

17/93

4

The main reason to provide UASB reactor with GSS was (i) to collect the discharged

biogas properly, (ii) to decrease the turbulence which is mainly resulted from gas arising

in bubbles, (iii) to reduce the solids content in effluent, and (iv) to reduce the sludge

particles washout by entrapping particles in sludge blanket or flocculating or settling the

particles. Fig. 1-2C shows how the separation device is working. The successful

treatment in UASB reactor is mainly attributed to the formation of anaerobic granular in

sludge bed where microbial communities plays the central role on digesting the substrates

to biogas. The biological digestion process is illustrated in Fig. 1-2D.

In the UASB granules, different groups of bacteria carry out sequential metabolic

processes. Various theories have been explained the activity and performance of

microbial communities inside UASB (Liu et al., 2003). An overall scheme for anaerobic

conversions of organic substrates to methane is indicated in Fig. 1-3. During anaerobic

degradation of particulate organic materials, particulate biopolymers (carbohydrates,

proteins and lipids) are firstly hydrolyzed to organic monomers, which can be utilized as

substrates by fermentative organisms (amino acids, sugars) or by anaerobic oxidizers

(fatty acids). The carbonic products from these reactions are either acetate (CH3COOH)

and hydrogen or intermediate compounds, such as propionate and butyrate, which may

later be converted to acetate or hydrogen (H2). Methane (CH4) is mostly produced from

acetate or hydrogen and carbon dioxide (CO2).

UASB microbial communities can be classified into two domains, Bacteria and

Archaea. Stable anaerobic digestion is accomplished by representatives of four major

metabolic groups: hydrolytic-fermentative bacteria, proton-reducing acetogenic bacteria,

acetotrophic methanogens and hydrogenotrophic methanogens. Acetotrophic and

hydrogenotrophic methanogens are essential for the last step of methanogenesis.

The acetotrophic methanogens are obligate Archaea anaerobes, which convert

acetate to methane and carbon dioxide (CH3COOHCH4 + CO2). The activity of the

acetotrophic methanogens are of paramount importance during anaerobic conversion of

acetate. In earlier work,MethanosarcinaandMethanosaetaspecies were found to be the

dominant methanogens in a variety of UASB reactors. In other methanogenic reactions,

hydrogen is used as an electron acceptor to form methane by hydrogennotrophic

methanogens (4H2 + CO2CH4 + 2H2O), while many H2-using methanogens can also

7/22/2019 24-0514

18/93

5

use formate as an electron donor for the reduction of CO2to CH4(4HCOOH CH4+

3CO2+ 2H2O).

Complex organic substrates

Particulate organic matter Carbohydrates Proteins Lipids

Monomers

Amino acids Fatty acids Sugars Alcohols

Intermediary products

Acetate Propionate Ethanol Lactate

Methanogenesis

Methane (CH4)+

Carbon dioxide (CO2)

Fig. 1-3 Anaerobic conversion of organic substrates to methane

The hydrogen partial pressure is an important parameter, which defines process

stability or upsets in an anaerobic digestion process. Hence, the occurrence of the

hydrogenotrophic methanogens is crucial for an efficient process performance (Demirel

et al., 2008). Table 1-1 shows the outline of methanogenic bacteria classification

Hydrolysis

Acidogenesis

Acetogenesis

Reductive homoacetogenesis

Acetate

(CH3COOH)H2, CO2

Homoacetogenic oxidation

Reductive homoacetogenesis

Hydrolytic bacteria

Fermentative acidogenic bacteria

Acetogenic bacteria

Acetotrophic methanogens Hydrogenotrophic methanogens

7/22/2019 24-0514

19/93

6

(Whitman et al., 2001). So far, 28 genera of methanogens have been described. The

majority of rod-shaped methanogens are affiliated to the order Methanobacteriales,

which consists of three mesophilic genera (Methanobacterium,Methanobrevibacterand

Methanosphaera) and two thermophilic or hyperthermophilic genera

(MethanothermobacterandMethanothermus).

Table 1-1 Classification of methanogenic bacteria (Whitman et al., 2001)

Class I. Methanobacteria (known to grow on H2/CO2and formate as carbon source)

Order I. Methanobacteriales

Family I. Methanobacteriaceae

Genus I. Methanobacterium

Genus II. Methanobrevibacter

Genus III. MethanosphaeraGenus IV. Methanothermobacter

Family II. Methanothermaceae

Genus I. Methanothermus

Class II. Methanococci (known to grow on H2/CO2and formate as carbon source)

Order I. Methanococcales

Family I. Methanococcaceae

Genus I. Methanococcus

Genus II. Methanothermococcus

Family II. Methanocaldococcaceae

Genus I. Methanocaldococcus

Genus II. Methanotorris

Class III. Methanomicrobia

Order I. Methanomicrobiales (known to be hydrogenotrophic)

Family I. Methanomicrobiaceae

Genus I. Methanomicrobium

Genus II. Methanoculleus

Genus III. Methanofollis

Genus IV. Methanogenium

Genus V. Methanolacinia

Genus VI. Methanoplanus

Family II. Methanocorpusculaceae

Genus I. Methanocorpusculum

Family III. Methanospirillaceae

Genus I. Methanospirillum

Order II. Methanosarcinales (known to be acetotrophic and methylotrophic)Family I. Methanosearcinaceae

Genus I. Methanosarcina

Genus II. Methanococcoides

Genus III. Methanohalobium

Genus IV. Methanohalophilus

Genus V. Methanolobus

Genus VI. Methanomethylovorans

Genus VII. Methanomicrococcus

Genus VIII. Methanosalsum

Family II. Methanosaetaceae

Genus I. Methanosaeta

(Genus: related to the laboratory-scale work in Chapter 2, 3, 4)

7/22/2019 24-0514

20/93

7

All methanogens grow on a H2/CO2gas mixture. Many of them utilize formate and

some grow on other simple alcohols. The anaerobic digester is a compatible surrounding

for the growth of mesophilic methanogens andMethanobacteriumstrains, which play an

important role in the anaerobic degradation of organic compounds as the terminal

metabolic groups (Hobson & Shaw, 1973).

Many mechanisms and models for anaerobic granulation are currently available in

the literature. Based on the microscopic observation, a layered structure of UASB

granules (Fig. 1-4) was initially proposed by MacLeod et al. (1990) and Guiot et al.

(1992), also supported by a numbers of works (Arcand et al., 1994; Lens et al., 1995; Liu

et al., 2003). Recent research by Sekiguchi et al. (1998) showed that UASB granules have

a center which might be formed as a result of the accumulation of metabolically inactive,

decaying biomass and inorganic materials. Tay et al. (2000) proposed a theory for the

molecular mechanism of sludge granulation. The overall granulation starts from

dehydration of bacterial surfaces, and followed by embryonic granule formation, granule

maturation and post maturation. This theory provides useful information for

understanding how anaerobic granules form in a molecular level, but it is most likely that

this theory does not account for those operational conditions associated metabolic

changes of microorganisms, which would highly contribute to the formation of UASB

granules.

Fig. 1-4 Schematic of the multi-layer model for anaerobic granulation

(Hulshoff Pol, 2004)

CH4, CO2

CH3COOH

VFA

7/22/2019 24-0514

21/93

8

The start-up and operation of UASB reactor is involved the adjustment of pH of

influent, initial sludge amount, hydraulic retention time (HRT), organic loading rate

(OLR), upflow velocity and temperature of treatment. The start-up period is continuing

until reaching steady-state operation, which is recognized by the changes in removal

efficiency below 10%.

Temperature is a significant variable where it enhances microorganisms to produce

methane from digestion organic matters. An investigation for the influence of the

temperature on the UASB performance included operation of two UASB reactors in the

same HRT of 7 days and OLRs of 10.74 kg COD m-3d-1but different temperatures of

treatment (mesophilic temperature of 37oC vs. thermophilic temperature at 55oC). Where

the temperature was increasing from 37 to 43oC, removal efficiency increment was

observed, consequently it had been concluded that the optimum range is the mesophilic

temperature up to 37oC and less than 43oC (Choorit et al., 2007). Furthermore,

temperature shock is of considerable phenomena. It usually occurs in seasonal countries

due to their temperatures varieties during the day. The influence of temperature shock has

been studied by Hwang et al. (1991) and Ke et al. (1996). The authors reported that as a

result of decreased the temperature by 15oC for 48h, a reduction in biogas production of

60% and was observed. The partial recovery of gas production took 5 days to reach 80%

of original level whereas the full recovery has been achieved after 30 days.

