Viruses 2012, 4, 637-653; doi:10.3390/v4040637

viruses ISSN 1999-4915

www.mdpi.com/journal/viruses

Article

Co-circulation of Four Human Coronaviruses (HCoVs) in Queensland Children with Acute Respiratory Tract Illnesses in 2004

Ian M. Mackay 1,2,*, Katherine E. Arden 1,2, David J. Speicher 1,3, Nicholas T. O’Neil 1,

Peter K. McErlean 1,4, Ristan M. Greer 5, Michael D. Nissen 1,6 and Theo P. Sloots 1,6

1 Queensland Paediatric Infectious Diseases Laboratory, Queensland Children’s Medical Research

Institute, Sir Albert Sakzewski Virus Research Centre, Children’s Health Service, University of

Queensland, Herston 4029, Australia; E-Mails: katherine.arden@uq.edu.au (K.E.A.);

d.speicher@griffith.edu.au (D.J.S.); n.oneill@uq.edu.au (N.T.O’N.);

p-mcerlean@northwestern.edu (P.K.M.); Michael_Nissen@health.qld.gov.au (M.D.N.);

t.sloots@uq.edu.au (T.P.S.) 2 Clinical Medical Virology Centre, School of Chemistry and Molecular Biosciences, University of

Queensland, Herston 4029., Australia 3 Molecular Basis of Disease research Program, Griffith Health Institute, Griffith University,

Queensland 4222, Australia 4 Division Allergy-Immunology, Northwestern University, The Feinberg School of Medicine,

Chicago, IL 60611, USA 5 Queensland Children’s Medical Research Institute, University of Queensland, Herston 4029,

Australia; E-Mail: r.greer@uq.edu.au 6 Division of Microbiology, Pathology Queensland Central, Clinical and Scientific Services, Royal

Brisbane Hospitals Campus, Herston 4029, Australia

* Author to whom correspondence should be addressed; E-Mail: ian.mackay@uq.edu.au;

Tel.: +617-3636-8716; Fax: +617-3636-1401.

Received: 23 March 2012; in revised form: 11 April 2012 / Accepted: 11 April 2012 /

Published: 23 April 2012

Abstract: Acute respiratory illnesses (ARIs) with unconfirmed infectious aetiologies peak

at different times of the year. Molecular diagnostic assays reduce the number of

unconfirmed ARIs compared to serology- or culture-based techniques. Screening of 888

inpatient and outpatient respiratory specimens spanning late autumn through to early

spring, 2004, identified the presence of a human coronavirus (HCoV) on 74 occasions

OPEN ACCESS

Viruses 2012, 4 638

(8.3% of all specimens and 26.3% of all respiratory virus detections). Prevalence peaked in

August (late winter in the southern hemisphere) when they were detected in 21.9% of

specimens tested. HCoV-HKU1 and HCoV-OC43 comprised 82.4% of all HCoVs

detected. Positive specimens were used to develop novel reverse transcriptase real-time

PCRs (RT-rtPCRs) for HCoV detection. An objective clinical severity score was assigned

to each positive HCoV patient. Severity scores were similar to those from a random

selection of young children who were positive for respiratory syncytial virus at a different

time but from the same specimen population. During the cooler months of 2004, sensitive

and specific RT-rtPCRs identified the concurrent circulation of all four HCoVs, a quarter

of which co-occurred with another virus and most of which were from children under the

age of two years.

Keywords: respiratory virus; coronavirus; HCoV-HKU1; HCoV-NL63; HCoV-229E;

HCoV-OC43; real-time PCR; clinical impact

1. Introduction

Acute respiratory illnesses (ARIs) are a frequent cause of paediatric morbidity and a common

reason for outpatient visits and hospitalisations. Among children, RNA viruses are the most frequent

cause of “colds” and “influenza-like” illness (ILIs); usually self-limiting upper respiratory tract

illnesses (URTIs) [1]. Virus detections are also often associated with lower respiratory tract illness

(LRTI; [2]) although their replication in these tissues is seldom identified. Human rhinoviruses (HRV),

respiratory syncytial virus (HRSV), influenzaviruses (IFVs) adenoviruses (HAdV), metapneumovirus

(HMPV) and parainfluenza viruses (HPIV) are among the most frequently sought respiratory viruses

in the clinical microbiology laboratory [3-7]. Many peak at distinct times of the year. However, even

when bacterial pathogens are added to this viral panel, 40–70% of suspected infections remain without

laboratory confirmation [8-10]. The inclusion of more viruses into the diagnostic algorithm is

recommended to support and confirm a clinically diagnosed infectious aetiology [11]. Nonetheless,

extended testing panels are most often used by research projects and the human coronaviruses (HCoVs)

are one group of pathogens often overlooked by routine testing. Two of the enveloped positive sense

RNA HCoVs, HCoV-229E and HCoV-OC43, have been known for more than 40 years [12;13].

Infections by these two viruses can be difficult to distinguish from ILI in a population vaccinated for

IFV [14]. Both HCoVs have also been identified in non-respiratory specimens [15]. Recently three

new HCoVs, all detected in patients with ARIs were described; the severe acute respiratory syndrome

coronavirus (SARS-CoV) in 2003, HCoV-NL63 in 2004 and HCoV-HKU1 in 2005 [16-18].

Some studies have noted that genus Alphacoronavirus species HCoV-NL63 and HCoV-229E and

the genus Betacoronavirus species HCoV-HKU1 and subspecies HCoV-OC43 may circulate annually,

but the prevalence varies significantly [19]. Only HCoV-HKU1 has a seroprevalence below 90% in

adults; the reason for this apparently reduced exposure may be related to a cross-protective antibody

effect afforded by prior infection with HCoV-OC43 [20;21].

Viruses 2012, 4 639

RT-PCR methods more frequently detect HCoVs than in vitro culture because they are difficult to

grow without a source of primary tissue [22-24]. Studies that definitively link the presence of viral

RNA to human disease, akin to those conducted using infection of human volunteers are lacking.