HRT is considered as the key operating parameter where its effectiveness is mainly

controlling the performance of UASB reactors. Many authors are in agreement by

considering HRTs of 8 hr is the optimum. The very long HRTs (over 10 hr) are affecting

adversely on the process of sludge granulation with a little removal efficiency increment

was obtained. The very short HRTs (under 1 hr) can be disadvantageous due to its

negative role of biomass washout (Alphenaar et al., 1993; Van Haandel et al., 1994; Yu et

al., 2000).

The pH value is also affected the UASB performance. The pH of influent has been

limited by Van Haandel & Lettinga (1994) between the ranges of 6.3 to 7.8. The change in

pH of treatment is an important factor for the UASB reactor stability. Some of

experiments have been conducted to illustrate the behavior of UASB system towards a

change in the substrate pH (Borja & Banks, 1995). Lowering the pH value from 6.8 to 6.6

7/22/2019 24-0514

22/93

9

by injecting HCl, gas production increased 40% as well as the concentration of CO2.

Where NaOH was added to raise the pH up to 7.4, an increment of biogas generation was

observed with decreasing in CO2production.

Recently, modifications of UASB have been conducted in order to expand the use of

system and to increase its purpose. Some of suggested ideas have been practically

implemented. Lettinga et al. (1980) has been recommended adding natural ionic acids to

treatment of a very strong wastewater in order to enhance the digestion process.

Subsequently, it has been implemented by Leal et al. (2006) using additive hydrolytic

enzyme to remove oil and grease in treating dairy effluents. Yu et al. (2000) and Tiwari et

al. (2005) reported the possibilities of adding natural or artificial materials to increase the

sludge granule size and enhance the digestion of UASB reactor. One major drawback of

the UASB reactor is its long start-up period, which generally requires 2-8 months for the

development of anaerobic granular sludge (Liu et al., 2003). In order to reduce the

space-time requirements of UASB bioreactors towards a cheaper treatment, strategies for

expediting granular formation are highly desirable.

1.1.2 Application of PVA-gel carrier for wastewater treatment

The inert nuclei model for anaerobic granulation was initially proposed by Lettinga

et al. (1980). In the presence of inert micro-particles in an UASB reactor, anaerobic

bacteria could attach to the particle surfaces to form the initial biofilms, namely

embryonic granules. The mature granules can be further developed through the growth of

these attached bacteria under given operational conditions. The inert nuclei model was

supported by experimental evidences that addition of water absorbing polymer particles

were used to promote the formation of anaerobic granules (Imai et al., 1997).

Biomass entrapment within various hydrogels is among the progressive approaches

for the creation of enhanced granulation. Many gel matrices have been proposed as

possible carriers. Either natural biopolymers (polysaccharides such as alginate, agar,

carrageenan, etc. or proteins such as gelatin, collagen and others) or synthetic polymers

(polyvinyl alcohol, polyethers, polyacrylates, polyurethanes) can be used. These

polymeric materials were first described at the beginning of 1970s. In recent years,

poly(vinyl alcohol) (PVA)-gel which is an inexpensive and non-toxic synthetic polymer

7/22/2019 24-0514

23/93

10

has been widely used for immobilization of bioactive materials (Cao et al., 2002, Chen et

al., 1998; Lozinsky et al., 1998; Quan et al., 2009; Zhang et al., 2007). Because PVA-gel

possesses many attractive properties (i.e. hydrophilicity, reactivity, film formation,

resistance to oxidation), it is a potential biomass carrier that can be applied in the

fermentation industry, medicine, food, chemistry and the ecological engineering (Bai et

al., 2010). Table 1-2 shows the recent laboratory-scale work on removal of COD from

wastewaters using PVA-based biomass carriers.

Table 1-2 Five-year reports on COD removal using PVA-gel carriers (2005-2011)

Carrier Reactor Operationaltime (days)

Substrate,Temperature (

oC)

HRT(h)

Reference

PVA entrapment Cinder filtration4 days per

batch

Oil-field

wastewater, 3096 Li (2005)

PVA beadsAnaerobic fluidized

bed (AFB)

120 Corn steep liquor,

3510

Zhang

(2009)

PVA-calcium

alginate pellets

Membrane

bioreactor (MBR)

330 Reactive Black 5

dye, 20 24

You

(2010)

PVA beads UASB90 Ethylene glycol,

358

Zhang

(2011)

In the present work, PVA-gel beads were supplied by Kuraray Corporation, from

which it was first industrialized in the world. This is a small white spherical

bacteria-fixed carrier made from PVA resin. With an extremely fine net-like structure,

each sphere with diameter of 4 mm and specific gravity of 1.025 can sustain one billion

microorganisms. PVA gel is design to treat industrial and domestic wastewater through

bacterial activities. Fig. 1-5 shows the biological wastewater treatment system using

PVA-gel beads. Because it enables the use of smaller facilities and more efficient

processing than the conventional activated sludge method, this process is being adopted

in household septic tanks, factory wastewater facilities and sewage processing plants.

Removal efficiencies of biological oxygen demand (BOD5), chemical oxygen demand

(COD) and total nitrogen (TN) obtained from treatment of industrial wastewater

7/22/2019 24-0514

24/93

11

containing 600 mg BOD L-1, 200 mg COD L-1and 600 mg TN L-1is 99, 90 and 98%,

respectively. PVA-gel carrier has been selected for hundreds of industrial-scale water

treatment systems (Kuraray Corporation). It has also been applied for lab-scale anaerobic

bioreactors, including packed-bed reactor (Rouse et al., 2005), anammox reactor (Tran et

al., 2006; Quan et al., 2010; Li et al., 2011) and UASB reactor (Zhang et al., 2008; Khanh

et al., 2011). Quan et al. (2010) conducted an anammox reactor using modified PVA-gel

carrier with immobilization technique. Other authors used the original Kurarays PVA-gel

beads. Zhang et al. (2008-2011) carried out his experiments with UASB reactor using

PVA carrier treating high-strength wastewaters. The treatment of low-strength

wastewater is crucial in many developing countries, such as Vietnam, etc., thus, my study

focus on the UASB reactor using PVA-gel carrier treating low-strength wastewater.

Fig. 1-5 Kurarays wastewater treatment technology using PVA gel beads.

(Kuraray Annual Report, 2007)

7/22/2019 24-0514

25/93

12

1.2 Objectives of this study

COD reduction is one of the most common factors for validation of any wastewater

treatment facility. The aim of this study was to investigate COD removal fromlow-strength wastewater with application of UASB reactors using PVA-gel beads. The

more specific objectives of the research included:

1. Establishing a UASB reactor treating low-strength wastewater under mesophilic

to psychrophilic conditions. The effect of temperature decrease on COD

reduction will be studied; besides, the acceptable organic loadings for

low-strength wastewater treatment by UASB reactor will also be investigated

under the decrease of hydraulic retention time. (Chapter 2);

2. Realizing the role of porous structure of PVA granules in UASB reactors. COD

removal performance and the dominant microbial species in two identical

bioreactors using PVA and poly(ethylene glycol)-gel carriers will be studied

(Chapter 3);

3. Studying the diversity and dynamics of microbial communities in two lab-scale

UASB bioreactors treating low-strength wastewater (Chapter 4);

4. Investigating the feasibility of applying a swim-bed reactor as post-treatment of

UASB effluents (Chapter 5).

References

Alphenaar, P.A., Visser, A., Lettinga, G. (1993): The effect of liquid upward velocity and

hydraulic retention time on granulation in UASB reactors treating wastewater with a

high sulphate content, Bioresource Technology, 3, 960968.

Arcand, Y., Guiot, S.R., Desrochers, M., Chavarie, C. (1994): Impact of the reactor

hydrodynamics and organic loading on the size and activity of anaerobic granules,

Chemical Engineering Journal and Biochemical Engineering Journal, 56, 2335.

Arching, B.K., Schmidt, J.E., Winther-Nielsen, M., Macario, A.J.L., de Macario, E.C.

(1993): Effect of medium composition and sludge removal on the production,

composition and architecture of thermophilic (55o

C) acetate-utilizing granules from

7/22/2019 24-0514

26/93

13

an upflow anaerobic sludge blanket reactor, Applied and Environmental

Microbiology, 59, 25382545.

Bai, X., Ye, Z.F., Li, Y.F., Zhou, L.C., Yang, L.Q. (2010): Preparation of crosslinkedmacroporous PVA foam carrier for immobilization of microorganisms, Process

Biochemistry, 45, 6065.

Borja, R., Banks, C.J. (1995): Response of an anaerobic fluidized bed reactor treating

ice-cream wastewater to organic, hydraulic, temperature and pH shocks, Journal of

Biotechnology, 39(3), 251259.

Cao, G.M., Zhao, Q.X., Sun, X.B., Zhang, T. (2002): Characterization of nitrifying and

denitrifying bacteria coimmobilized in PVA and kinetics model of biological

nitrogen removal by coimmobilized cells, Enzyme and Microbial Technology, 30,

4955.

Chen, K.C., Lee, S.C., Chin, S.C., Houng, J.Y. (1998): Simultaneous carbon-nitrogen

removal in wastewater using phosphorylated PVA-immobilized microorganisms,

Enzyme and Microbial Technology, 23, 311320.

Choorit, W., Wisarnwan, P. (2007): Effect of temperature on the anaerobic digestion of

palm oil mill effluent, Journal of Biotechnology Research, 10 (3), 376385.

Demirel, B., Scherer, P. (2008): The roles of acetotrophic and hydrogenotrophic

methanogens during anaerobic conversion of biomass to methane: a review,

Reviews in Environmental Science and Biotechnology, 7, 173190.

Guiot, S.R., Pauss, A., Costerton, J.W. (1992): A structured model of the anaerobic

granules consortium, Water Science and Technology, 25, 110.

Habeeb, S.A., Aziz Bin Abdul Latiff, A.B., Zulkifli B.A. (2010): A review on Properties

of the digestion process in the upflow anaerobic sludge blanket (UASB) reactor.

Canadian Journal on Environmental, Construction and Civil Engineering, 1 (3),

5870.

Hobson, P.N., Shaw, B.G. (1973): The bacterial population of piggery-waste anaerobic

digesters, Water Research, 8, 507516.

7/22/2019 24-0514

27/93

14

Hulshoff Pol, L.W., de Castro Lopes, S.I., Lettinga, G., Lens, P.N.L. (2004): Anaerobic

sludge granulation, Water Research, 38, 13761389.

Hwang, P.C., Cheng, S.S. (1991): Treatment of p-cresol with a recirculating UASBreactor using the concept of kinetic control, Water Science and Technology, 24,

133140.

Imai, T. (1997): Advanced start-up of UASB reactors by adding of water absorbing

polymer, Water Science and Technology, 36, 399406.

Ke, S.Z., Shi, Z., Zhang, T., Fang, H.H. (1996): Degradation of phenol in wastewater in

an upflow anaerobic sludge blanket reactor, Water Research, 30(6), 13531360.

Khanh, D.P., Quan, L.M., Zhang, W., Hira D., Furukawa, K. (2011): Effect of

temperature on low-strength wastewater treatment by UASB reactor using

poly(vinyl alcohol)-gel carrier, Bioresource Technology, 102,1114711154.

Kuraray Annual Report (FY2007) www.kuraray.co.jp/ir/library/pdf/annual/ar2007.pdf

Leal, M.C.M.R., Freire, D.M.G., Cammarota, M.C., Sant Anna Jr. G.L. (2006): Effect of

enzymatic hydrolysis on anaerobic treatment of dairy wastewater, Process

Biochemistry, 41(5), 11731178.

Lens, P., de Beer D., Cronenberg, C., Ottengraf, S., Verstraete, W. (1995): The use of

microsensors to determine distributions in UASB aggregates, Water Science and

Technology, 31, 273280.

Lettinga, G., Velsen, A.F.M., Hobma, S.W., Zeeuw, W., Klapwijk, A. (1980): Use of the

upflow sludge blanket reactor concept for biological wastewater treatment,

Biotechnology and Bioengineering, 22(4), 699734.

Li, Q., Kang, C., Zhang, C. (2005): Wastewater produced from an oilfield and

continuous treatment with an oil-degrading bacterium, Process Biochemistry, 40,

873877.

Li, Z.G., Hira, D., Fujii, T., Furukawa, K. (2011): Treatment capability and microbial

community of anammox process using PVA gel beads as biomass carriers,

Japanese Journal of Water Treatment Biology, 47(4), 137145.

7/22/2019 24-0514

28/93

15

Liu, Y., Xu, H.L., Yang, S.F., Tay, J.H. (2003): Mechanisms and models for anaerobic

granulation in UASB reactor, Water Research, 37 (3), 661673.

Lozinsky, V.I., Plieva, F.M. (1998): Poly(vinyl alcohol) cryogels employed as matricesfor cell immobilization: 3. Overview of recent research and developments, Enzyme

and Microbial Technology, 23, 227242.

MacLeod, F.A., Guiot, S.R., Costerton, J.W. (1990): Layered structure of bacterial

aggregates produced in an upflow anaerobic sludge bed and filter reactor, Applied

and Environmental Microbiology, 56, 15981607.

Quan, L.M., Khanh, D.P., Hira, D., Fujii, T., Furukawa, K. (2011): Reject water

treatment by improvement of whole cell anammox entrapment using polyvinyl

alcohol/alginate gel, Biodegradation, 22, 11551167.

Sankar Ganesh, P., Ramasamy, E.V., Gajalakshmi, S., Sanjeevi, R., Abbasi, S.A. (2007):

Studies on treatment of low-strength effluents by UASB reactor and its application

to dairy industry wash waters, Indian Journal of Biotechnology, 6, 234238.

Sekiguchi, Y., Kamagata, Y., Syutsubo, K., Ohashi, A., Harada, H., Nakamura, K.

(1998): Diversity of mesophilic and thermophilic granular sludge determined by

16S rRNA gene analysis, Microbiology, 22, 26552665.

Show, K.Y., Wang, Y., Foong, S.F., Tay, J.H. (2004): Accelerated start-up and enhanced

granulation in upflow anaerobic sludge blanket reactors, Water Research, 38,

22932304.

Rouse, J.D., Fujii, T., Sugino, H., Tran, H., Furukawa, K. (2005): PVA-gel beads as a

biomass carrier for anaerobic oxidation of anmmonium in a packed-bed reactor, In:Proceedings of 5th International Exhibition and Conference on Environmental

Technology, Heleco05, Athens, Greece, 19.

Tay, J.H., Xu, H.L., Teo, K.C. (2000): Molecular mechanism of granulation. I: H+

translocation-dehydration theory, Environmental Engineering, 126, 403410.

Tiwari, M.K., Guha, S., Harendranath, C.S., Tripathi, S. (2005): Enhanced granulation

by natural ionic polymer additives in UASB reactor treating low-strength

7/22/2019 24-0514

29/93

16

wastewater, Water Research, 40(7), 38013810.

Tran, T.T.H., Luong, N.K., Liu, Z.J., Fujii, T., Rouse, J.D., Furukawa, K. (2006):

Nitrogen removal by immobilized anammox sludge using PVA gel as biocarrier,Japanese Journal of Water Treatment Biology, 42(3), 139149.

Van Haandel, A., Kato, M.T., Cavalcanti, P.F.F., Florencio, L. (2006): Anaerobic reactor

design concepts for the treatment of domestic wastewater, Environmental Science

and Bioechnology, 5, 2138.

Van Haandel, A.C., Lettinga, G. (1994): Anaerobic sewage treatment: A practical guide

for regions with a hot climate, John Wiley & Sons, New York.

Whitman, W.B., Boone, D.R., Koga, Y., Keswani, J. (2001): Taxonomy of methanogenic

Archaea, In: Boone DR, Castenholz RW, Garrity GM (eds), Bergeys manual of

systematic bacteriology, vol 1. Springer, 211294.