This has hampered the assignment of specific disease associations for these and other newly identified

respiratory viruses. Screening for all HCoVs in a multi-year population sampling is infrequent so

studies that directly compare the impact of HCoV infections are rare [19;25-31]. Despite a sizable

historical role in the common cold [32] the HCoVs are also found in patients with more severe cases of

ARI [26;33-35] including LRTI and pneumonia in adults and the elderly [9;36;37]. HCoVs are also

found in cases of bronchial hyper-responsiveness in susceptible individuals [38;39] and nosocomial

respiratory viral infections [40-42].

We have previously identified instances of HCoV-HKU1 from samples collected during the winter

of 2004 [43]. Here we expanded upon that investigation, using newly designed reverse transcriptase

real-time PCR (RT-rtPCR) assays to screen for all four non-SARS-CoVs in a hospital-based,

predominantly paediatric population with ARI. The clinical status of patients with single and multiple

HCoV detection was also compared.

2. Results and Discussion

2.1. Detection of HCoVs and RT-rtPCRs

We expanded our previous study of 324 specimens using PCR assays to screen for HCoVs. We

previously identified that a pan-HCoV RT-PCR often failed to detect HCoV-HKU1 and HCoV-OC43

although it was useful for HCoV-229E and HCoV-NL63 detection [43;44]. We therefore included a

specific HCoV-HKU1 assay [45] and developed an RT-rtPCR for HCoV-OC43 detection (this study).

When enough specimen extract remained, positives were confirmed using nucleotide sequencing

(Figure 4).

Newly developed HCoV-HKU1, HCoV-NL63 and HCoV-229E RT-rtPCRs confirmed previous

and new (Table 1; this study) conventional RT-PCR HCoV positives [43;46]. Previous sequencing of

the 1b region had confirmed HCoV identity where specimen remained [43;47]. The RT-rtPCRs did not

produce any positive results (defined in the Experimental section) when amplifying clinical samples

positive for HRSV (n = 103), HAdVs (n = 26), HRVs (n = 17) IFVs (n = 5) or HPIV-positive (n = 28)

specimens. The HCoV RT-rtPCRs have since been used in several other studies (including many more

positives for each of these respiratory viruses listed) and no cross-reactions have been noted. The

analytical sensitivity of each assay was determined to be 101 copies ivtRNA/20 μL reaction.

Overall 74 instances of a coronavirus (8.3% of tested specimens) were detected. The majority of

which were HCoV-HKU1 (n = 34; 46.6% of all HCoV), followed by HCoV-OC43 (n = 27; 37.0%),

HCoV-NL63 (n = 9;12.3%) and HCoV-229E (n = 4; 5.5%).

2.2. Epidemiology and Clinical Features of HCoV-positive Individuals During Winter 2004

HCoV detection peaked in late winter (August in the southern hemisphere) when sample numbers

were lowest (Figure 1). Most (69.9%) of the HCoV detections were from patients two years old or less

with children (age 14 years) comprising 80.8% of the positive patients. HCoV types were equally

Viruses 2012, 4 640

distributed between males and females except for HCoV-NL63 which was only detected in males

(p = 0.012; 95% confidence interval). HCoV-OC43 was detected in all age groups, was the only HCoV

detected in neonates (n = 2) and was detected in adults (6.3% of all viruses detected in patients over 14

years old) more than any other respiratory virus (3.1%).

Figure 1. Specimens tested and the proportion of respiratory viruses positive during the

study period.

The average age of positive patients was highest for HCoV-OC43 among the four HCoVs

(Figure 2; Table 2). Each HCoV was involved in more co-detections than the average level of

co-detections for the study population (10.5%; Table 2) and more frequently (HCoV-229E, 25.0%;

HCoV-OC43, 11.1%; HCoV-HKU1, 14.7%) than most other respiratory viruses sought (HRSV, 4.9%;

HAdV, 15.4%; HPIV3, 28.6%; HMPV, 8.1%).

Clinical reviews were obtained on 62 HCoV positives, representing 61 patients (83.6% of HCoV

detections; Table 3). In one patient both HCoV-HKU1 and HCoV-OC43 were co-detected (sequencing

confirmed that both viruses were present; data not shown). This male toddler (13 months old), also

positive for HMPV, had been admitted three months prior with bronchiolitis. For the current

presentation, following seven days of symptoms including cough, otitis media, a measurable fever and

rhinorrhoea, salbutamol and antibiotics were administered.

The average clinical severity score among patients positive for any HCoV was 2.1 with 47 cases

(77.0% of HCoV-positive reviews) admitted to hospital (26 were only positive for an HCoV). Of these

admissions, 20 (32.8%) remained for 96 hours, with 14 of these sole HCoV detections. There was no

difference in severity score between the four HCoV groups, either between samples with a single

detection and co-detections considered together, p = 0.21, or between those with single detections,

p = 0.29, or those with co-detections, p = 0.09 (Kruskal-Wallis test). The highest average severity

score (4.5) was observed from HCoV-NL63-positive patients who were also positive for another virus.

Most HCoV cases met Gaunt et al.’s criteria [19] for URTI (n = 17; 27.4%) or LRTI (n = 19; 30.6%;

Table 2). Data could not be obtained for four (6.5%) HCoV-positive cases. Antibiotics were given

to 22 cases (36.1%). HCoV-HKU1 detections, whether single or co-detections, were most often

made from patients with URTI or LRTI (70.9%; Figure 3). Most single HCoV-OC43 detections

Viruses 2012, 4 641

were in patients with chronic disease (38.1% of detections). Most HCoV-229E detections were

accompanied by another virus and no HCoV-NL63 detections were made in chronically diseased or

immunocompromised patients.

Figure 2. Comparison of the proportion of each HCoV detected in each age group. The

number of HCoV detections is shown to the left of each bar.

Viruses 2012, 4 642

Figure 3. Clinical groupings among the single detection of each HCoV. Based on the

criteria of Gaunt et al. [19]. The number of HCoV detections is shown to the left of each

bar. IC-immunocompromised; LRTI-lower respiratory tract illness; URTI-upper

respiratory tract illness.