Yu, J.H., Chen, M.J., Yue, P.L. (2000): Distribution and change of microbial activity in

combined UASB and AFB reactors for wastewater treatment, Bioprocess and

Biosystems Engineering, 22(4), 315322.

Zhang, L.S., Wu, W.Z., Wang, J.L. (2007): Immobilization of activated sludge using

improved polyvinyl alcohol (PVA) gel, Journal of Environmental Sciences, 19,

12931297.

Zhang, W., Wang, D., Koga, Y., Yamamoto, T., Zhang, L., Furukawa, K. (2008): PVA

gel beads enhance granule formation in a UASB reactor, Bioresource Technology,

99, 84008405.

Zhang, W., Xie, Q., Rouse, J.D., Qiao, S., Furukawa, K. (2009): Treatment of

high-strength corn steep liquor using cultivated polyvinyl alcohol gel beads in

anaerobic fluidized-bed reactor, Bioscience and Bioengineering, 107(1), 4953.

Zhang, W., Zhang, X., Wang, D., Koga, Y., Rouse, J.D., Furukawa, K. (2011): Trace

elements enhance biofilm formation in UASB reactor for solo simple molecule

wastewater treatment, Bioresource and Technology, 102, 92969299.

7/22/2019 24-0514

30/93

17

Chapter 2 Effect of temperature on UASB treatment of

low-strength wastewater using poly(vinyl alcohol)-gel carrier

2.1Introduction

COD reduction is one of the most common factors for validation of any facility that

has to comply with wastewater treatment regulations. Failure to deal appropriately with

COD reduction can result in non-compliance fines. UASB reactor is among the most

popular anaerobic treatment process in which organic matter is digested, absorbed, and

metabolized into bacterial cell mass and biogas, thus COD reduction can be successfully

achieved (Seghezzo et al., 1998; Tchobanoglous et al., 2003). PVA, which is a readily

available low-cost polymeric gel, has previously been shown to be an effective biomass

carrier in UASB reactors treating high-COD-containing wastewater (Zhang et al., 2008a

and 2008b). Further experiments were therefore conducted to evaluate the feasibility of

using UASB reactors for low-COD-containing wastewater treatment. It is widely known

that low-COD-containing wastewater [

7/22/2019 24-0514

31/93

18

2.2Materials and methods

2.2.1 Experimental setup

Fig. 2-1 Schematic diagram of 3.9L-cuboid-shaped UASB reactor (A),

blank PVA-gel beads (B), macrostructure of a PVA-gel bead, scale bar 20 m (C),

cultivated PVA-gel beads (D)

The laboratory-scale UASB reactor constructed in cuboid shape was made of

Plexiglas with a total volume of 3.9 L (60x60x110 mm).The reactor had six sampling

ports and a peristaltic pump was used to maintain the fluidity of the sludge bed (Fig.

2-1A). The influent was injected at the bottom-end of the reactor with a stepwise increase

in flow rates. Table 2-1 shows the strategy for operating UASB reactor under short

hydraulic retention times. HRTs less than 2h and 1h were applied, involving with high

A

Recycle port

PVA gelcarrier

P

Gas-solidseparator

Influent

Gascoll

ection

NaCl

solution

SP-1

SP-2

SP-3

SP-4

SP-5

Effluent port

P

Water bath

7/22/2019 24-0514

32/93

19

organic loading rates. In comparison with HRTs of 6h and more in conventional UASB,

these HRTs was short, allows savings in time for treatment process. The treatment

temperature was decreased allows to save input of energy supplied for the reactor. The

treatment of low-strength wastewater is preferably carried out at ambient temperature.

The reactor temperature was referred to the mean annual temperatures in

moderate-climate and tropical-climate countries. Depending on the geographical location,

mean annual temperatures of wastewater have been reported in the range 327C in the

United States and from 30 to 35C for countries in Africa and the Middle East

(Tchobanoglous et al., 2003).

Table 2-1 Operational parameters

HRT

(h)

Flow rate

(L h-1)

Upflow velocity

(m h-1)

Loading rate

(kg-COD m-3 d-1)

Time (days)

Period I

(35oC)

Period II

(25oC)

Period III

(15oC)

2.00 2.0 0.9 5.05.3 017

1.56 2.5 1.1 6.46.6 1727 7095 190205

0.87 4.5 1.7 11.512.0 2733 95110 205224

0.60 6.5 2.2 17.017.5 3339 110130 224240

0.49 8.0 2.6 21.022.0 3945 130150 240265

0.39 10 3.2 26.027.5 4553 150180 265270

0.33 12 3.8 27.531.5 5356 180185 270275

0.28 14 4.3 36.437.1 5661 185190 275278

0.25 16 4.9 39.139.7 6567

0.23 17 5.1 42.544.5 6769

0.22 18 5.4 46.047.5 6970

2.2.2 Synthetic medium

The influent containing COD concentrations of 430 20 mg L1was prepared by

diluting concentrated synthetic wastewater composed of bonito extract (40 g L1),

peptone (60 g L

1

), NaHCO3(80 g L

1

), NaCl (10 g L

1

), KCl (2.8 g L

1

), CaCl22H2O

7/22/2019 24-0514

33/93

20

(2.8 g L1), and MgSO47H2O (2.0 g L

1). Influent pH was approximately 7.1-7.3. The

5-day soluble biochemical oxygen demand (BOD5) was about 65% of the soluble COD.

2.2.3 Biomass carrier

The original PVA-gel beads (4-mm diameter) were supplied by the Kuraray Co., Ltd

(Osaka, Japan) (Figs. 2-1B, 1C). The cultivated PVA-gel beads originated from a

previously studied anaerobic fluidizing reactor. The volume of bio-carrier was 0.8 L.

These beads were black when transferred to the UASB reactor (Fig. 2-1D) and had an

average settling velocity of 177 m h1. The settling velocities of the PVA gel were

determined in quiescent water in a 2-L graduated cylinder (height 42 cm).

2.2.4 Analytical methods

Effluent filtered through a 1.0-m membrane filter was used for analysis of soluble

components. Soluble COD concentrations were measured by the closed reflux

colorimetric method (APHA, 1995). The evolved gas was collected through a gassolid

separator and the volume was measured using an inverted cylinder containing tap water

with the pH lowered to 3.0 using 1N H2SO4. Methane analyses were performed using a

GC-14B gas chromatograph (Shimadzu, Kyoto, Japan). Determination of BOD5 was

carried out using the dilution method and total nitrogen (TN) concentration was measured

using the persulfate digestion-UV spectrophotometric method and Standard Methods

(APHA, 1995).

Scanning electron microscopic observations of the PVA-gel structure were

conducted as follows: a PVA-gel bead was cut into two pieces and washed twice, for 5

min each time, with 0.1 M phosphate buffer (pH 7.4). The PVA-gel pieces were hardened

for 90 min in a 2.5% glutaraldehyde solution prepared with 0.1 M phosphate buffer (pH

7.4). Next, the samples were washed in the buffer solution three times, for 10 min each

time, and then fixed for 90 min in a 1.0% OsO4solution prepared with 0.1 M phosphate

buffer. After washing the samples three times, for 10 min each time, in the buffer solution,

they were dehydrated in serially graded solutions of ethanol at concentrations of 10%,

30%, 50%, 70%, 90%, and 95% for 10 min each, and then twice at a concentration of

99.5% for 30 min each time. The samples were frozen and dried using a freeze-drier

(JEOL JFD-300, JEOL, Tokyo, Japan), and then sputter-coated with gold for 100 s with

7/22/2019 24-0514

34/93

21

an ion-sputtering device (JEOL JFC-1100E). Finally, the samples were observed with a

scanning electron microscope (JEOL JSM 6390LV).