The most commonly noted additional clinical features among patients only positive for a HCoV

(n = 37; 59.7% of HCoV cases) were cough (n = 6; 9.7%), fever (n = 5; 8.1%) and vomiting (n = 4;

6.5%; Table 3). Among HCoV co-detections the most common features were otitis media (n = 5;

8.1% of HCoV cases), cough (n = 4; 6.5%), fever (n = 3; 4.8%) and vomiting (n = 3; 4.8% of

HCoV-positives).

In the comparison population of HRSV-positive children whose charts were reviewed the average

severity score was also 2.1. The obvious differences between HRSV and HCoV hospitalisations were

that slightly fewer HRSV cases were admitted than in the HCoV group (70.0% vs. 77.0%),

hospitalisation times were shorter (20.0% vs. 32.8% inpatients at 96 hours) and fewer patients required

mechanical ventilation (5.0% vs. 11.5%). However, more HRSV-positive children had a measurable

fever (n = 13; 65% compared to 10.3% of HCoV-positive patients).

Viruses 2012, 4 643

Table 1. Oligonucleotide primers and probes used for HCoV screening.

Oligonucleotide Name (gene target)

Oligonucleotide Sequence

229E 01.4 (N) ACAACGTGGTCGTCAGGGT 229E 02.6 (N) GCAACCCAGACGACACCT 229E_MGB FAM-CATCTTTATGGGGTCCTG -MGBNFQ 229E 01.3 T7 AAAATAATACGACTCACTATAGGGGAACCACAACGTGGTCGTCAGGGT 229E 02.5 T7 GGTTCTGAATTCTTGCGCCTAA HKU1 01.2 (1b) GTTGGGACGATATGTTACGTCATCTT HKU1 02.2 (1b) TGCTAGTACCACCAGGCTTAACATA HKU1_MGB FAM-CAACCGCCACACATAA-MGBNFQ HKU1 01.2 T7 AAAATAATACGACTCACTATAGGGGTTGGGACGATATGTTACGTCATCTT HKU1 02.2 T7 TGCTAGTACCACCAGGCTTAACATA OC43 01.3 (N) GAAGGTCTGCTCCTAATTCCAGAT OC43 02.4 (N) TTTGGCAGTATGCTTAGTTACTT OC43_TM ROX-TGCCAAGTTTTGCCAGAACAAGACTAGC-BHQ2 OC43 01.2 T7 AAAATAATACGACTCACTATAGGGCGATGAGGCTATTCCGACTAGGT OC43 02.4 T7 ACCAGATGCCGACATAAGGTTCATTCT NL63_N_01.13 (N) GAGTTCGAGGATCGCTCTAATA NL63_N_02.8 (N) TGAATCCCCCATATTGTGATTAAA NL63_TM5 CY5-AAAATGTTATTCAGTGCTTTGGTCCTCGTGA-BHQ1 NL63 01.6 T7 AAAATAATACGACTCACTATAGGGAGTCTTGGTAATCGCAAACGTAATC NL63 02.6 T7 TATCAAAGAATAACGCAGCCTGATTA

01-sense primer; 02-antisense primer; T7–primers used to make ivtRNA controls showing the promoter region (bold, underlined) and 5’ spacer sequence (underlined, not bold).

Viruses 2012, 4 644

Table 2. Patient population and HCoV findings.

229E NL63 OC43 HKU1 Total population (n = 888)

Male (%) 2 (50.0) 91 (100) 12 (44.4) 19 (55.9) 514 (57.9) Detections 4 9 272 342 2903 (32.7) Co-detections (%) 3 (75.0) 2 (22.2) 6 (18.5) 11 (23.5) 294 (10.5) Mean age, years 4.9 3.9 18.6 4.9 7.9 Peak month July August July August June Average severity score (single/co-detection) ND/2.5 2.0/4.5 2.9/2.0 1.6/1.5 -

1p=0.012 with 95% confidence level 2A single co-detection between HCoV-OC43 and HCoV-HKU1 are included in each tally; 3Total of all virus detections including HCoVs; 4-only HCoV-positive samples were screened for HRVs; ND-no data available

Table 3. Clinical features of patients positive for an HCoV.

HCoV

detected

Average

Score 1 Detections Fever Vomit Cough Diarrhoea Rash AOM 2

IC 3

(n = 4)

chronic

(n = 9)

LRTI (n

= 18)

URTI

(n = 17)

other

(n = 9)

no data

(n = 4)

HKU1 single 1.63 17 3 3 3 0 2 2 2 0 5 7 1 2

HKU1 dual 1.54 14 1 3 2 1 1 3 1 1 4 6 2 0

NL63 single 2.00 5 0 0 2 0 0 0 0 0 2 1 1 1

NL63 dual 4.50 2 0 0 0 0 0 0 0 0 2 0 0 0

OC43 single 2.85 14 2 1 1 0 0 0 1 6 2 2 3 0

OC43 dual 2.00 7 2 0 2 0 0 2 0 2 2 1 2 0

229E single ND 1 0 0 0 0 0 0 0 0 0 0 0 1

229E dual 2.50 2 0 0 0 0 0 0 0 0 2 0 0 0

62 8 7 10 1 3 7 4 9 19 17 9 4

SoDe HCoV 5 4 6 0 2 2 3 6 9 10 5 4

8.1% 6.5% 9.7% 0.0% 3.2% 3.2% 4.8% 9.7% 14.5% 16.1% 8.1% 6.5%

CoDe HCoV 3 3 4 1 1 5 1 3 10 7 4 0

4.8% 4.8% 6.5% 1.6% 1.6% 8.1% 1.6% 4.8% 16.1% 11.3% 6.5% 0.0% 1 The severity score is a 5-point index which takes oxygen requirement to be the best single quantifier of respiratory illness. Additional component scores are derived from the need for

admission, intravenous fluids and the time until discharge. This peer-reviewed severity index has been validated during previous studies [48-50]. ; 2 acute otitis media; 3 immune compromise

Viruses 2012, 4 645

Figure 4. Confirmation of HCoV Identities. Phylogenetic analysis of some Queensland

HCoVs detected during the winter of 2004 from cases of ARI, presented on a topology tree

prepared in MEGA 5 and compared to other coronavirus sequences (BCoV, DQ811784-

bovine coronavirus, assigned ot the same species as HCoV-OC43; PEDV, NC_003436-

porcine epidemic diarrhoea virus; MHV, NC_001846-murine coronavirus; CCoV,

AF124986-canine coronavirus; FCoV, AF124987-feline coronavirus; IBV, NC_001451-

avian infectious bronchitis virus; SDAV, AF124990-; HCoV-NL63, AY567487; HCoV-

229E, AF304460; HCoV-OC43, NC_005147; HCoV-HKU1, NC_006577; SARS-CoV,

AY274119). The nucleotide alignment of 225nt of the polymerase gene was prepared using

Geneious Pro v5.5. The tree was drawn to scale and evolutionary distances were calculated

using the Maximum Composite Likelihood method. HCoV groupings are indicated.

Viruses 2012, 4 646

3. Experimental Section

3.1. Study Population

The study comprised 888 respiratory specimens from individuals who had presented to Queensland

hospitals with signs and symptoms of ARI during May to September 2004. This included 324

previously described specimens [43]. Specimens were predominantly nasopharyngeal aspirates (NPA;

97.9%) collected either from outpatients or admitted patients. Specimens were selected by season,

without prior knowledge of patient details or viral diagnostic status. The subjects ranged in age from

three days to 92.4 years (mean = 7.9 years, median = 1.1 years, mode = 0.2 years), with infants (one to

twelve months old) comprising 41.1% of the study population.

Prior to this retrospective study, nucleic acids had been extracted from specimens, tested for

common respiratory viral pathogens and stored at -70C. The clinical microbiology laboratory assays

included culture-amplified direct fluorescent assay and subsequent PCRs to detect HRSV, HAdV,

HPIV-1, 2 and 3 and influenza viruses A & B (IFAV, IFBV) [8]. An additional PCR assay was used to

detect HMPV [51]. No virus was detected in 574 specimens (64.6%). Additional RT-rtPCR testing for

human rhinoviruses (HRVs) was based on a modified, previously described method [52;53], only

applied to the HCoV-positive samples.

3.2. HCoV RT-PCR Testing

The RT-PCRs used to initially screen specimens included a mix of conventional (for HCoV-229E,

HCoV-NL63 and HCoV-HKU1; described previously [43;54]) and RT-rtPCRs (HCoV-OC43;

described in this study). The positives patients from these assays were subject to retrospective medical

chart review. The positive specimens, when extract remained, were used for the validation of newly

designed RT-rtPCRs for the detection of HCoV-229E, HCoV-NL63 and HCoV-HKU1.

Single-target RT-rtPCR assays were developed to maximise sensitivity, using in-house

oligonucleotides specific to HCoV-229E, HCoV-HKU1, HCoV-OC43 or HCoV-NL63 (Table 1).

Reaction mixes were combined with 1 μL of purified RNA and subjected to RT (OneStep RT-PCR kit,

QIAGEN, Australia) for 30 min at 50 C followed by a 15min incubation at 95C. PCR was performed

for 55 cycles of 94 C for 5 sec, 60 C for 60 sec (Rotor-Gene 3000, 6000 or Q, QIAGEN, Australia).

Synthetic T7-tagged HCoV-specific in vitro transcribed RNAs (ivtRNAs) were created by adapting a

previously described approach [55]. We used oligonucleotides which bound at (HCoV-HKU1) or

outside (all other HCoVs) the diagnostic RT-rtPCR target area (T7 oligonucleotides; Table 1). RNA

was subjected to two treatments with DNase (Turbo, Life Technologies) followed by column

purification (High Pure Viral Nucleic Acid Kit, Roche Diagnostics). These stock RNAs were used to

determine the analytical sensitivity of each assay after testing a 10-fold dilution series. The last

dilution to yield a positive result (defined below) was taken as the limit of analytical sensitivity. The

ivtRNA copy numbers were calculated using the optical density to approximate the mass of RNA in

the stock solution at 260 nm, determining the number of moles by establishing the molecular weight of

each HCoV-specific ivtRNA and then multiplying by 6.02 × 1023 (Avogadro’s number). A positive

diagnostic result was defined by the presence of a sigmoidal curve that crossed an arbitrary threshold

Viruses 2012, 4 647

of 0.05, before 45 cycles, during an experiment in which duplicate non-template controls did not cross

the threshold.

3.3. Nucleotide Sequencing and Phylogenetic Analysis

Nucleotide sequencing reactions were performed using 2 μL of amplicon with the ABI PRISM™

BigDye cycle sequencing kit (Perkin Elmer Applied Biosystems Division, USA). Sequences were

determined using an Applied Biosystems 3130xl capillary electrophoresis genetic analyser.

Nucleotide sequences were aligned using Geneious Pro v5 [56] and presented in a neighbour-

joining tree prepared in MEGA 5 [57]. Nucleotide sequences deposited into GenBank as a result of this

study include JQ732182-JQ732203.

3.4. Clinical Data Collection

Medical records of patients with specimens positive for HCoV by conventional RT-PCRs [43;54]

were reviewed to determine the severity of the ARI using a validated, objective scoring system [49].

The severity score is based on the patient’s need for hospitalisation, supplemental fluids and degree of

respiratory support. If other clinical information such as cough, wheeze, fever and pre-existing

conditions was documented, this was also recorded. A secondary dataset of clinical information

(n = 20) was also collected from age-matched patients (less than three years of age) positive for HRSV

who had also presented with ARI between July and December 2009.