A sludge sampleattached to PVA gel was taken from at sampling port 1 (day 270).The sludge samples used for DNA extraction were stored at 20C prior to analyses. The

sludge sample was first ground with a pestle under liquid nitrogen. Meta-genomic DNA

was extracted using an ISOIL kit (Nippon Gene, Tokyo, Japan) according to the

manufacturers instructions. The archaeal 16S rRNA genes in the DNA were amplified by

PCR with Phusion High-Fidelity DNA polymerase (Finnzymes, Espoo, Finland) and the

primers of Parch519f (forward primer: 5-CAGCCGCCGCGGTAA-3) and ARC915r

(reverse primer: 5- GTGCTCCCCCGCCAATTCCT -3) (Coolen et al., 2004). PCR was

carried out according to the following thermocycling parameters: 30 s initial denaturation

at 98C, 25 cycles of 10 s at 98C, 20 s at 65C, 20 s at 72C, and 5 min final elongation

at 72C. The amplified products were electrophoresed on a 1% agarose gel. A band (~0.4

kb) on the agarose gel was excised, and the DNAs in that band were extracted and

purified using a Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI,

USA).

The purified DNA fragments were ligated into the EcoRV site of pBluescript II KS +(Stratagene, La Jolla, CA, USA). Escherichia coli DH5 was transformed using the

constructed plasmids. The plasmids were extracted from the clones carrying them by the

alkaline method. The DNA fragments were sequenced using a 3130xl genetic analyzer

and BigDye terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA,

USA). Operational taxonomic units (OTUs) were defined by a 1% distance level in the

nucleotide sequences. The sequences were compared with those in the nr database by the

basic local alignment search tool (BLAST) program available on the NCBI website

(http://blast.ncbi.nlm.nih.gov/Blast.cgi).

2.3 Results

2.3.1 UASB reactor performance

The reactor was operated at temperatures varying from 35C (Period I) to 25C

(Period II), and 15C (Period III) as shown in Table 2-2. The experiments were carried

7/22/2019 24-0514

35/93

22

out with stable influent COD concentrations (43020 mg L1) and a stepwise decrease in

HRT, which reduces the treatment space and time.

Table 2-2 Performance of UASB reactor during Period I-III

Parameters 35oC (I) 25oC(II) 15oC (III)

Influent COD (mg L-1

) 42515 42916 4258

Effluent COD (mg L-1

) 9680 17530 32540

COD loading rate (kg m-3

d-1

) 2217 1710 147

COD removal rate (kg m-3

d-1

) 1411 10.56.5 42

COD removal efficiency (%) 7610 6010 313

Specific COD removal rate (kg m3-PVA-gel

1d

1) 6046 5031 199

CH4 yield (m3kg

1-CODremoved) 0.250.04 0.150.06 0.020.01

Fig. 2-2 shows the time courses of COD removal. Influent COD concentration was

kept stable and HRT was shortened, leading to an increase in loading rates and specific

COD removal rate. Due to the decrease of temperature, the methane yield reduced and

effluent COD concentrations increased stepwise. The effluent COD concentrations were

below 200 mg L-1 during Period I-II. At extremely short HRTs, COD removal rates

dropped to low values that indicated the COD overloads.

The reactor was started up at 35 C and an HRT of 2.0 h. From day 20, the HRT was

decreased stepwise. As the HRT was shortened to 0.26 h, the COD loading rate reached

40 kg-COD m3d1. A COD removal rate of 28 kg-COD m3d1, correlated with a high

specific COD removal rate of 137 kg-COD m3-PVA-gel1 d1, was achieved. The

methane yield reached 0.25 m3kg1-CODremoved. At the extremely short HRT of 0.22 h,

the COD removal rate dropped to 26 kg-COD m3d1with a decrease in methane yield to

0.21 m3kg1-CODremoved.

Period II at 25C was started from day 70. The COD removal rate reached 17

kg-CODremovedm3d1at an HRT of 0.39 h. The maximum loading rate was 27 kg-COD

m

3

d

1

. A specific COD removal rate of 80 kg-COD m

3

-PVA-gel

1

d

1

and a methane

7/22/2019 24-0514

36/93

23

yield of 0.21 m3kg1-CODremoved were obtained. The HRT was then shortened to 0.28 h,

and thereafter it was increased to 1.56 h for the third period of operation, at 15 C, from

day 190.

Period I

(35oC)

Period II

(25oC)

Period III

(15oC)

Fig. 2-2 Time courses of COD removal

During Period III, a maximum loading rate of 21 kg-COD m3 d1was obtained

using stepwise decreases in HRT. The COD removal rate reached 6 kg-COD m3d1

under HRT 0.49 h. A specific COD removal rate of 28 kg-COD m3-PVA-gel1d1was

obtained, and the methane yield was reduced to 0.19 m3kg1-CODremoved. Overall, COD

removal rate decreased by 50% with each temperature decrease of 10C.

0.0

0.2

0.4

0.6

0.8

1.0

1.2

1.4

1.6

0

5

10

15

20

25

30

35

HRT(h)

Temperature(oC) Temperature

HRT

0

5

10

15

20

25

30

35

40

45

50

0

50

100

150

200

250

300

350

400

450

500

CODloadingrate,

COD

removalrate

(kg-CODm-3d-1)

C

ODconcentration(mgL-1)

Influent COD Effluent COD COD loading rate COD removal rate

0.00

0.05

0.10

0.15

0.20

0.25

0.30

0

20

40

60

80

100

120

0 50 100 150 200 250 300

Methaneyield

(m3kg-1-CODremoved

)

SpecificCODremovalrate

(kg-CODm3-PVA-gel-1d-1)

Time (day)

Specific COD removal rate

Methane yield

7/22/2019 24-0514

37/93

24

In each period of operation, a steady-state phase was reached before COD overload

conditions occurred; overload conditions occurred during days 6569, days 180189, and

days 265278. The HRTs for each COD overload condition were 0.26 h, 0.39 h, and 0.49

h at 35C, 25C, and 15C, respectively. The changes in COD concentrations inside the

UASB reactor during the steady-state phases were measured (Fig. 2-3). The samples were

taken from the three sampling ports (lower port SP-3; middle port SP-4; higher port SP-5)

located at heights of 35, 50, and 65 cm above the reactor bottom.

The steady-state COD concentrations were compared with the influent and effluent

COD concentrations. At the same HRT (0.6 h) and an up-flow linear velocity of 2.2 m h1,

only 715% of the influent COD concentration (30 to 60 mg-COD L1, depending on the

reactor temperatures) was removed from the upper part of UASB reactor where the

sampling ports are located. Thus, it could be concluded that organic matter was mostly

degraded by the PVA-gel layer in the lower part of reactor. High COD consumption in the

sludge bed at 35C and 25C periods demonstrated that the PVA-gel beads played an

important role as support materials in retaining a sufficient amount of anaerobic sludge in

the UASB reactor. Under short HRTs, temperatures as low as 15C may lead to limited

biodegradation, thus high concentrations of residual COD in the upper part of UASB

reactor were observed.

Fig. 2-3 COD concentrations at different sampling ports

under loading rate of 17 kg-COD m3

d1

(HRT 0.6 h)

0

50

100

150

200

250

300

350

400

450

COD

concentration(mgL-1)

Influent port Lower port Middle port Higher port Effluent port

35oC 25

oC 15

oC

7/22/2019 24-0514

38/93

25

2.3.2Effects of temperature decrease and extremely short HRTsA decrease in biochemical reaction rate is often related to a decrease in treatment

temperature. The effect of reactor temperature (T) on COD removal rate (k) is given by

the following empirical equation (Tchobanoglous et al., 2003):

(1)

where kT is the COD removal rate at temperature TC, k20 is the COD removal rate at

20C, and is the temperature coefficient 1.056 (20-30oC) and 1.135 (4-20oC). The

values for cold temperatures (below 20C) were larger than those for medium

temperatures, implying that psychrophilic conditions had more influence on the COD

removal rate than mesophilic conditions did. This trend is illustrated in Fig. 2-4 that

shows the temperature dependence of COD removal rates under HRTs ranging from 1.56

h to 0.49 h.

Fig. 2-4 Temperature dependence of COD removal rate

The Eq. (1) permits the calculation of the temperature coefficient () based on

experimental COD removal rates. The value was determined to be 1.05 to 1.09

(average: 1.07) at temperatures ranging from 35C to 15C. The values in the present

study were consistent with previously reported results (Table 2-3).