4. Discussion

We retrospectively investigated an Australian paediatric, hospital-based winter population for the

presence of HCoVs and developed four novel RT-rtPCRs. Studies identifying the co-circulation of all

four non-SARS-CoVs are uncommon [19;25-29]. A paucity of such data hinders direct comparison of

the epidemiology and clinical features of individuals infected by the different HCoVs. Some assays

designed to detect all four HCoVs are too insensitive for practical use in a clinical microbiology

laboratory [44;58]. Others, using similar measures of assay sensitivity to those employed here, have

proven sensitive and specific when used to screen focused or hospitalized disease populations [30;59;60].

The appearance of commercial assay alternatives is progressing but large scale or routine use is

rare [61]. The incidence of 8.3% in our samples is higher than reported by a three-year study (<1%

prevalence; [19]) and among those hospitalized with pneumonia or ARI and/or fever [30;59;60]

reflecting our more focused winter study period and mixed inpatient and outpatient hospital population;

the known period of peak HCoV prevalence. Similar to others, we observed a high number of

co-detections (18.5–75.0%) among the HCoVs compared to the overall study population

(10.5%) [19;62]. Others have commented that HCoVs impart a limited impact due to their low

prevalence, relatively higher proportion of involvement in co-detections and low secondary attack rate

in households [62]. Our retrospective study also observed that clinical features and the average severity

scores from patients with HCoV were very close to those from a similarly aged set of children who

were positive for HRSV.

Viruses 2012, 4 648

HCoV-OC43 was detected in patients with a range of clinical conditions but predominated among

those with chronic conditions and manifested as both URTI and LRTI. HCoV-HKU1 dominated

detections overall and specifically in those with URTI, LRTI and in those with vomiting, cough, fever

and otitis media. Our findings are similar to those from Hong Kong where HCoV-HKU1, previously

identified in patients with pneumonia, was associated with fever and febrile convulsion [25]. However,

HCoV-HKU1 whether as a single or co-detection had the lowest average severity score, a metric that

was focussed on respiratory symptoms. Dijkman et al. proposed that HCoV-OC43 seroconversions

dominated those of HCoV-HKU1 (and that HCoV-NL63 dominated HCoV-229E) because of

cross-protective neutralizing antibodies elicited by the first infection with HCoV-OC43 or

HCoV-NL63 [20]. Our study found that most HCoV-HKU1 detections (peaking in August) were made

after the HCoV-OC43 detections (peaking in July). Although the numbers in our winter study were

smaller than those of Dijkman et al.’s and the differences in peak detection were not great, our testing

of all inpatient and outpatient samples from Queensland hospital presentations between May and

September 2004 may have better resolved and reflected HCoV activity than did the outcome of a

five-year average of testing results from paediatric inpatients below the age of two years [20]. Extending

serosurveys to other populations may resolve this discrepancy. Neither HCoV-NL63 nor HCoV-229E

occurred in patients with rash, immunocompromise, diarrhoea or vomiting or in those with chronic

disease. HCoV-NL63 was most common among those with cough (including croup and prolonged

cough) and LRTI which is in keeping with its association with croup [5]. Vomiting and diarrhoea

occurred most often in HCoV-HKU1 cases supporting other recent findings for this HCoV [63].

Several study limitations should be highlighted. This population does not represent clinically well

subjects (i.e., those who do not feel ill enough to warrant a visit to their hospital or outpatients clinic)

so no conclusions about the impact of these viruses in the community can be drawn beyond the

extrapolation that because our patient population is sampled from the community, it is reasonable to

assume that these viruses have been circulating concurrently. It is additionally worth noting that all

respiratory viruses have so far been found to some extent in clinically well populations. This finding

does not bestow unimportance or reduced pathogenicity upon the viruses, just as a statistically

significant higher proportion in the number of detections in an ill population versus a control group

cannot guarantee causality upon the virus. Because human immunity plays a significant regulatory role

in every virus challenge a control population is only the first of many steps to identify a disease

association. Another useful step is a birth cohort followed for several years and sampled at regular

short intervals regardless of disease state. We have such a cohort underway. Because this is a

cross-sectional study, we could not define what was happening to the HCoVs during the “off-season”.

We did not test all specimens for bocaviruses or HRVs so the overall number of co-detections may be

under-reported.

We did not expect the predominance of males among the HCoV-NL63 cases, a pattern of gender

distribution which differs from the other HCoVs. It is possible this is a type 1 error associated with

multiple tests. However, as there were only four tests and a small p-value, it is possible this indicates a

true virus effect, which requires further investigation for confirmation. HCoV-HKU1 was the most

frequently detected HCoV and involved in the broadest array of clinical outcomes. HCoV-OC43

should be considered in the diagnosis of acute adult respiratory disease while HCoV-NL63 may play a

role in more severe disease involving multiple viruses. Because HCoV-229E occurs infrequently and

Viruses 2012, 4 649

mostly in co-detections, its role in ARIs beyond the common cold remains hard to define. Despite

reports of a role for HCoV-229E in ARI in immunocompromised patients [19], we did not have many

cases of immunocompromise in our population and so we may have missed this role in our study.

5. Conclusions

We have presented the design and application of four sensitive, specific and novel RT-rtPCRs that

allow us to differentiate between peak HCoV prevalence and that of other circulating respiratory

viruses. We observed HCoV-specific differences in co-detection frequencies, monthly peak prevalence

and the sex of the positive patients. Even though many differences were noted in this cross-sectional

study, future respiratory virus studies are needed to confirm and better define these differences through

frequent analysis of cohortees and/or studies conducted over greater periods of time. Such prospective

cohort studies will improve our understanding of the biology of these viruses, and ultimately

improve patient care by better defining discordances between testing methods, study timing and

population characteristics.

Acknowledgments

The study was funded by Queensland Children’s Medical Research Institute Project Grants #10281

and #50028 sponsored by the Children’s Hospital Foundation Queensland. The project was approved

by the Human Research Ethics Committee, Queensland Children's Health Services, Queensland,

Australia (#HREC/06/QRCH/97 and HREC/10/QRCH/95) and the Medical Research Ethics

Committee, University of Queensland (#2008004496 and #2009000039).

Conflict of Interest

The authors do not have a commercial or other association that might pose a conflict of interest.