0

5

10

15

20

15 25 35

CODremovalrate(kg-CODm-3d-1)

Temperature (oC)

HRT 1.56 hHRT 0.87 h

HRT 0.60 h

HRT 0.49 h

7/22/2019 24-0514

39/93

26

Table 2-3 Comparison of temperature coefficients ()for anaerobic treatments

Temperature coefficient () Temperature References

1.047 20oC Phelps (1944)

1.135

1.056

420oC

2030oCSchroepfer et al., (1964)

1.09 (PVA beads)

1.05 (PVA beads)

1525oC

2535oCThis study

1.07-1.11 (star channel)

1.06-1.11 (pall rings)

1.04-1.05 (gravel)

1525oC El-Monayeri et al., (2007)

All values of were larger than 1, showing that the COD removal rate decreased as

the temperature decreased. El-Monayeri et al. (2007) discussed that the structure of

biomass carrier influences the values. Thereported values of varied from 1.05 to 1.11

for three types of support media (gravel, pall rings and star channel). The highly porous

carriers, such as star channel and pall rings have the higher values of than non-porous

carriers. The average value of in case of PVA-gel carrier was 1.07 consistent with the

range of values for the highly porous carriers.

2.3.3 Characteristics of attached growth

Fig. 2-5 Scanning electron microscopic images of a matured PVA-gel bead:

cross-section (A), surface (B) and interior (C)

A B C

7/22/2019 24-0514

40/93

27

The PVA beads on days 70, 170, and 270 had average settling velocities of 194, 199,

and 201 m h1, respectively, greater than the value of 177 m h1in the start-up process. In

comparison, reported typical values for anaerobic biomass granules are in the range

18100 m h1 (Quan et al., al., 2011). Because of biomass attachment, the color of

PVA-gel beads turned to black. The outer surface of matured PVA-gel was covered with a

dense sludge layer (Fig. 2-5). Cracks appeared as a result of gas release. The porous

structure of PVA-gel provided a matrix for biomass development to the inner core of bead.

The use of PVA-gels in lab-scale UASB reactors treating different types of wastewater

under temperature variation is summarized in Table 2-4. Zhang et al. (2008a) conducted

his experiments using PVA beads as seed nuclei in a UASB reactor treating high-strength

synthetic wastewater made of corn steep liquor. The PVA-gel beads had a similar density

to natural granules, 1.031.08 g cm3, which has been shown to be beneficial for

microbial attachment (Schmidt and Ahring, 1996).

Table 2-4 Performance of lab-scale UASB reactors using PVA-gel carrier

Operational condition

UASB I

(Zhang et al., 2008a; 2008b)

UASB II

(this study)

Reactor temperature 35 C 35 C 35 C 25 C 15 C

Reactor volume (L) 7.5 7.5 3.9 3.9 3.9

HRT (h) 4810 14.48.0 2.000.22 1.560.28 1.560.28

Synthetic medium Corn steep liquor Ethylene glycol Peptone-bonito extract

Influent COD concentration (mg L1) 770-11000 600-3800 43020

COD loading rate (kg-COD m3d1) 0.422.5 1.011 5.247 6.337 6.435.5

COD removal rate (kg-COD m3d1) 20.5 10.7 25 16 12

Operation period (day) 280 137 70 118 98

PVA-gel size (mm diameter) 23 34 4 4 4

Packing ratio (%) 8 12 20 20 20

Specific COD removal rate(kg-COD m3-PVA-gel1d1)

154 78 119 81 60

Settling velocity (m h1) 200 322 194 199 201

7/22/2019 24-0514

41/93

28

During the experimental periods, the PVA-gel beads always settled at the bottom of

the reactor. The smaller PVA-gel beads (2~3-mm diameter) promoted biomass

attachment, but the bigger ones (4-mm diameter) were helpful for retaining the beads in

the reactor (Zhang et al., 2008a and 2008b). Hence, the bigger-size PVA-gel beads were

selected for the experiments in our study. As the reactor temperature decreased from

35 C to 15 C, the specific COD removal rate decreased by nearly 50%, from 119 to 60

kg-COD m3-PVA-gel1d1; however, the settling velocity increased. The mechanism of

anaerobic sludge granulation in UASB reactors is poorly understood, but the increase in

settling velocity could be explained by the development of attached biomass layers on the

surface of PVA-gel.

2.3.4 Archaeal community analysis

In the UASB reactor, sequential metabolic processes are carried out by different

groups of bacteria such as hydrolytic bacteria, fermentative acidogenic bacteria,

acetogenic bacteria, and methanogens. The archaeal communities for UASB sludge on

the surface of the PVA-gel carrier treating low-strength organic wastewater in the present

study is shown in Table 2-5.

Eight different OTUs were identified in the archaeal clone library of the sludge

sample (day 270). OTU 1 and OTU 2 had 100% and 98% sequence identity with

Methanobacterium beijingensestrain 4-1 (AY552778), respectively.Methanobacterium

beijingense strain 4-1 was isolated from an anaerobic digester in Beijing, China. The

strain has been shown to use H2/CO2 and formate for growth and methane production.

OTU 3 and OTU 4 had 100% sequence identity withMethanobacterium formicicum

strain FCam (AF028689) and Methanobacterium formicicum strain S1 (DQ649309),respectively.Methanobacterium formicicumstrain FCam was isolated from rice-field soil

in France. The strain has also been shown to use H2/CO2 and formate for growth and

methane production. Thus, 36% (12 clones/33 clones) of archaeal members in the UASB

sludge community were thought to belong to the genus ofMethanobacteriumwhich grow

on H2/CO2 and formate.

OTU 5 and OTU 6 had 99% sequence identity with UnculturedMethanosarcinales

archaeon clone QEEC1CH041 (CU917466) and 97% sequence identity withUncultured

7/22/2019 24-0514

42/93

29

Methanosaeta sp. clone DI_C03 (AY454761), respectively.

Table 2-5 Archaeal communities of UASB sludge

OTU TaxonGenBankAccession

Identity(%)

Numberof clones

1 UnculturedMethanobacteriumsp. clone WA1

Methanobacterium beijingense strain 4-1

EU88817

AY552778

100

100

6/33

2 Uncultured Methanogenic archaeon isolate SSCP band As11

Methanobacterium beijingensestrain 4-1

DQ682559

AY552778

99

98

1/33

3 UnculturedMethanobacterium sp. clone SWA3

Methanobacterium formicicum strain FCam

EU888014

AF028689

100

100

4/33

4 UnculturedMethanobacteriumsp. clone SWA4

Methanobacterium formicicum strain S1

EU888013

DQ649309

100

100

1/33

5 UnculturedMethanosarcinalesarchaeon clone QEEC1CH041

UnculturedMethanosarcinales archaeon clone QEEC1AB061

CU917466

CU917434

99

99

1/33

6 Uncultured archaeon isolate ARC7_G07

UnculturedMethanosaetasp. clone DI_C03

FM162215

AY454761

99

97

1/33

7 Archaeon enrichment culture clone C4-15C-A

Uncultured archaeon 44A-1

GU196162

AF424765

100

100

12/33

8 Uncultured crenarchaeote clone F31

Uncultured crenarchaeote clone GoM_GC232_4463_Arch73

EU910616

AM745241

99

94

7/33

It is widely known thatMethanosarcina andMethanosaeta are important aceticlastic

methanogenic species.Methanosarcinaare the most versatile methanogens. They can use

various sources of carbon, including methylamines and acetate. Methanosaetaalso can

use acetate as a substrate, although their growth rate is slower than that of

Methanosarcina. Methanosaeta was found to be dominant at very low acetate

concentrations and has a high affinity for acetate (Kongjan et al., 2011). On the other hand,

the genus Methanosarcina was able to tolerate high acetate concentrations and has a

7/22/2019 24-0514

43/93

30

much lower substrate affinity, but higher maximum specific use rate (Karakashev et al.,

2005; Tatara et al., 2005). Thus, the presence of Methanosarcina and Methanosaeta

species would support the proposition that methanogens with slow growth rates like

Methanosaetacan easily bind to PVA-gel, allowing longer sludge retention times in the

UASB reactor.

OTU 7 and OTU 8 had 100% sequence identity with Archaeon enrichment culture

clone C4-15C-A (GU196162) and Uncultured archaeon 44A-1 (AF424765), 94-99%

sequence identity with Crenarchaeote-relatives (EU910616 and AM745241). The

presence of these sequences can be explained by the distinctive operating conditions of

the UASB reactor under low temperatures and extremely short hydraulic retention time.