References

1. Heikkinen, T.; Järvinen, A. The common cold. Lancet 2003, 361, 51–59.

2. Klig, J.E.; Shah, N.B. Office pediatrics: current issues in lower respiratory infections in children.

Curr. Opin. Pediatr. 2005, 17, 111–118.

3. Hayden, F.G. Rhinovirus and the lower respiratory tract. Rev. Med. Virol. 2004, 14, 17–31.

4. Fouchier, R.A.; Rimmelzwaan, G.F.; Kuiken, T.; Osterhaus, A.D.M.E. Newer respiratory virus

infections: human metapneumovirus, avian influenza virus, and human coronaviruses. Curr. Opin.

Infect. Dis. 2005, 18, 141–146.

5. van der Hoek, L.; Sure, K.; Ihorst, G.; Stang, A.; Pyrc, K.; Jebbink, M.F.; Petersen, G.; Forster, J.;

Berkhout, B.; Überla, K. Croup is associated with the novel coronavirus NL63. PloS Med. 2005, 2,

e240.

6. Selwyn, BJ. The epidemiology of acute respiratory tract infection in young children: Comparison

of findings from several developing countries. Rev. Infect. Dis. 1990, 12, S870–S888.

7. Hall, C.B. Respiratory syncytial virus and parainfluenza virus. N. Engl. J. Med. 2001, 344, 1917–

1928.

Viruses 2012, 4 650

8. Syrmis, M.W.; Whiley, D.M.; Thomas, M.; Mackay, I.M.; Williamson, J.; Siebert, D.J.; Nissen,

M.D.; Sloots, T.P. A sensitive, specific and cost-effective multiplex reverse-transcriptase-PCR

assay for the detection of seven common respiratory viruses in respiratory samples. J. Mol. Diagn.

2004, 6, 125–131.

9. Nicholson, K.G.; Kent, J.; Hammersley, V.; Cancio, E. Acute viral infections of upper respiratory

tract in elderly people living in the community: comparative, prospective, population based study

of disease burden. Br. Med. J. 1997, 315, 1060–1064.

10. Ireland, D.C.; Kent, J.; Nicholson, K.G. Improved detection of rhinoviruses in nasal and throat

swabs by seminested RT-PCR. J. Med. Virol. 1993, 40, 96–101.

11. Kuiken, T.; Fouchier, R.; Rimmelzwaan, G.; Osterhaus, A. Emerging viral infections in a rapidly

changing world. Curr. Opin. Biotechnol. 2003, 14, 641–646.

12. Hamre, D.; Kindig, D.A.; Mann, J. Growth and intracellular development of a new respiratory

virus. J. Virol. 1967, 1, 810–816.

13. Tyrrell, D.A.J.; Bynoe, M.L. Cultivation of a novel type of common-cold virus in organ cultures.

Br. Med. J. 1965, 1, 1467–1470.

14. Gorse, G.J.; O'Connor, T.Z.; Hall, S.L.; Vitale, J.N.; Nichol, K.L. Human coronavirus and acute

respiratory illness in older adults with chronic obstructive pulmonary disease. J. Infect. Dis. 2009,

15, 847–857.

15. Principi, N; Bosis, S.; Esposito, S. Effects of coronavirus infections in children. Emerg. Infect.

Dis. 2010, 16, 183–188.

16. Ksiazek, T.G.; Erdman, D.; Goldsmith, C.S.; Zaki, S.R.; Peret, T.; Emery, S.; Tong, S.; Urbani,

C.; Comer, J.A.; Lim, W.; et. al. A novel coronavirus associated with severe acute respiratory

syndrome. N. Engl. J. Med. 2003, 15, 1953–1966.

17. van der Hoek, L.; Pyrc, K.; Jebbink, M.F.; Vermeulen-Oost, W.; Berkhout, R.J.M.; Wolthers,

K.C.; Wertheim-van DIllen, P.M.E.; Kaandorp, J.; Spaargaren, J.; Berkhout, B. Identification of a

new human coronavirus. Nat. Med. 2004, 10, 368–373.

18. Woo, P.C.Y.; Lau, S.K.P.; Chu, C.-M.; Chan, K.-H.; Tsoi, H.-W.; Huang, Y.; Wong, B.H.L.;

Poon, R.W.S.; Cai, J.J.; Luk, W.-K.; et. al. Characterization and complete genome sequence of a

novel coronavirus, coronavirus HKU1, from patients with pneumonia. J. Virol. 2005, 79,

884–895.

19. Gaunt, E.R.; Hardie, A.; Claas, E.C.; Simmonds, P.; Templeton, K.E. Epidemiology and clinical

presentations of the four human coronaviruses 229E, HKU1, NL63, and OC43 detected over 3

years using a novel multiplex real-time PCR method. J. Clin. Microbiol. 2010, 48, 2940–2947.

20. Dijkman, R.; Jebbink, M.F.; Gaunt, E.; Rossen, J.W.; Templeton, K.E.; Kuijpers, T.W. The

dominance of human coronavirus OC43 and NL63 infections in infants. J. Clin. Virol. 2012, 53,

135–139.

21. Severance, E.G.; Bossis, I.; Dickerson, F.B.; Stallings, C.R.; Origoni, A.E.; Sullens, A.; Yolken,

R.H.; Viscidi, R.P. Development of a nucleocapsid-based human coronavirus immunoassay and

estimates of individuals exposed to coronavirus in a U.S. metropolitan population. Clin. Vaccine

Immunol. 2008, 15, 1805–1810.

22. van Elden, L.J.R.; van Kraaij, M.G.J.; Nijhuis, M.; Hendricksen, K.A.W.; Dekker, A.d.W.;

Rozenberg-Arksa, M.; van Loon, A.M. Polymerase chain reaction is more sensitive than viral

Viruses 2012, 4 651

culture and antigen testing for the detection of respiratory viruses in adults with hematological

cancer and pneumonia. Clin. Infect. Dis. 2002, 34, 177–183.

23. Vabret, A.; Mourez, T.; Gouarin, S.; Petitjean, J.; Freymuth, F. An outbreak of coronavirus OC43

respiratory infection in Normandy, France. Clin. Infect. Dis. 2003, 36, 985–989.