2.3.5 Post-treatment of UASB reactor effluent

The benefits of anaerobic wastewater treatment in UASB reactors are fully realized

if a post-treatment system is available. This process should be easy to operate, stable

under shock loads, and have low energy-requirements because the UASB reactor is

operated under various temperatures and HRTs. Fig. 2-6 shows the effluent BOD and

COD concentrations. The BOD5/COD ratio was 0.6, so the effluents from our UASB

reactor contain easily biodegradable organic carbon.

Fig. 2-6 BOD5, COD and TN concentrations in UASB effluents

under loading rates of 5 to 40 kg-COD m3

d1

Nitrogen removal is also often required before discharging treated effluents. The

influent total nitrogen (TN) concentrations were from 35 to 40 mg L1, of which 30% was

removed from the influent by the UASB reactor. As shown in Fig. 2-6, the UASB

effluents contained low TN concentrations. The economical post-treatment of such

0

50

100

150

200

250

300

350

BOD5 COD TN

Concentration(mgL-1) 35oC 25oC 15oC

35oC 25oC 15oC

BOD5

7/22/2019 24-0514

44/93

31

UASB effluents has been documented using a down-flow hanging-sponge system

(Takahashi et al., 2011); a sequencing batch reactor system (Moawad et al., 2009); an

electrocoagulation system (Yetilmezsoy et al., 2009); slow sand filters (Tyagi et al.,

2009); and polishing ponds (Sato et al., 2006), etc. Other studies of the development of

swim-bed technology demonstrated that swim-bed-attached growth bioreactors showed

excellent performance in organic wastewater post-treatment (Cheng et al., 2006). With

respect to the use of PVA-based biomass carriers, recently developed anammox reactors

have been reported as providing a promising nitrogen removal process (Ge et al., 2009;

Quan et al., 2011). These results show that further study is needed to evaluate

cost-effective systems for the post-treatment of UASB reactor effluents.

2.4 Discussion

It is widely known that temperature is an important factor in anaerobic treatment of

domestic wastewater. In addition, temperature shifts may cause higher suspended solids

levels in effluents and a decrease in the removal efficiencies of soluble COD (Morgan

and Allen, 2003; Ndon et al., 1997); the accumulation of suspended solids present in

domestic wastewater may decrease the methanogenic activity of the sludge, and also

causes formation of scum layers. Sudden washout of sludge may occur if these scum

layers are not stabilized within the reactor. In this situation, long HRTs and relatively

low organic loading rates are needed, thus the scope for high-rate wastewater treatment

is limited.

The UASB reactor showed the ability to sustain shock loads; however, it should be

prevented from overloading. In the present study, the recognition of COD overload

during each period of operation based on the drops of COD removal rate as showed in Fig.

2-2. Our findings must be viewed in the light of some limitations. One potential limitation

is that temperature control of the UASB reactor was needed, even though operation at

ambient temperatures is preferred. This was because of large variations in the ambient

temperature; these variations may cause unexpected effects in the reactor performance

under extremely short HRTs. This study also did not cover temperatures below 10 C,

which has been a challenge for many biological treatment processes. However, the results

from this study demonstrated the treatment feasibility of UASB reactors at low

temperatures.

7/22/2019 24-0514

45/93

32

The use of PVA-gel as the biomass carrier in UASB reactors has not been widely

documented. UASB reactors are required to operate under various temperatures,

depending on seasonal conditions. The present study addressed the effects of temperature

change on the treatment performance of a UASB reactor. It was found that the COD

removal rate of UASB reactor decreased by 50% for a temperature decrease of 10 C.

Extremely short HRTs could not be used at low temperatures because COD overload

occurred. Also, the characteristics of matured PVA-gel beads were found to be affected

by the wastewater constituents.

This study presented trends for COD removal rate against COD loading rate in

agreement with those reported by El-Monayeri et al. (2007). The key feature of UASB

process that allows higher volumetric COD loadings than as in other anaerobic processes

is the development of a dense granulated sludge (Ghangrekar et al., 2005; Tchobanoglous

et al., 2003). Several months may be required to develop this granulated sludge. A seed is

often supplied from other facilities to accelerate the reactor start-up. The UASB reactor in

our study was seeded with cultivated PVA-gel obtained from a previous anaerobic

fluidizing bed reactor, resulting in a short start-up phase.

Recently, there has been increasing interest in the mechanisms of granuledevelopment inside UASB reactors (Bhunia and Ghangrekar, 2007; Liu et al., 2003;

Vlyssides et al., 2008). Habeeb et al. (2011) assessed five key factors affecting UASB

granulation, namely (1) temperature, (2) organic loading rate, (3) pH and alkalinity, (4)

nutrients, and (5) cations and minerals. The present study covered the effects of

temperature and organic loading rate on PVA-gel carrier. Further work should assess the

development of granules in terms of the other factors. In addition, it has been

demonstrated experimentally that a high COD removal rate can be achieved by preparing

active microorganisms inside gel biomass carriers (Isaka et al., 2011; Quan et al., 2011).

These methods can be applied to the attached immobilization of useful microorganisms.

2.5 Conclusions

Two important findings were obtained from this study:

1) The effect of temperature on the treatment of low-strength wastewater in a UASB

reactor using PVA-gel carrier was investigated. The COD removal rate was reduced by

7/22/2019 24-0514

46/93

33

50% when the temperature was decreased by 10 C;

2) The relationship between COD removal rate and treatment temperature was

experimentally evaluated. The average temperature coefficient () was determined to be

1.07.

References

APHA, AWWA, WPCF (1995): Standard Methods for the Examination of Water and

Wastewater, 19th ed., American Public Health Association, Washington, DC.

Angenent, L.T., Banik, G.C., Sung, S. (2001): Anaerobic migrating blanket reactor

treatment of low-strength wastewater at low temperatures, Water Environment

Research, 73(5), 567574.

Bhunia, P., Ghangrekar, M.M. (2007): Statistical modeling and optimization of biomass

granulation and COD removal in UASB reactors treating low strength wastewater,

Bioresource Technology, 99, 42294238.

Cheng, Y.J., Watanabe, Y., Qiao, S., Koyama, T., Furukawa, K. (2006): Comparison of

treatment capacity of swim-bed technology and conventional activated sludgeprocess for domestic wastewater treatment, Japanese Journal of Water Treatment

Biology, 42(3), 129157.

Coolen, M.J.L., Hopmans, E.C., Rijpstra, W.I.C., Muyzer, G., Schouten, S., Volkman,

J.K., Sinninghe, D.J.S. (2004): Evolution of the methane cycle in Ace Lake

(Antarctica) during the Holocene: response of methanogens and methanotrophs to

environmental change, Organic Geochemistry, 35, 11511167.

El-Monayeri, D.S., Atta, N.N., El-Mokadem, S., Aboul-Fotoh, A.M. (2007): Effect of

organic loading rate and temperature on the performance of horizontal biofilters, In:

Proceedings of Eleventh International Water Technology Conference, IWTC11 2007,

Sharm El-Sheikh, Egypt, 671682.

Ge, Y.S., Yamaguchi, A., Sakuma, H. (2009): Study on the performance of anaerobic

ammonium oxidation treatment using PVA gel as a carrier, Water Science and

Technology, 59(5), 10371041.

7/22/2019 24-0514

47/93

34

Ghangrekar, M.M., Asolekar, S.R., Joshi, S.G. (2005): Characteristics of sludge

developed under different loading conditions during UASB reactor start-up and

granulation, Water Research, 39, 11231133.

Habeeb, S.A., Aziz Bin Abdul L.A.B., Zawawi, B.D., Zulkifli, B.A. (2011): A review

on granules initiation and development inside UASB reactor and the main factors

affecting granules formation process, International Journal of Energy and

Environment (IJEE), 2(2), 311320.

Isaka, K., Itokawa, H., Kimura, Y., Noto, K., Murakami, T. (2011): Novel autotrophic

nitrogen removal system using gel entrapment technology, Bioresource

Technology, 102(17), 77207726.

Karakashev, D., Batstone, D., Angelidaki, I. (2005): Influence of environmental

conditions on methanogenic compositions in anaerobic biogas reactors, Applied and

Environmental Microbiology, 71(1), 331338.