24. van Elden, L.J.R.; van Loon, A.M.; van Alphen, F.; Hendriksen, K.A.W.; Hoepelman, A.I.M.; van

Kraaij, M.G.J.; Oosterheert, J.-J.; Schipper, P.; Schuurman, R.; Nijhuis, M. Frequent detection of

human coronaviruses in clinical specimens from patients with respiratory tract infection by use of

a novel real-time reverse-transcription polymerase chain reaction. J. Infect. Dis. 2004, 189, 652–

657.

25. Lau, S.K.P.; Woo, P.C.Y.; Yip, C.C.Y.; Tse, H.; Tsoi, H.-W.; Cheng, V.C.C.; Lee, P.; Tang,

B.S.F.; Cheung, C.H.Y.; Lee, R.A.; So, L.-Y.; Lau, Y.-L.; Chan, K.-H.; Yuen, K.-Y. Coronavirus

HKU1 and other coronavirus infections in Hong Kong. J. Clin. Microbiol. 2006, 44, 2063–2071.

26. Dominguez, S.R.; Robinson, C.C.; Holmes, K.V. Detection of four human coronaviruses in

respiratory infections in children: a one-year study in Colorado. J. Med. Virol. 2009, 81, 1597–

1604.

27. Ren, L.; Gonzalez, R.; Xu, J.; Xiao, Y.; Li, Y.; Zhou, H.; Li, J.; Yang, Q.; Zhang, J.; Chen, L.;

Wang, W.; Vernet, G.; Paranhos-Baccala, G.; Wang, Z.; Wang, J. Prevalence of human

coronaviruses in adults with acute respiratory tract infections in Beijing, China. J. Med. Virol.

2011, 83, 291–297.

28. Kuypers, J.; Martin, E.T.; Heugel, J.; Wright, N.; Morrow, R.; Englund, J.A. Clinical disease in

children associated with newly described coronavirus subtypes. Pediatrics 2007, 119, e70–e76.

29. Venter, M.; Lassauniere, R.; Kresfelder, T.L.; Westerberg, Y.; Visser, A. Contribution of common

and recently described respiratory viruses to annual hospitalizations in children in South Africa. J.

Med. Virol. 2011, 83, 1458–1468.

30. Talbot, H.K.; Crowe, J.E. Jr.; Edwards, K.M.; Griffin, M.R.; Zhu, Y.; Weinberg, G.A.; Szilagyi,

P.G.; Hall, C.B.; Podsiad, A.B.; Iwane, M.; Williams, J.V. Coronavirus infection and

hospitalizations for acute respiratory illness in young children. J. Med. Virol. 2009, 81, 853–856.

31. Milano, F.; Campbell, A.P.; Guthrie, K.A.; Kuypers, J.; Englund, J.A.; Corey, L.; Boeckh, M.

Human rhinovirus and coronavirus detection among allogeneic hematopoietic stem cell

transplantation recipients. Blood 2010, 115, 2088–2094.

32. Hamre, D.; Beem, M. Virologic studies of acute respiratory disease in young adults. V.

Coronavirus 229E infections during six years of surveillance. Am. J. Epidemiol. 1972, 96, 94–106.

33. Hamre, D.; Procknow, J.J. A new virus isolated from the human respiratory tract. Proc. Soc. Exp.

Biol. Med. 1966, 121, 190–193.

34. Pene, F.; Merlat, A.; Vabret, A.; Rozenberg, F.; Buzyn, A.; Dreyfus, F.; Cariou, A.; Freymuth, F.;

Lebon, P. Coronavirus 229E-related pneumonia in immunocompromised patients. Clin. Infect.

Dis. 2003, 37, 929–932.

35. Folz, R.J.; Elkordy, M.A. Coronavirus pneumonia following autologous bone marrow

transplantation for breast cancer. Chest 1999, 115, 901-905.

36. Forgie, S.; Marrie, T.J. Healthcare-associated atypical pneumonia. Semin. Respir. Crit. Care Med.

2009, 30, 67–85.

Viruses 2012, 4 652

37. Birch, C.J.; Clothier, H.J.; Seccull, A.; Tran, T.; Catton, M.C.; Lambert, S.B.; Druce, J.D. Human

coronavirus OC43 causes influenza-like illness in residents and staff of aged-care facilities in

Melbourne, Australia. Epidemiol. Infect. 2004, 133, 273–277.

38. McKean, M.C.; Leech, M.; Lambert, P.C.; Hewitt, C.; Myint, S.; Silverman, M. A model of viral

wheeze in nonasthmatic adults: symptoms and physiology. Eur. Respir. J. 2001, 18, 23–32.

39. Enserink, M. Calling all coronavirologists. Science 2003.

40. Gagneur, A.; Sizun, J.; Vallet, S.; Legrand, M.C.; Picard, B.; Talbot, P.J. Coronavirus-related

nosocomial viral respiratory infections in a neonatal and paediatric intensive care unit: a

prospective study. J. Hosp. Infect. 2002, 51, 61–69.

41. Sizun, J.; Gagneur, A.; Legrand, C.; Baron, M.R. Respiratory coronavirus infections in children.

Pediatr. Infect. Dis. J. 2001, 20, 555–556.

42. Vallet, S.; Gagneur, A.; Talbot, P.J.; Legrand, M.-C.; Sizun, J.; Picard, B. Detection of human

coronavirus 229E in nasal specimens in large scale studies using an RT-PCR hybridization assay.

Mol. Cell. Probe. 2004, 18, 75–80.

43. Sloots, T.P.; McErlean, P.; Speicher, D.J.; Arden, K.E.; Nissen, M.D.; Mackay, I.M. Evidence of

human coronavirus HKU1 and human bocavirus in Australian children. J. Clin. Virol. 2006, 35,

99–102.

44. Chiu, S.S.; Chan, K.H.; Chu, K.W.; Kwan, S.W.; Guan, Y.; Poon, L.L.M.; Peiris, J.S.M. Human

coronavirus NL63 infection and other coronavirus infections in children hospitalized with acute

respiratory disease in Hong Kong, China. Clin. Infect. Dis. 2005, 40, 1721–1729.

45. Woo, P.C.Y.; Lau, S.K.P.; Yuen, K.Y. Clinical features and molecular epidemiology of

coronavirus-HKU1–associated community-acquired pneumonia. Hong Kong Med. J. 2009, 15,

546–547.

46. Arden, K.E.; Nissen, M.D.; Sloots, T.P.; Mackay, I.M. New human coronavirus, HCoV-NL63,

associated with severe lower respiratory tract disease in Australia. J. Med. Virol. 2005, 75, 455–

462.

47. Wang, C.Y.T.; Arden, K.E.; Greer, R.M.; Sloots, T.P.; Mackay, I.M. A novel duplex real-time

PCR for HPIV-4 detects co-circulation of both viral subtypes among ill children during 2008. J.

Clin. Virol. 2012, 54, 83–85.

48. McErlean, P.; Shackelton, L.A.; Lambert, S.B.; Nissen, M.D.; Sloots, T.P.; Mackay, I.M.

Characterisation of a newly identified human rhinovirus, HRV-QPM, discovered in infants with

bronchiolitis. J. Clin. Virol. 2007, 39, 67–75.

49. McErlean, P.; Shackelton, L.A.; Andrewes, E.; Webster, D.R.; Lambert, S.B.; Nissen, M.D.;

Sloots, T.P.; Mackay, I.M. Distinguishing Molecular Features and Clinical Characteristics of a

Putative New Rhinovirus Species, Human Rhinovirus C (HRV C). PLoS One 2008, 3, e1847.

50. Arden, K.E.; Faux, C.E.; O'Neill, N.T.; McErlean, P.; Nitsche, A.; Lambert, S.B.; Nissen, M.D.;

Sloots, T.P.; Mackay, I.M. Molecular characterization and distinguishing features of a novel

human rhinovirus (HRV) C, HRVC-QCE, detected in children with fever, cough and wheeze

during 2003. J. Clin. Virol. 2010, 47, 219–223.

51. Maertzdorf, J.; Wang, C.K.; Brown, J.B.; Quinto, J.D.; Chu, M.; de Graaf, M.; van den Hoogen,

B.G.; Spaete, R.; Osterhaus, A.D.M.E.; Fouchier, R.A.M. Real-time reverse transcriptase PCR

Viruses 2012, 4 653

assay for detection of human metapneumoviruses from all known genetic lineages. J. Clin.

Microbiol. 2004, 42, 981–986.

52. Lu, X.; Holloway, B.; Dare, R.K.; Kuypers, J.; Yagi, S.; Williams, J.V.; Hall, C.B.; Erdman, D.D.

Real-time reverse transcription-PCR assay for comprehensive detection of human rhinoviruses. J.

Clin. Microbiol. 2008, 46, 533–539.

53. Arden, K.E.; Mackay, I.M. Newly identified human rhinoviruses: molecular methods heat up the

cold viruses. Rev. Med. Virol. 2010, 20, 156–176.

54. Arden, K.E.; McErlean, P.; Nissen, M.D.; Sloots, T.P.; Mackay, I.M. Frequent detection of human

rhinoviruses, paramyxoviruses, coronaviruses, and bocavirus during acute respiratory tract

infections. J. Med. Virol. 2006, 78, 1232–1240.

55. Smith, G.; Smith, I.; Harrower, B.; Warrilow, D.; Bletchly, C. A simple method for preparing

synthetic controls for conventional and real-time PCR for the identification of endemic and exotic

disease agents. J. Virol. Methods 2006, 135, 229–234.

56. Hall, T.A. Bioedit: a user-friendly biological sequence alignment editor and analysis program for

Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 98.

57. Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: molecular

evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum

parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739.

58. Zlateva, K.T.; Crusio, K.M.; Leontovich, A.M.; Lauber, C.; Claas, E.; Kravchenko, A.A.; Spaan,

W.J.; Gorbalenya, A.E. Design and validation of consensus-degenerate hybrid oligonucleotide

primers for broad and sensitive detection of corona- and toroviruses. J. Virol. Methods 2011, 177,

174s–183.

59. Dare, R.K.; Fry, A.M.; Chittaganpitch, M.; Sawanpanyalert, P.; Olsen, S.J.; Erdman, D.D. Human

coronavirus infections in rural Thailand: a comprehensive study using real-time reverse-

transcription polymerase chain reaction assays. J. Infect. Dis. 2007, 196, 1321–1328.

60. Prill, M.M.; Iwane, M.K.; Edwards, K.M.; Williams, J.V.; Weinberg, G.A.; Staat, M.A.; Willby,

M.J.; Talbot, H.K.; Hall, C.B.; Szilagyi, P.G.; Griffin, M.R.; Curns, A.T.; Erdman, D.D. Human

coronavirus in young children hospitalized for acute respiratory illness and asymptomatic controls.

Pediatr. Infect. Dis. J. 2012, 31, 235–240.

61. Loeffelholz, M.J.; Pong, D.L.; Pyles, R.B.; Xiong, Y.; Miller, A.L.; Bufton, K.K.; Chonmaitree, T.

Comparison of the FilmArray respiratory panel and Prodesse real-time PCR assays for the

detection of respiratory pathogens. J. Clin. Microbiol. 2011, 49, 4083–4088.

62. Esposito, S.; Bosis, S.; Niesters, H.G.M.; Tremolati, E.; Begliatti, E.; Rognoni, A.; Tagliabue, C.;

Principi, N.; Osterhaus, A.D.M.E. Impact of human coronavirus infections in otherwise healthy

children who attended an emergency department. J. Med. Virol. 2006, 78, 1609–1615.

63. Esper, F.; Ou, Z.; Huang, Y.T. Human coronaviruses are uncommon in patients with

gastrointestinal illness. J. Clin. Virol. 2010, 48, 131–133.

© 2012 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).