Kongjan, P., O-Thong, S., Angelidaki, I. (2011): Performance and microbial community

analysis of two-stage process with extreme thermophilic hydrogen and

thermophilic methane production from hydrolysate in UASB reactors, Bioresource

Technology, 102, 40284035.

Kumar, A., Yadav, A.K., Sreekrishnan, T.R., Satya, S., Kaushik, C.P. (2007): Treatment

of low strength industrial cluster wastewater by anaerobic hybrid reactor,


Liu, Y., Xu, H.L., Yang, S.F., Tay, J.H. (2003): Mechanisms and models for anaerobic

granulation in upflow anaerobic sludge blanket reactor, Water Research, 37 (3),

661673.

Moawad, A., Mahmoud, U.F., El-Khateeb, M.A., El-Molla, E. (2009): Coupling of

sequencing batch reactor and UASB reactor for domestic wastewater treatment,

Desalination, 242, 325335.

Morgan, S.F., Allen, D.G. (2003): Effects of temperature transient conditions on aerobic

biological treatment of wastewater, Water Research, 37(15), 35903601.

7/22/2019 24-0514

48/93

35

Ndon, U.J., Dague, R.R. (1997): Effects of temperature and hydraulic retention time on

anaerobic sequencing batch reactor treatment of low-strength wastewater, Water

Research, 31(10), 24552466.

Phelps, E.B. (1944): Stream Sanitation, John Wiley & Sons, New York.

Quan, L.M., Khanh, D.P., Hira, D., Furukawa, K. (2011): Reject water treatment by

improvement of whole cell anammox entrapment using polyvinyl alcohol/alginate

gel, Biodegradation, 22, 11551167.

Sato, N., Okubo, T., Onodera, T., Ohashi, A., Harada, H. (2006): Prospects for a

self-sustainable sewage treatment system: A case study on full-scale UASB system

in Indias Yamuna River Basin, Journal of Environmental Manage, 80, 198207.

Schmidt, J.E. and Ahring, B.K. (1996): Granular sludge formation in upflow anaerobic

sludge blanket (UASB) reactors, Biotechnology and Bioengineering, 49 (3),

229246.

Schroepfer, G.J., Robins, M.L., Susag, R.H. (1964): The research program on the

Mississippi River in the Vicinity of Minneapolis and St.Paul, Advances in Water

Pollution Research, Vol. 1, Pergamon, London.

Seghezzo, L., Zeeman, G., van Lier, J.B., Hamelers, H.V.M., Lettinga, G. (1998): A

review: The anaerobic treatment of sewage in UASB and EGSB reactors,


Sekiguchi, Y., Kamagata, Y., Nakamura, K., Ohashi, A., Harada, H. (1999): Fluorescence

in situ hybridization using 16S rRNA-targeted oligonucleotides reveals localization

of methanogenes and selected uncultured bacteria in mesophilic and thermophilicsludge granules, Applied and Environmental Microbiology, 65, 12801288.

Singh, K.S., Harada, H., Viraraghavan, T. (1995): Low-strength wastewater treatment by

a UASB reactor, Bioresource Technology, 55, 187194.

Takahashi, M., Yamaguchi, T., Kuramoto, Y., Nagano, A., Shimozaki, S., Sumino, H.,

Araki, N., Yamazaki, S., Kawakami, S., Harada, H. (2011): Performance of a

pilot-scale sewage treatment: An up-flow anaerobic sludge blanket (UASB) and a

7/22/2019 24-0514

49/93

36

down-flow hanging sponge (DHS) reactors combined system by sulfur-redox

reaction process under low-temperature conditions, Bioresource Technology, 102,

753757.

Tatara, M., Yamazawa, A., Ueno, Y., Fukui, H., Goto, M., Sode, K. (2005): High-rate

thermophilic methane fermentation on short-chain fatty acids in a down-flow

anaerobic packed-bed reactor, Bioprocess and Biosystems Engineering, 27 (2),

10513.

Tchobanoglous, L., Burton, F.L., Stensel, D.H. (2003): Wastewater Engineering:

Treatment and Reuse, 4th ed., Mc Graw-Hill, New York, ISBN 0-07-041878-0.

Tyagi, V.K., Khan, A.A., Kazmi, A.A., Mehrotra, I., Chopra, A.K. (2009): Slow sand

filtration of UASB reactor effluent: A promising post treatment technique,

Desalination, 249(2), 571576.

Uemura, S., Harada, H. (2000): Treatment of sewage by a UASB reactor under moderate

to low temperature conditions, Bioresource Technology, 72, 275282.

Vlyssides, A., Barampouti, E.M., Mai, S. (2008): Granulation mechanism of a UASB

reactor supplemented with iron, Anaerobe, 14(5), 275279.

Yetilmezsoy, K., Iihan, F., Sapci-Zengin, Z., Sakar, S., Gonullu, M.T. (2009):

Decolorization and COD reduction of UASB pretreated poultry manure wastewater

by electrocoagulation process: A post-treatment study, Journal of Hazardous

Materials, 162, 120132.

Zhang, W., Wang, D., Koga, Y., Yamamoto, T., Zhang, L., Furukawa, K. (2008a):

PVA-gel beads enhance granule formation in a UASB reactor, BioresourceTechnology, 99, 84008405.

Zhang, W. (2008b): Applications of PVA-gel beads as biomass carrier for anaerobic

wastewater treatment, Ph.D. thesis, Kumamoto University, Kumamoto, Japan.

http://reposit.lib.kumamoto-u.ac.jp/handle/2298/11953

7/22/2019 24-0514

50/93

37

Chapter 3 Response of poly(vinyl alcohol)-gel and

poly(ethylene glycol)-gel biogranular sludges in two identical

UASB reactors

3.1 Introduction

UASB reactor has been employed in industrial and municipal wastewater treatment

for decades. It exhibits positive features such as high organic loadings, low energy

demand, short hydraulic retention time and easy reactor construction (Alphenaar et al.,

1993; Bhunia et al., 2007; El-Kamah et al., 2011; Fang et al., 1994; Ghangrekar et al.,2005; Lettinga et al., 1980; Mahoney et al., 1987; Schmidt et al, 1996; Zhang et al., 2008).

Important parameters affecting the treatment efficiency of UASB reactors include the

granulation process in the reactor, the characteristics of the wastewater to be treated, the

selection of inoculum material, the influent of nutrients and several other environmental

factors. Among these parameters, the granulation process is believed to be the most

critical one (Fang et al., 1994; Show et al., 2004). Different mechanisms and models for

anaerobic granulation in UASB reactors were reviewed by Liu et al. (2004). Of those,

some authors have been in agreements that one of the contributing factors to the

development of granules is the presence of nuclei (or bio-carriers) for microbial

attachment. The attachment of cells to these particles has been proposed as the initiation

step for granulation. Since the second step is the formation of a dense and thick biofilm on

the cluster of the inert carriers, this step could be considered as biofilm formation. One

the initial aggregates are formed, subsequent granulation could be regarded as an

increment of biofilm thickness. Several investigators have studied the effect of inert

particles in the granulation. Hulshoff Pol et al. (1989, 2004) demonstrated the importance

of inert support particles in the granulation process. When the inert particles with a

diameter of 40-100 m were removed from the inoculated sewage sludge, granulation

was not observed within the period of time required for granulation in the seed sludge. Yu

et al. (1999) proposed the guidelines for the selection of inert materials to be used in order

to enhance sludge granulation as (i) high specific surface area, (ii) specific gravity similar

to anaerobic sludge, (iii) good hydrophobicity, and (iv) spherical shape.

7/22/2019 24-0514

51/93

38

In chapter 1, PVA-gel beads supplied by Kuraray Corporation (Japan) were applied

for treatment of low-strength wastewater. PVA-gel performed itself as a potential biomass

carrier in UASB reactor (Khanh et al., 2011; Zhang et al., 2008; Zhang et al., 2011). Of

polymer gel particles, poly(ethylene glycol) (PEG), which is very similar to PVA beads,

has been considered as a possible biomass carrier (Hashimoto et al., 1998; Isaka et al.,

2007; Isaka et al., 2011; Xiangli et al., 2008). In the

24-0514

Documents